ID: 975712940

View in Genome Browser
Species Human (GRCh38)
Location 4:77178660-77178682
Sequence CTGTGGAAGGAGAAGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1596
Summary {0: 1, 1: 1, 2: 9, 3: 128, 4: 1457}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975712940 Original CRISPR CTGTGGAAGGAGAAGGAAGA GGG Intronic
900215887 1:1481415-1481437 CTGTGGAAGGCCAAGGCAGGCGG - Intronic
900223025 1:1519469-1519491 CTGTGGAAGGCCAAGGCAGGCGG - Intronic
900363860 1:2302595-2302617 GTTTGGCAGGAGAAGGACGAGGG + Intronic
900647950 1:3717527-3717549 CTAGGGAAGGAGAAGGCAGGAGG + Intronic
900861040 1:5231581-5231603 CATAGGAAGCAGAAGGAAGAGGG + Intergenic
901310674 1:8267285-8267307 CTTTGGAAGGCCAAGGCAGAAGG - Intergenic
901461781 1:9396319-9396341 CTTTGGAAGGATGAGGCAGAAGG + Intergenic
901988070 1:13091736-13091758 CTGTGGAAGGAAAAAAAAAAGGG - Intergenic
901993742 1:13135031-13135053 CTGTGGAAGGAAAAAAAAAAGGG + Intergenic
902385155 1:16072222-16072244 CTGGGGAAGGGGAAGGTACAGGG - Intronic
902652077 1:17843660-17843682 AAGTGAAAGGAGAAGGAAGGTGG - Intergenic
902672312 1:17983319-17983341 CTGCGGTGGCAGAAGGAAGAGGG + Intergenic
902740000 1:18431219-18431241 CTTTGGAAGGCCAAGGAAGGTGG - Intergenic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
902919448 1:19657412-19657434 CTGTGGGAGGGGGAGGAAGTTGG + Exonic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
903059701 1:20661347-20661369 CTTCGGCAGGAGGAGGAAGATGG - Exonic
903282407 1:22257460-22257482 CTCTGGATCGAGAAGGAGGAAGG - Intergenic
903611023 1:24612816-24612838 CTTTGGAAGGCCAAGGCAGACGG - Intergenic
903632851 1:24789971-24789993 CTGTGGAGGGAAAAGGAGAAGGG + Intronic
903851839 1:26311931-26311953 ATGTGGGTGGAGAAGGGAGAAGG - Intronic
903853286 1:26320938-26320960 CTGGGGCTGGAGAAGGATGATGG + Intergenic
903934091 1:26882872-26882894 CTGAGGCAGGAAAAGGAGGAGGG - Intronic
904051226 1:27640216-27640238 CTGTGGAAGGAAAAGCTGGATGG - Intergenic
904139998 1:28345571-28345593 CTTTGGAAGGCCAAGGCAGATGG + Intergenic
904277418 1:29393506-29393528 GGGTGGGAGGAGAAGGAGGAAGG + Intergenic
904295393 1:29516937-29516959 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295740 1:29518748-29518770 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295752 1:29518808-29518830 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295769 1:29518898-29518920 AAGAAGAAGGAGAAGGAAGAAGG - Intergenic
904610121 1:31721196-31721218 CTGAGGAAGGAGGAGGGAGCTGG + Intergenic
904848834 1:33441545-33441567 AGGAGGAAGGAGAAGGAAGAAGG - Intergenic
904879466 1:33684455-33684477 TCGTGGAGGGGGAAGGAAGAAGG - Intronic
904918043 1:33984545-33984567 CTTTGGGAGGTGGAGGAAGAAGG + Intronic
904998625 1:34650765-34650787 CTGAGGAAGCAGCAGGAAGGAGG + Intergenic
905011245 1:34748302-34748324 CTGTGGGAGGAGAGTGAGGAGGG - Intronic
905047378 1:35016725-35016747 CTTTGGAAGGCCAAGGCAGAAGG + Intronic
905130572 1:35753332-35753354 CTTTGGAAGGACAAGGCAGGAGG - Intronic
905142823 1:35861934-35861956 CTGTGGCTGGAGAAGGAAGAAGG + Intergenic
905224793 1:36472140-36472162 CTGTGGATGGAACAAGAAGAGGG + Intronic
905242675 1:36590971-36590993 CTGGGGAAGGGGATGGAGGAAGG + Intergenic
905300525 1:36983536-36983558 CTGTGAAATGAGAATGATGATGG - Intronic
905411588 1:37773407-37773429 CTTTGGAAGGCCAAGGAAGAAGG + Intergenic
905776777 1:40672934-40672956 CTGTGGAAGGCCAAGGCAGGTGG + Intergenic
905898934 1:41567834-41567856 CTGGGGAAGGTGAAGTCAGATGG - Intronic
906077738 1:43064447-43064469 CTGTGGGAGGCCAAGGAAGGAGG - Intergenic
906085595 1:43130974-43130996 CTGTGCAAGGAACAGAAAGAAGG - Intergenic
906170202 1:43718589-43718611 CTGTTGAAGGAGGGAGAAGAAGG - Intronic
906180828 1:43817431-43817453 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
906180864 1:43817668-43817690 AGAAGGAAGGAGAAGGAAGAAGG - Intronic
906180868 1:43817697-43817719 GAGGAGAAGGAGAAGGAAGAAGG - Intronic
906819334 1:48912836-48912858 CTATGAAAGGAGTAGGAATAGGG + Intronic
907099733 1:51819056-51819078 CTGTGGGAGGCGAAGGCAGGCGG + Intronic
907181480 1:52574052-52574074 CTTTGGAAGGCCAAGGAGGAAGG + Intergenic
907248924 1:53125118-53125140 CTGTGGCAGCACACGGAAGACGG + Intronic
907254416 1:53167675-53167697 CTGTGGAAGGCAAAGGCAGGTGG + Intergenic
907297986 1:53467782-53467804 CTATGGAAGGAGCTGGAGGAAGG - Intergenic
907330069 1:53664939-53664961 CTGTGGCAGGAGGAGGGGGAGGG + Intronic
908236763 1:62154690-62154712 CTTTGAAAGGAGAAATAAGAAGG + Intronic
908376607 1:63548585-63548607 AAGTGGAAGAAGAAGAAAGAGGG - Intronic
908448026 1:64220524-64220546 CTCTGGAAGGAGGGGTAAGAGGG - Intronic
908467447 1:64411564-64411586 CTTTGGAAGGCCAAGGCAGAGGG + Intergenic
908498836 1:64722675-64722697 CAGTGGAGCGAGCAGGAAGATGG + Intergenic
908512771 1:64862518-64862540 CTGTGGAGGGAGCAGGAGGAGGG - Intronic
908526649 1:64994182-64994204 CTTTGGAAGGCCAAGGAAGGCGG - Intergenic
908871524 1:68618552-68618574 CTCTGGAATGAGAGGGTAGAAGG - Intergenic
908897278 1:68914442-68914464 CTGTGGAATGAGAAAGATAAGGG - Intergenic
909170056 1:72283063-72283085 CTGGGGATGGAGAAGGGAGGGGG + Intergenic
