ID: 975710598

View in Genome Browser
Species Human (GRCh38)
Location 4:77157304-77157326
Sequence GAGGGTGGGCGCGCGGGGAG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1135
Summary {0: 1, 1: 2, 2: 9, 3: 101, 4: 1022}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975710586_975710598 2 Left 975710586 4:77157279-77157301 CCGCGGCCGGCGTTGCGCCGCGG 0: 1
1: 0
2: 0
3: 3
4: 90
Right 975710598 4:77157304-77157326 GAGGGTGGGCGCGCGGGGAGCGG 0: 1
1: 2
2: 9
3: 101
4: 1022
975710589_975710598 -4 Left 975710589 4:77157285-77157307 CCGGCGTTGCGCCGCGGCGGAGG 0: 1
1: 0
2: 1
3: 5
4: 55
Right 975710598 4:77157304-77157326 GAGGGTGGGCGCGCGGGGAGCGG 0: 1
1: 2
2: 9
3: 101
4: 1022

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975710598 Original CRISPR GAGGGTGGGCGCGCGGGGAG CGG Exonic