909305504 1:74070749-74070771 CTGTTGAAGGGGCAGGAGGAAGG + Intronic
909360260 1:74751053-74751075 CTTTGGGAGGCCAAGGAAGATGG - Intronic
909498281 1:76304367-76304389 GGGTGGATGGAGAAAGAAGATGG - Intronic
910094468 1:83505247-83505269 CTCTGGAAGGAGGAGGAGGCAGG - Intergenic
910144470 1:84063306-84063328 CTTTGGGAGGAGAAGGCAGGTGG - Intergenic
910260423 1:85288680-85288702 CTTTGGAAGGTCAAGGCAGAAGG - Intergenic
910391949 1:86754829-86754851 CCCTGGAGGGAAAAGGAAGAAGG + Intergenic
910462725 1:87466151-87466173 GTATGGAAGGTGATGGAAGAGGG + Intergenic
910542607 1:88378029-88378051 CTAAGGAAGGAAAAGGAAGGAGG + Intergenic
910549601 1:88461111-88461133 ATGTGAAAGGAGCAGGAAGCAGG + Intergenic
910672823 1:89790186-89790208 CTCTGGAGGGGAAAGGAAGAAGG - Intronic
911251910 1:95585906-95585928 CGGTGGTAGGAAAATGAAGATGG - Intergenic
911634772 1:100222744-100222766 CAGTGAAAGGAGGAGAAAGAGGG - Intronic
912787767 1:112620338-112620360 CTGAGGAAGGAGGAGCAAAAGGG - Intronic
912936922 1:114011781-114011803 CTGTGGGAGGCCAAGGCAGAAGG - Intergenic
913008428 1:114658146-114658168 AGGTTTAAGGAGAAGGAAGAAGG + Intronic
913107709 1:115629697-115629719 CTCTGGAACCAGAAGGAAAAGGG - Intergenic
913200963 1:116495156-116495178 CGGAGGAAGGAGCAGGAGGAGGG - Intergenic
913209296 1:116570162-116570184 GTGTGGAGGGTGAAGGAGGATGG + Intronic
913356892 1:117931671-117931693 CTGTAGAAGGAGGTGGTAGATGG + Intronic
913596311 1:120381151-120381173 CTGTGGAGTGATATGGAAGAAGG + Intergenic
914090961 1:144497824-144497846 CTGTGGAGTGATATGGAAGAAGG - Intergenic
914307639 1:146436385-146436407 CTGTGGAGTGATATGGAAGAAGG + Intergenic
914594469 1:149136753-149136775 CTGTGGAGTGATATGGAAGAAGG - Intergenic
914790394 1:150872451-150872473 CTGTGGATGAAGAATGTAGAAGG - Intronic
915155397 1:153871443-153871465 CTTTGGAAGGCCAAGGCAGATGG - Intronic
915244298 1:154545192-154545214 CTCTGGAAGGGGAGAGAAGAGGG + Intronic
915376916 1:155404428-155404450 CTTTGGAAGGACAAGGCAGGAGG + Intronic
915382606 1:155455863-155455885 CTTTGGAAGGAGGAAGAAAAAGG - Intronic
915399484 1:155611898-155611920 CTGGGGAAGGGCAGGGAAGATGG - Intronic
915416597 1:155747478-155747500 CTGGGGAAGGGCAGGGAAGATGG - Intergenic
916066900 1:161143298-161143320 CTTTGGAAGGCCAAGGAAGAAGG + Intergenic
916462760 1:165044374-165044396 CTGTGGTAGGAGAGGAAAGTAGG - Intergenic
916572165 1:166037499-166037521 ATGTGGATAGTGAAGGAAGAGGG + Intergenic
916585133 1:166143639-166143661 ATGTGGAACCAGGAGGAAGAGGG + Intronic
916896450 1:169168305-169168327 CTGAGGAAGCATAAGGCAGAAGG - Intronic
917509978 1:175661862-175661884 CTGTGGAGGCAGGAGAAAGAGGG - Intronic
917599421 1:176559618-176559640 GTATGGTAAGAGAAGGAAGATGG - Intronic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
918081805 1:181213614-181213636 CTGTGGTCTGAGAGGGAAGAAGG + Intergenic
918123019 1:181556484-181556506 CTGTGGGAGGGGGAGGCAGAGGG + Intronic
918148877 1:181781348-181781370 CAGGGAAAGGAGAAGGAAGTGGG - Intronic
918170264 1:181989631-181989653 ATGTGTGAGGAGAAAGAAGAAGG - Intergenic
918221675 1:182441230-182441252 TTGTGGGAGGAGAGGCAAGAGGG + Intergenic
918368232 1:183832181-183832203 CTGAGGAATGAGAATGAAGTGGG + Intronic
918621908 1:186614922-186614944 AGGTGGAAGGAGAACAAAGAAGG + Intergenic
918703829 1:187637389-187637411 TTGGGGATGGAGAAGGAGGAGGG - Intergenic
918708686 1:187700855-187700877 CTGTAGAATGAGAACAAAGAAGG + Intergenic
919321637 1:196048101-196048123 CAGTAGCAGGAGAAAGAAGAGGG + Intergenic
919389418 1:196963587-196963609 CTTTGGAAGGCGGAGGCAGACGG + Intergenic
919631607 1:199965255-199965277 CTTTGGAAGGCCAAGGCAGACGG - Intergenic
919735209 1:200945093-200945115 CTTTGGAAGGCCAAGGCAGAAGG - Intergenic
919745983 1:201009453-201009475 CTGTCGAAGGAGAAGATTGAGGG - Exonic
920201629 1:204263178-204263200 CTGTGACAGGAGAAGGCAGAGGG + Intronic
920215396 1:204358928-204358950 CAGTGGAAGGGGAGGGAAGCGGG - Intronic
920492889 1:206431755-206431777 GAGGGGATGGAGAAGGAAGAGGG + Intronic
920548931 1:206841988-206842010 CTGAGGAAGGAGGTGGAATAAGG + Intronic
920567726 1:206988666-206988688 ATGTGGAAGAAGGAGGTAGAAGG + Intergenic
920612870 1:207458718-207458740 CACTGGAAGGAGAAGGGACAGGG - Intronic
920678715 1:208056802-208056824 CTGTGGAATGAGTGGGCAGAGGG + Intronic
920756216 1:208736436-208736458 ATTTAGAAGGAGTAGGAAGAAGG + Intergenic
920824651 1:209413993-209414015 CTGAGCAAAGAGAAGGAAAACGG + Intergenic
920954626 1:210607029-210607051 CTGGGGGTGAAGAAGGAAGAGGG + Intronic
921067146 1:211631157-211631179 CTGTTGAAAGAGTGGGAAGAGGG + Intergenic
921225497 1:213015489-213015511 GGGTGGAAGGAAGAGGAAGAGGG - Intronic
921334919 1:214076332-214076354 CTGGGAAAGGAAGAGGAAGAAGG + Intergenic
921833176 1:219750957-219750979 CTTTGGAAGGCCAAGGCAGATGG - Intronic
921935640 1:220793902-220793924 ATGTGGCAGGAGCAGGAAGAAGG + Intronic
922117244 1:222625980-222626002 CTTTGGAAGGCCAAGGCAGATGG - Intronic
922184802 1:223264819-223264841 CTGTGGAAGGTGAAAGAAAAAGG + Intronic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
922870760 1:228900161-228900183 CTTTGAAAGCAGAAAGAAGATGG - Intergenic
922993537 1:229937829-229937851 CCGGGGATGGAGAAGGAAGCAGG + Intergenic
923640791 1:235758294-235758316 CTGGGGTAGCAGAAGGAAAATGG + Intronic
923665267 1:235993410-235993432 GTGGGGAAGGAGAAAGAAGAGGG + Intronic
923695125 1:236241298-236241320 CTGTGGGAGGCCAAGGCAGACGG + Intronic
923713570 1:236406195-236406217 CTGTGATAGGAGGAGGGAGAAGG + Intronic
924093616 1:240527571-240527593 CTGAGGAAGGAGAGGGACAAGGG + Intronic
924440768 1:244083398-244083420 CTGTTGAAAGAGAAAGAAGTGGG - Intergenic
924728760 1:246693036-246693058 CTTTGGAAGGCCAAGGAGGAAGG - Intergenic
1062789662 10:294201-294223 CCTTGGAAGAAGATGGAAGAGGG - Intronic
1062859745 10:802310-802332 CTGTGGGAGGCTAAGGCAGAAGG - Intergenic
1062876931 10:950017-950039 CTGTGGAAGGCCAAGGAGGGTGG - Intergenic
1063120627 10:3103401-3103423 CTTTGGAAGGCCAAGGCAGAAGG + Intronic
1063135416 10:3212313-3212335 CTTTGGAAGGCCAAGGCAGATGG - Intergenic
1063224662 10:4004486-4004508 CTGTTGAATGAGAAGGCTGAAGG + Intergenic
1063650981 10:7936589-7936611 CTGTGGAGGGAGCAGGCAGTGGG - Intronic
1063945425 10:11171513-11171535 CTGGGGAATGAACAGGAAGAAGG + Intronic
1064275755 10:13903483-13903505 CTTTGGAAGGTGAAGGCAGGAGG + Intronic
1064769403 10:18708415-18708437 CTTTGGGAGGATAAGGGAGACGG + Intergenic
1065052783 10:21812910-21812932 CTGTGGAAGGAGACTGCACAAGG - Intronic
1065070675 10:22021056-22021078 CCTTGGAAGCAAAAGGAAGAAGG + Intergenic
1065261280 10:23926113-23926135 CTCAGGAAAAAGAAGGAAGAAGG + Intronic
1065743051 10:28814378-28814400 CTTTGGAAGGATAAGGCAGGAGG - Intergenic
1066292398 10:34026395-34026417 GGGTGGAAAGAGAAAGAAGAGGG - Intergenic
1066504068 10:36023787-36023809 CTGAAGGAAGAGAAGGAAGAAGG - Intergenic
1066609320 10:37222259-37222281 CTGGGGAAGGTGAAGAAACATGG - Intronic
1066746456 10:38606480-38606502 CTGGGGCAGGGGAAGGAAAATGG + Intergenic
1067121981 10:43480657-43480679 CTTTGGAAGGCCAAGGAAGGTGG - Intronic
1067431846 10:46250468-46250490 CTGTGGGAGGAGGGGGCAGATGG - Intergenic
1067441574 10:46311710-46311732 CTGTGGGAGGAGGGGGCAGATGG + Intronic
1067659406 10:48223291-48223313 GTGTGGAAGGAGAAGCAGTAGGG + Intronic
1067695981 10:48535996-48536018 CTGTGGAAGGAGAAAGGCGCAGG + Intronic
1069718398 10:70535008-70535030 CACAGGAAGGACAAGGAAGAGGG + Intronic
1069718518 10:70535587-70535609 AAGAGGAAGGAGAAGGAAGGAGG - Intronic
1070039112 10:72757407-72757429 TTGGGGAAGTAGGAGGAAGAAGG - Intronic
1070050766 10:72887389-72887411 TGGTGGAGGGAGAAGGAAGTGGG - Exonic
1070161307 10:73868258-73868280 CAGAGGAAGCAGCAGGAAGAAGG + Intronic
1070171695 10:73937855-73937877 CTGGGGAAGGAGGAGGATGTTGG + Intergenic
1070205780 10:74259698-74259720 CTTTGGGAGGCGAAGGCAGACGG - Intronic
1070264802 10:74892122-74892144 CTTTGGGAGGACAAGGAAGGAGG + Intronic
1070319516 10:75343984-75344006 TTGTGGAGGGGAAAGGAAGATGG + Intergenic
1070342335 10:75509378-75509400 CTGTGGAAGCAGAAAGTAAAAGG - Intronic
1070440363 10:76436910-76436932 AGGTGGAGGGAGAAGGAAGGTGG - Intronic
1071074333 10:81732877-81732899 ATGGGGTAGGAGAAGGGAGATGG - Intergenic
1071179430 10:82965490-82965512 CTTTGGAAGGCAAAGGCAGATGG + Intronic
1071319441 10:84438491-84438513 CTCTGGAAGGGCAGGGAAGAAGG - Exonic
1072578777 10:96722266-96722288 CTTTGGGGAGAGAAGGAAGAGGG - Intergenic
1072613046 10:97031681-97031703 CGGAGGAAGGAGATGGAGGAAGG + Intronic
1073034875 10:100557009-100557031 CTGGGGCAGGAAAAGCAAGATGG + Exonic
1073371659 10:102995189-102995211 AAGAGGAAGGAGGAGGAAGAGGG - Intronic
1073390170 10:103169371-103169393 CTTTGGAAGGACAAGGCAGGAGG + Intronic
1073513879 10:104060315-104060337 ATGTGCCAGGAGAAGGGAGAGGG + Intronic
1073702944 10:105950674-105950696 CTGTGGAATGAAAAAGAAAATGG + Intergenic
1074202938 10:111256058-111256080 CTCTAGAAGGAGGAGGAAGAGGG + Intergenic
1074203280 10:111258589-111258611 CTGTGGAGGGCCAAGCAAGATGG - Intergenic
1074351827 10:112745174-112745196 TTGTGGAGAGAGTAGGAAGAGGG + Intronic
1074972547 10:118551034-118551056 CTGTGGAATGATAAGCATGATGG + Intergenic
1075062489 10:119266631-119266653 CTGTGGCTGGAGGAGGAAGCGGG + Intronic
1075291800 10:121237106-121237128 CTGTGGATGTAGGAGGAAGTGGG + Intergenic
1075309113 10:121396957-121396979 GTATGGAAGGAAACGGAAGAGGG + Intergenic
1075396367 10:122130582-122130604 AGGTGGAAGAGGAAGGAAGAGGG - Intronic
1075445820 10:122512110-122512132 CTGTGGGGGTAGCAGGAAGAGGG + Intronic
1075585430 10:123653782-123653804 ATGGGGAAGGGGAAGGGAGAAGG + Intergenic
1075802342 10:125160925-125160947 CCGGGGAAGGAGAAGGAAAACGG + Intronic
1075842518 10:125517241-125517263 CTGTGGAAAGTGTTGGAAGATGG + Intergenic
1076071167 10:127490963-127490985 CTGGGGAGGGGGAGGGAAGAAGG - Intergenic
1076121659 10:127941247-127941269 ATGGGGAAGGAGTAGGCAGAGGG - Intronic
1076861705 10:133141021-133141043 ATGTGGAAGGAGAGGGACGGTGG - Intergenic
1076995146 11:294099-294121 GTGTGGACGGAGAATGCAGACGG + Exonic
1077243613 11:1524977-1524999 CTGGGGAAGGGGAAGGAAGGTGG + Intergenic
1077260619 11:1617638-1617660 CTTTGGGAGGTTAAGGAAGAAGG - Intergenic
1077988397 11:7378557-7378579 CAGTTGATGGAGATGGAAGAGGG + Intronic
1078049385 11:7948519-7948541 CTGTGGAAGGGAAGGAAAGAAGG - Intergenic
1078609337 11:12806521-12806543 CCCTGGGAGGAGGAGGAAGATGG + Intronic
1078683207 11:13500229-13500251 TTGTGGATGGAGAGGGAAAATGG + Intergenic
1079182155 11:18203507-18203529 AAGTGGAAGGAGGAAGAAGAAGG + Intronic
1079343290 11:19630641-19630663 CTTTGGGAGGCCAAGGAAGATGG + Intronic
1079652879 11:22951763-22951785 CTGAGAAAGAAGAAAGAAGATGG - Intergenic
1079750846 11:24194844-24194866 CTTTGGAAGGCCAAGGAGGATGG + Intergenic
1079986974 11:27209885-27209907 GTGTGTAAAGAGGAGGAAGATGG + Intergenic
1080564227 11:33493306-33493328 CTATGGCAGAAGATGGAAGAAGG - Intergenic
1080856628 11:36117197-36117219 ATCTGGAAGGAAAAGGAGGAAGG + Intronic
1080873576 11:36257796-36257818 CTGTGGAGGGTGGAGGCAGATGG + Intergenic
1081567632 11:44269856-44269878 CTGAGGAAGGAGCGGAAAGACGG - Intronic
1081585403 11:44380526-44380548 CTGTGCAAGGTAAAGGGAGAGGG + Intergenic
1081623176 11:44631064-44631086 TGGGGGAAGGAGAAGAAAGAGGG + Intergenic
1081864613 11:46352651-46352673 CTGTTCAAGGAGGAGGCAGAGGG - Intronic
1081994032 11:47352306-47352328 CTGTGGAAGGTGAAGGCAATGGG + Intronic
1082655838 11:55856277-55856299 CTGTGGAGGGAAGAAGAAGAGGG + Intergenic
1082798686 11:57397563-57397585 CTATGGTAAGAGGAGGAAGAGGG - Intronic
1083043904 11:59714837-59714859 CAGAGGGAGGAGAAGGGAGATGG - Intronic
1083153085 11:60805778-60805800 ATGGAGACGGAGAAGGAAGAGGG - Intergenic
1083551846 11:63595996-63596018 CTGTGGGAGGCCAAGGAAGGCGG + Intronic
1084202625 11:67571427-67571449 CTTTGGAAGGACAAGGCAAAAGG - Intergenic
1084276672 11:68055147-68055169 CTTTGGAAGGCCAAGGCAGACGG + Intronic
1084300192 11:68244650-68244672 CTTTGGAAGGCTAAGGCAGAAGG - Intergenic
1084436838 11:69147739-69147761 TCCTGGAAGGAAAAGGAAGAGGG + Intergenic
1084463241 11:69307838-69307860 CTGAGCTGGGAGAAGGAAGATGG - Intronic
1084681116 11:70666982-70667004 CTGTGGAAGGTGAAGGGGGTGGG + Intronic
1084937020 11:72592317-72592339 CTGGGGAGGGAGGAGGAAGGAGG - Intronic
1085056299 11:73406078-73406100 GTGGGGAAGGAGAGGGAAGAAGG - Exonic
1085178052 11:74507829-74507851 GTGAGGAAGGTGAAGGAAGTGGG - Intronic
1085325592 11:75604098-75604120 GTGAGGAAGGAGAAGTATGAAGG - Intronic
1085405541 11:76259666-76259688 CAGAGGAAGAGGAAGGAAGAAGG + Intergenic
1085713354 11:78850690-78850712 AGGTGGAAGGAGAAAGAGGATGG + Intronic
1085849764 11:80106456-80106478 CTGGGGAAGAATAAGAAAGAGGG + Intergenic
1086571603 11:88291330-88291352 GGAAGGAAGGAGAAGGAAGAAGG + Intergenic
1086571606 11:88291347-88291369 AGAAGGAAGGAGAAGGAAGAAGG + Intergenic
1086571613 11:88291385-88291407 GGAAGGAAGGAGAAGGAAGAAGG + Intergenic
1086588923 11:88488567-88488589 AAGTTGAAGGAGATGGAAGAAGG - Intergenic
1086832615 11:91584035-91584057 CTGTGGGAGGGCAAGGAACAAGG - Intergenic
1086881002 11:92153118-92153140 ATGGGGAAGGTGAAAGAAGAAGG - Intergenic
1087174695 11:95085890-95085912 CTTTGGAAGGCCAAGGCAGATGG + Intergenic
1087194369 11:95290539-95290561 CTGTTGAAGGAGAGGGAAAATGG + Intergenic
1087727929 11:101743527-101743549 ATATGGAAACAGAAGGAAGAAGG + Intronic
1088140490 11:106609910-106609932 GTGTGGAAGTAGTGGGAAGAAGG - Intergenic
1088150708 11:106741478-106741500 GTATCAAAGGAGAAGGAAGAAGG + Intronic
1088230518 11:107669380-107669402 CTGTGGAAGGAGAAACACGCAGG + Intergenic
1088339330 11:108745128-108745150 GAGTGGAAGGAGAAGGGAGAAGG - Intronic
1088430203 11:109750424-109750446 CTGAGGAAGGGGACAGAAGATGG - Intergenic
1088454808 11:110022469-110022491 CTGTGGAAGGAAAGGGGAGATGG - Intergenic
1088680452 11:112237096-112237118 CAGTGGAAATAGATGGAAGAAGG + Intronic
1088867256 11:113860566-113860588 CTTTGGAAGGTGAAGGCAGGCGG + Intronic
1089156357 11:116405911-116405933 CGGTGGAGGGAGGAGAAAGAAGG + Intergenic
1089187087 11:116625442-116625464 CTGTGGAAGGATAAGGTGGAAGG + Intergenic
1089279958 11:117366996-117367018 CTGTGAAAGGAGGAGACAGAAGG + Intronic
1089654073 11:119934438-119934460 CTGTGGTAGGAAGAGGCAGAAGG - Intergenic
1089690293 11:120182902-120182924 ATGTGGCAGGAGGAGGGAGAAGG + Intronic
1089778844 11:120858914-120858936 CTGTGGAAGGACAAGGAAGGGGG - Intronic
1089802319 11:121043685-121043707 CTGGGAGTGGAGAAGGAAGATGG - Intronic
1090345835 11:126069691-126069713 CTGTGGAAGGCCAAGGTAGGTGG + Intergenic
1090464628 11:126923293-126923315 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090464635 11:126923344-126923366 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090639307 11:128716891-128716913 CAGTGCAGGGAGGAGGAAGAAGG + Intronic
1090652487 11:128819561-128819583 CAGTGGGAGGGGGAGGAAGAGGG + Intergenic
1090749997 11:129738163-129738185 ATCTGGAAGGAGCAGGAAGAAGG - Intergenic
1090908081 11:131094750-131094772 CTGTGGAAAGAGAAGGAGTTGGG + Intergenic
1091319986 11:134642524-134642546 CTGTGGAAGGTGCAGGAAGAGGG - Intergenic
1091386749 12:100826-100848 CGGTGGAGGGAGAAGGAAAGAGG + Intronic
1091579720 12:1776757-1776779 CTGCAGCATGAGAAGGAAGATGG + Intronic
1091593112 12:1857098-1857120 ATGTGTAGGAAGAAGGAAGAAGG + Intronic
1092055045 12:5501808-5501830 ATGTGGAAGGCGAAAGAGGAAGG + Intronic
1092307259 12:7314140-7314162 ATGTAGAAGATGAAGGAAGAAGG + Intronic
1092490895 12:8943911-8943933 CTGAGGAGGGACAAGGAAAATGG + Intronic
1092495961 12:8995463-8995485 GTGGGGAGGGAGAGGGAAGAAGG - Intronic
1092546456 12:9456192-9456214 CTTTGGGAGGACAAGGTAGAAGG - Intergenic
1092550217 12:9490302-9490324 AGGTGGAAGGAGAAGGAAGAAGG + Intergenic
1093378473 12:18460328-18460350 CTTTGGAAGGCCAAGGAGGACGG + Intronic
1093508399 12:19896765-19896787 AGGAGGAAGGAGGAGGAAGAAGG - Intergenic
1094201878 12:27803417-27803439 CTGATGGAGGAGAAGGAGGATGG + Intergenic
1094499316 12:31008383-31008405 ATGAGGAAGGACAGGGAAGAGGG - Intergenic
1094506485 12:31065882-31065904 CTTTGGGAGGACAAGGTAGAAGG + Intergenic
1094521591 12:31196071-31196093 AGGTGGAAGGAGAAGGAAGAAGG - Intergenic
1094650160 12:32368449-32368471 CTGTGGAAGGCCGAGGCAGAGGG + Intronic
1094739799 12:33275567-33275589 CTGTGGGAGGCCAAAGAAGATGG - Intergenic
1094838073 12:34331516-34331538 CTGTGGAAGGAAAAAAAAAATGG - Intergenic
1094846771 12:34364787-34364809 TTGTGGAAGGAAAAGAAAAAGGG - Intergenic
1094848436 12:34371688-34371710 TTGTGGAAGGAAAAGAAAAACGG - Intergenic
1095052087 12:37563426-37563448 CTGTGGGAGGCCAAGGAAGGTGG + Intergenic
1095100374 12:38175819-38175841 CTGGGGAACTAGGAGGAAGAAGG - Intergenic
1095800404 12:46266454-46266476 CAGCGGAAGGAACAGGAAGAAGG - Intronic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1096586594 12:52626647-52626669 CTGTGAAAGGAGAAAGGATAAGG + Intergenic
1096610639 12:52798978-52799000 TGGTGGAAGAAAAAGGAAGAAGG + Intergenic
1097068773 12:56339636-56339658 CAGTGAATGGAGTAGGAAGAGGG + Intronic
1097110769 12:56656340-56656362 CTTTGGAAGGCCAAGGAAGATGG - Intergenic
1097291805 12:57922946-57922968 CTTTGGAAGGCCAAGGTAGATGG - Intergenic
1097485688 12:60196447-60196469 CTTTGGAAGGCCAAGGCAGAAGG + Intergenic
1097548904 12:61041656-61041678 CTGTGGAATGGAAAGGTAGAGGG - Intergenic
1097845735 12:64363528-64363550 CTTTGCGAGGAGGAGGAAGAGGG + Intronic
1097937790 12:65272977-65272999 ATGTGGAATGTGAAAGAAGAAGG - Intergenic
1098771902 12:74562795-74562817 CTTTGGAAGGCCAAGGCAGAAGG - Intergenic
1098857787 12:75672401-75672423 CTGTGCAAGGAGAGAGGAGAAGG + Intergenic
1098900684 12:76109149-76109171 CTTTGGAAGGCCAAGGCAGATGG + Intergenic
1098953767 12:76667987-76668009 TGGTGGGAGGGGAAGGAAGAGGG - Intergenic
1099231624 12:80032518-80032540 TTGAGGAAGGAGTAGGAAGAGGG + Intergenic
1099894844 12:88632275-88632297 CTTTGGGAGGCGAAGGCAGAAGG - Intergenic
1099924120 12:88996679-88996701 CTGTGGAAGGAGAGAGTAAAAGG - Intergenic
1099950044 12:89291825-89291847 CTGAAGAAGGAGAAAGAAGAGGG + Intergenic
1100480910 12:94978026-94978048 CTGTTCAAGGAAAAGCAAGAAGG + Intronic
1100604811 12:96142925-96142947 TTGGGGAAGGAGAAGAGAGAGGG + Intergenic
1100742720 12:97612237-97612259 CTTTGGGAGGTCAAGGAAGAGGG + Intergenic
1100840184 12:98605004-98605026 CTTTGGAAGGCCAAGGCAGAAGG - Intronic
1101149562 12:101872065-101872087 CTTTGGGAGGCCAAGGAAGAAGG - Intergenic
1101193764 12:102361687-102361709 GAGAGGAAGAAGAAGGAAGAAGG + Intergenic
1101320284 12:103667526-103667548 CCAGGGAAAGAGAAGGAAGAGGG + Intronic
1101321640 12:103678099-103678121 CTGTGGAAAGAGGTGGAAGCAGG - Intronic
1101676433 12:106921220-106921242 CACTGGAAAGAGAATGAAGAGGG - Intergenic
1102167485 12:110818322-110818344 CTTTGGAAGGCCAAGGCAGATGG - Intergenic
1102230367 12:111257636-111257658 AGGAGGAAGGAGGAGGAAGAGGG - Intronic
1102257970 12:111427140-111427162 CTTTGGGAGGCGAAGGCAGATGG + Intronic
1102329908 12:112020129-112020151 GGGTGGAATGTGAAGGAAGAGGG - Intronic
1102383544 12:112487375-112487397 CTTTGGAAGGACAAGGCAGGTGG - Intronic
1102418640 12:112786531-112786553 CTCTTAAAGGAGAAGGAGGAGGG + Intronic
1102618019 12:114171750-114171772 CTGGGGTAGGAAGAGGAAGAGGG + Intergenic
1102822705 12:115921863-115921885 CTTTGGAAGGCCAAGGCAGATGG + Intergenic
1102870147 12:116407897-116407919 CTTTGGAAGGCCAAGGCAGAAGG - Intergenic
1102928343 12:116843616-116843638 CAGAGGAAGGGGGAGGAAGAAGG - Intronic
1102984244 12:117265511-117265533 CTGTGGGAGGAGAGGGGACAGGG + Intronic
1103118794 12:118362772-118362794 CTTTGGAAGGCCAAGGTAGATGG + Intronic
1103257007 12:119550489-119550511 CTTTGGGAGGAAAAGAAAGAAGG + Intergenic
1104373521 12:128244542-128244564 CTCTGGAGGCTGAAGGAAGATGG + Intergenic
1104416665 12:128601461-128601483 CAGAGAAAGGAGGAGGAAGATGG + Intronic
1105502394 13:20983809-20983831 GTGTAGAAGGAAAAGGAAGGAGG + Intronic
1105524174 13:21160290-21160312 CTGACAAAGGAGGAGGAAGACGG + Intronic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1105562078 13:21501777-21501799 CTGTGGCAGGAAAAGAAGGAGGG - Intronic
1105648253 13:22344723-22344745 CTTTGGTCGGAGAAGGAAGGCGG - Intergenic
1105803791 13:23936887-23936909 CTTTGGGAGGTGAAGGAAAATGG + Intergenic
1105883677 13:24624740-24624762 CTGTGAAAGAAAAAGGAACATGG + Intergenic
1105887934 13:24658570-24658592 CTTTGGAAGGCCAAGGCAGAAGG + Intergenic
1106287366 13:28329376-28329398 CTGTGGAAGGAGATCAAAAAGGG + Intronic
1106299927 13:28454088-28454110 CTGGGGAAAGAGCAGTAAGAGGG - Intronic
1106506685 13:30376575-30376597 TTGAGGAAGGAAAAGGAAGAGGG + Intergenic
1106560438 13:30840939-30840961 CTGTGGAGGAACAATGAAGAAGG + Intergenic
1106870576 13:34014552-34014574 GCGTGGAAAGAGAAGGAAAATGG + Intergenic
1107697621 13:43015850-43015872 CAGTGGAAGGAGAGGGGAGGAGG - Intergenic
1107838188 13:44429082-44429104 CAGTGGAAGGAGAAGGAGCCTGG + Intergenic
1108315034 13:49228505-49228527 CTGGGGCAGGAGCCGGAAGATGG + Intergenic
1108510717 13:51153235-51153257 CTATGGAGGGAGCAGGAAAAAGG - Intergenic
1108904726 13:55453981-55454003 CTTTGGAAGGACAAGGTAGGTGG + Intergenic
1109961164 13:69633965-69633987 ATGGGGAAAGAGAAGGAAGTGGG - Intergenic
1110106296 13:71680356-71680378 CTTTGGAAGGCCAAGGCAGATGG + Intronic
1110560767 13:76908770-76908792 CTGGGGAAGCAGAAAAAAGATGG - Intergenic
1110668149 13:78142274-78142296 GTGTGGGAGTTGAAGGAAGAAGG + Intergenic
1110700387 13:78540626-78540648 CTCTGCAAGAAGAAGGAGGATGG - Intergenic
1111598521 13:90441991-90442013 GTGTGAAAGGAGAAGGAGGAGGG - Intergenic
1111760442 13:92457405-92457427 CTGGGGAAGGAGAAGGGTGCTGG - Intronic
1111960231 13:94802058-94802080 CTTTGGAAGGCCAAGGAGGAAGG + Intergenic
1112044483 13:95582579-95582601 CTGGGGAAGGAGTGGGAAGCAGG - Intronic
1112093246 13:96105256-96105278 CTGTGGAAAGACATGGAAGTAGG + Intronic
1112111650 13:96306452-96306474 CTTTGGGAGGCGAAGGCAGATGG - Intronic
1112119453 13:96393730-96393752 CTGTGGCAAGGGAAGGGAGATGG + Intronic
1112400274 13:99071377-99071399 CTTTGGAAGGCCAAGGTAGATGG - Intronic
1112522375 13:100108150-100108172 CTAGGGAAGGGAAAGGAAGAAGG + Intronic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1112749535 13:102567954-102567976 CTGTGGAAGAAGCTGGGAGAGGG - Intergenic
1113039860 13:106092741-106092763 CTGTGAAAGAATAAGGTAGAGGG - Intergenic
1113403629 13:110018474-110018496 CATTGGAAGGAGGAGGAGGAGGG - Intergenic
1113540639 13:111105639-111105661 CTCTGGAAGGACAAGGTAGGAGG + Intergenic
1114426441 14:22627808-22627830 ATGTGTAAGGAAAGGGAAGAGGG - Intergenic
1114490834 14:23100901-23100923 CTGGGGAAGGAACAGCAAGAAGG - Intergenic
1114899793 14:27043415-27043437 CTGTGGGTGAAGAAGGAAAAGGG + Intergenic
1115081739 14:29461440-29461462 CTTTGGAAGGAGAAAAAAGCTGG - Intergenic
1115095383 14:29629943-29629965 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1115225268 14:31095660-31095682 CTTTGGAAGGCGAAGGCAGATGG - Intronic
1115305258 14:31927372-31927394 CAGTGGAAGGAGAAGGAGTTGGG - Intergenic
1115383603 14:32769289-32769311 CTGTGGGAGGAGGAGGCAGGCGG - Intronic
1115653754 14:35423174-35423196 CTTTGGAAGGCCAAGGCAGATGG - Intergenic
1115742146 14:36399630-36399652 TGGTAGAAGGAGAGGGAAGAAGG - Intergenic
1116058307 14:39891247-39891269 CTGAGGAAGGAGAACAAAGGTGG + Intergenic
1116329101 14:43573843-43573865 CTGTGGAAGGAGGATGAATTGGG + Intergenic
1116443910 14:44986538-44986560 CTTTGGAAGGCCAAGGAAGAAGG - Intronic
1116696094 14:48180542-48180564 GAGAGGAAGGAAAAGGAAGAAGG - Intergenic
1116779837 14:49224902-49224924 CTGTGGAAGAAGAGAAAAGATGG + Intergenic
1116907240 14:50415913-50415935 CTTTGGAAGGCCAAGGCAGAAGG - Intronic
1117183106 14:53212862-53212884 TTTTGGGAGGAGAAGGAACAGGG + Intergenic
1117232851 14:53739438-53739460 TTGAGGAAGGAGAAGGAGCAAGG + Intergenic
1117359389 14:54958368-54958390 CTGTGGGAGGCCAAGGCAGACGG - Intronic
1117360041 14:54963866-54963888 CTTTGGAAGGCCAAGGCAGAGGG + Intronic
1117473562 14:56071015-56071037 ATGTGGAAGGAGAAGAAGGCAGG + Intergenic
1117731440 14:58726519-58726541 CTTTGGAAGGCTAAGGCAGAAGG - Intergenic
1117778948 14:59212564-59212586 CAGTGGAAGGAATAGGAAGTGGG - Intronic
1118072991 14:62266292-62266314 CTGTGGAAGGAAAAGGAAGGAGG - Intergenic
1118092608 14:62498694-62498716 TGGTGGAAGGAGAAGCAAGGAGG + Intergenic
1118201323 14:63676650-63676672 CTTTGGAAGGCCAAGGAGGATGG - Intergenic
1118592288 14:67410732-67410754 CTTTGGGAGGGGAATGAAGAGGG - Intronic
1118769839 14:68935352-68935374 CTCTGACAGGAGAAGGGAGAGGG - Intronic
1118894766 14:69936536-69936558 CAGTGGGAGGGGAAGGAGGAAGG - Intronic
1119222545 14:72920825-72920847 CTTTGGAAGGCCAAGGAAGGTGG - Intergenic
1119443776 14:74647303-74647325 CAGAGGAAGGAGAAGGGAGTCGG - Intergenic
1119573029 14:75693119-75693141 CTGAAAGAGGAGAAGGAAGAAGG + Intronic
1119614652 14:76091184-76091206 CGGAGGCCGGAGAAGGAAGAAGG - Intergenic
1119992897 14:79219371-79219393 CTTTGGGAGGCCAAGGAAGAAGG - Intronic
1120431327 14:84419369-84419391 CTGTGCAAGGAGAAAGTAGCAGG - Intergenic
1120591513 14:86379392-86379414 GTGTGGAAGGAGAAAAGAGAGGG + Intergenic
1120808724 14:88780814-88780836 CTTTGGGAGGACAAGGCAGATGG - Intronic
1121372680 14:93374788-93374810 CTTTGGAAGGCCAAGGCAGAAGG - Intronic
1121492840 14:94372246-94372268 GTACAGAAGGAGAAGGAAGAGGG - Intergenic
1121589377 14:95090603-95090625 CTGTGGAAGTAGTAGGAAAGGGG - Exonic
1121593267 14:95137174-95137196 AAGGGGAAGGAGAAGGAAAAGGG + Intronic
1121644007 14:95505267-95505289 CTGGGGAAGGTGGAGCAAGAGGG + Intergenic
1121797087 14:96744184-96744206 CTGTGGGAAGAGAAGTAAGGAGG + Intergenic
1121831385 14:97055270-97055292 ATGAAGAAGGAGAAGAAAGAAGG - Intergenic
1121880853 14:97499256-97499278 ATTTAGAAGAAGAAGGAAGAAGG + Intergenic
1121978166 14:98425691-98425713 CTGTTGCAGGAGAAGAATGAAGG - Intergenic
1122091136 14:99341322-99341344 CTGGGGAAGGACGAGGAAGAAGG + Intergenic
1122134285 14:99623957-99623979 TTATTGAAGGAAAAGGAAGATGG + Intergenic
1122154549 14:99742378-99742400 CTGGGGATGGAGAAGGTACATGG + Intronic
1122172150 14:99885751-99885773 CAGTGAAAGGAGGAGGAAGAGGG + Intronic
1122308250 14:100779021-100779043 CTGTGGTAGGAGAGGGAGGGAGG - Intergenic
1122712697 14:103671612-103671634 CTGTGGGAGGCTAAGGCAGATGG - Intronic
1122770712 14:104096454-104096476 CTCTGGAGGGACAAGGGAGACGG - Intronic
1122825965 14:104370605-104370627 CTGTGGAAAGAGCGTGAAGACGG - Intergenic
1122952813 14:105055084-105055106 CTTTGGAAGGACAAGGCAGGTGG + Intronic
1122958785 14:105085088-105085110 CTGTGGGAAGTGAAGGCAGAGGG - Intergenic
1123113057 14:105882019-105882041 CTCTGGGAGGAGAAGCAGGATGG - Intergenic
1123115406 14:105892169-105892191 CTCTGGGAGGAGAAGCAGGATGG - Intergenic
1123119657 14:105910887-105910909 CTCTGGGAGGAGAAGCAGGATGG - Intergenic
1123499752 15:20868921-20868943 CTGTGGATGGGGGAGGGAGAGGG + Intergenic
1123593225 15:21879884-21879906 CTGTGGATGGGGGAGGGAGAGGG + Intergenic
1123684287 15:22786532-22786554 GTGGGGGAGGAGCAGGAAGAGGG - Intronic
1123752827 15:23371996-23372018 CTGTGGAAGGACCAGGGAAACGG - Intergenic
1124371281 15:29106247-29106269 GTGTGGAAGGAGCAGGAACCAGG + Intronic
1124694643 15:31853814-31853836 TTGTTGAAGAAGAAGGATGAGGG - Intronic
1125205284 15:37147455-37147477 CTGTGGGTGGAGAAGTAAAAAGG - Intergenic
1125214163 15:37250615-37250637 CTGAGTAAGGAGACAGAAGATGG - Intergenic
1125405323 15:39347089-39347111 CTTTGGGAGGCGAAGGCAGACGG + Intergenic
1125409901 15:39395254-39395276 CAATGGAAGGAGAAAGAGGAAGG + Intergenic
1126314582 15:47356628-47356650 CTGTGAAATGAGAGGGATGAAGG - Intronic
1126524019 15:49630185-49630207 TGGTGAGAGGAGAAGGAAGAAGG + Intronic
1126828471 15:52574864-52574886 CTTTGGGAGGACAAGGTAGATGG - Intergenic
1126935950 15:53708019-53708041 ATGTGGAAGGTGAAGGCAGAGGG - Intronic
1126942397 15:53780941-53780963 CTGTGAAAGCAGCTGGAAGAAGG - Intergenic
1126951554 15:53887175-53887197 GTGTGGAAGGAGAAGGGTTATGG + Intergenic
1127121829 15:55778532-55778554 CTTTGGAAGGCCAAGGCAGAAGG - Intergenic
1127255704 15:57290982-57291004 CTGTGGAATGCCAAGGGAGAAGG - Intronic
1127269870 15:57390796-57390818 CTGTGGGAGGAGCAGAAGGATGG + Intronic
1127581770 15:60345381-60345403 CTTTGCAAAGAGAAGGAAAAGGG - Intergenic
1127831942 15:62758710-62758732 CTTTAGAAGGAAAAGGAAAAAGG + Intronic
1128095618 15:64952324-64952346 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128095631 15:64952461-64952483 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128095677 15:64952885-64952907 AGAAGGAAGGAGAAGGAAGAAGG - Intronic
1128095821 15:64954599-64954621 AAGAGGAAGGAGGAGGAAGAAGG - Intronic
1128160521 15:65420746-65420768 CTGTAGAAGGAGAATGATGATGG - Intronic
1128179943 15:65593303-65593325 GTGTGGCAGGAAAAGGAAAAAGG + Intronic
1128341664 15:66826553-66826575 ATCTTGAATGAGAAGGAAGAAGG - Intergenic
1128549399 15:68588507-68588529 CTGTGGAAGGCGAGGGAAGGTGG + Intronic
1128778261 15:70340538-70340560 ATGTGGAAGGAGAGGGAAAGTGG - Intergenic
1128856135 15:71018045-71018067 CTGTAAAAGGAGGAGGAGGAGGG + Intronic
1128990954 15:72260076-72260098 CTTTGGGAGGTGAAGGAAGGCGG + Intronic
1129067149 15:72914802-72914824 CTGTGGAAGGAGAAGGCAGAAGG - Intergenic
1129069352 15:72937920-72937942 CTGTGGAAGAGGAAGGATGCTGG + Intergenic
1129071682 15:72956700-72956722 TTGGGAAAGGAGAAGGAAGCAGG - Intergenic
1129108329 15:73323517-73323539 ATGTGGAAGGAGGATGAAGACGG + Exonic
1129146450 15:73652298-73652320 CTTTGGAAGGCCAAGGCAGAAGG + Intergenic
1129156140 15:73719394-73719416 CCGTGAAAGGAGAAGGGGGAGGG - Intergenic
1129332048 15:74832719-74832741 ATGGGGAGGGGGAAGGAAGAAGG - Intergenic
1129535937 15:76313719-76313741 CTATGGGAGTGGAAGGAAGAGGG + Intergenic
1129728433 15:77915892-77915914 CTCCCGAAGGAGAAGGCAGATGG - Intergenic
1129897930 15:79122498-79122520 CTTAGGAAGGAGACGGCAGAAGG - Intergenic
1130081187 15:80735102-80735124 CTGTGGCAGGAGAAAGAATGAGG + Intronic
1130244627 15:82234104-82234126 TTGTGGAAGGACAGGGAATAGGG - Intronic
1130456010 15:84109032-84109054 TTGTGGAAGGAAAAGGAATGGGG + Intergenic
1130541850 15:84826253-84826275 CTGTGGAAGCAGAAGCAAACAGG - Intronic
1130577790 15:85107583-85107605 CAGTGGAAGGAGAGGGGAGGGGG + Intronic
1131082248 15:89546454-89546476 TTGTGAAAGGAGAAGAAAAAGGG - Intergenic
1131294721 15:91136851-91136873 CTTTGGCAGGAGAAGCAAGAGGG + Intronic
1131591847 15:93758349-93758371 AGGAGGAAGGAGAAGGAAGAAGG + Intergenic
1131618818 15:94045371-94045393 CTGTAGCAGGAGATGGAACATGG - Intergenic
1131667387 15:94585079-94585101 GTTTGGAGGAAGAAGGAAGAGGG - Intergenic
1131947063 15:97635204-97635226 GGGTGGAAGGAGAAGGAGGAGGG - Intergenic
1131994572 15:98121794-98121816 CTGTAGGAGGAAAAGGAAGCTGG - Intergenic
1202965344 15_KI270727v1_random:169808-169830 CTGTGGATGGGGGAGGGAGAGGG + Intergenic
1132682004 16:1146265-1146287 CTGTGGAGTGGGAAGGAGGAGGG - Intergenic
1133019978 16:2963127-2963149 GTGTCGATGGAGAAGAAAGATGG - Intergenic
1133046053 16:3088978-3089000 AAGTGGAAGGAGAGGGAAGTGGG + Exonic
1133344034 16:5058442-5058464 CAGGGGAAGGGGAAGGAAAAAGG - Intronic
1133411215 16:5570594-5570616 CTTTGGGAGGCCAAGGAAGAAGG + Intergenic
1133460690 16:5984021-5984043 AGGAGGAAGAAGAAGGAAGAAGG - Intergenic
1133520118 16:6549103-6549125 GGGAGGAAAGAGAAGGAAGAGGG + Intronic
1133619521 16:7513018-7513040 CTTTGGGAGGACAAGGCAGATGG + Intronic
1133897706 16:9945075-9945097 CTTTGGGAGGCCAAGGAAGAAGG + Intronic
1134060021 16:11193775-11193797 AGGAGGAAGAAGAAGGAAGAAGG - Intergenic
1134111015 16:11515700-11515722 CTGAGGAGGGAGGAGGAAGGAGG + Intronic
1134330811 16:13249695-13249717 CAAGTGAAGGAGAAGGAAGAGGG - Intergenic
1134634259 16:15780061-15780083 CTTGGGAAGGAGAGTGAAGAAGG - Intronic
1135013334 16:18903469-18903491 TAGTGGTGGGAGAAGGAAGAAGG - Intronic
1135023882 16:18984289-18984311 TTGTGGAGGGAGCAGGAATAAGG - Intronic
1135145938 16:19962730-19962752 AGCTGGAAGGAGAAGGCAGAAGG + Intergenic
1135178887 16:20255763-20255785 GTGGGCAAGGAGGAGGAAGAAGG - Intergenic
1135231196 16:20709666-20709688 CTGTATAAGGATAAGGAAGTGGG - Intronic
1135411668 16:22239565-22239587 CTTTGGAAGGACAAGGCAGGAGG + Intronic
1135432619 16:22399134-22399156 CTTTGGAAGGCCAAGGTAGAAGG - Intronic
1135438690 16:22448147-22448169 TAGTGGTGGGAGAAGGAAGAAGG + Intergenic
1135511289 16:23086093-23086115 CTTTGGAGGAAGGAGGAAGAAGG - Intronic
1135793647 16:25421485-25421507 CTGGGCAGGGAGAAGGAAGAGGG + Intergenic
1136033318 16:27519235-27519257 CTGGGGAAGGGGAGGGGAGAGGG + Intronic
1136042805 16:27593749-27593771 CTTTGGAAGGCCAAGGTAGAAGG - Intronic
1136072035 16:27793154-27793176 TTGAGGATGGAGAAGGAACAAGG - Intronic
1136112208 16:28070779-28070801 CTGAGGAGGGAGAACGAGGAAGG + Intergenic
1136144951 16:28311078-28311100 GTGTGGAAGGAGAAGAAGGAGGG + Intronic
1136330489 16:29572763-29572785 TAGTGGTGGGAGAAGGAAGAAGG - Intergenic
1136382191 16:29900864-29900886 TGCTGGAAGGAGAAAGAAGAGGG + Exonic
1136499835 16:30664692-30664714 CTGTGGGAGGGGACGGGAGAAGG - Intronic
1136612281 16:31373400-31373422 CTGGGGAAGGAGGAGGAGGCAGG + Intronic
1136624500 16:31453734-31453756 CTGGGGGAGAAGAAGGAAAACGG + Intergenic
1136641443 16:31568904-31568926 CGCTGGGAGGAGGAGGAAGAAGG - Intergenic
1136736605 16:32473162-32473184 CTGGGGCAGGGGAAGGAAAATGG - Intergenic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137749384 16:50847936-50847958 CTATGGAAGGCCAAGGCAGAAGG - Intergenic
1137827305 16:51510164-51510186 CTGACAAAGGAGAAGGAAGATGG - Intergenic
1138053231 16:53804856-53804878 CTATGGGAGGCCAAGGAAGACGG - Intronic
1138303312 16:55950857-55950879 CTTTGGAAGGCCAAGGCAGATGG + Intronic
1138413916 16:56860351-56860373 CAGAGGAAGGAGAGGGGAGAGGG - Intergenic
1138544393 16:57707012-57707034 CTATGGAAGGAAAGGAAAGAAGG - Intronic
1138887651 16:61098901-61098923 AGGAGGAAGAAGAAGGAAGAAGG + Intergenic
1138938410 16:61759432-61759454 CAGTAGTAGGAGGAGGAAGAGGG + Intronic
1139078828 16:63489355-63489377 CTGTTGAAAGAGAAAGAAAAAGG - Intergenic
1139724301 16:68884151-68884173 CTCTGGAAGGACAAGGCAGGGGG - Intronic
1139910602 16:70395176-70395198 CTGTGGAAGGGAGGGGAAGATGG + Intronic
1140166430 16:72557044-72557066 CTTTGGAAGGCCAAGGCAGACGG - Intergenic
1140180492 16:72712320-72712342 CTTTGGAAGGCCAAGGCAGATGG - Intergenic
1140787553 16:78357374-78357396 CTATGCAGGGAGAAGCAAGATGG - Intronic
1140874397 16:79137680-79137702 CGGGGGAAGGAGACGGAGGAGGG - Intronic
1140921415 16:79542210-79542232 CTTTGGAAGGAGGAGGAAACAGG + Intergenic
1141045192 16:80709707-80709729 CTGTGGAAGTAGATGTGAGAAGG - Intronic
1141137302 16:81474638-81474660 CTGTGGAAGGGGAATGATGGGGG + Intronic
1141167432 16:81669743-81669765 GTGTGGAAGGAGAAGAGAGGTGG - Intronic
1141171622 16:81695263-81695285 TTTAGGAAGGAGAAGGTAGAAGG - Intronic
1141403570 16:83772046-83772068 CTGTGGGTGGAGAAGGATGGGGG + Intronic
1141477007 16:84280794-84280816 CTGTGAAAGCAGAAGGGAAAAGG - Intergenic
1141625358 16:85258634-85258656 CTGTGGGAGGAGGAGGGAGAGGG + Intergenic
1141714788 16:85720522-85720544 CTTTGGAAGGACAAGGACAAAGG + Intronic
1141925216 16:87163971-87163993 CTTTGGGAGGCCAAGGAAGAAGG + Intronic
1142152007 16:88516795-88516817 TTGTAGAAGGAGAAGGGGGAGGG + Intronic
1203016463 16_KI270728v1_random:356415-356437 CTGGGGCAGGGGAAGGAAAATGG + Intergenic
1203034798 16_KI270728v1_random:629573-629595 CTGGGGCAGGGGAAGGAAAATGG + Intergenic
1142787532 17:2235852-2235874 GTGTGGAAGTAGAGGGGAGAAGG - Intronic
1142849128 17:2695855-2695877 CTGCGGGAGGAGGAGGAGGATGG + Intronic
1143250237 17:5518136-5518158 ATGGGGGAGGTGAAGGAAGAAGG - Intronic
1143382821 17:6507120-6507142 CAGGGGAAGGAGAAGAAAGCTGG + Intronic
1143451056 17:7036925-7036947 CTTTGGAAGGAGCAGGAAGGAGG - Intronic
1143592558 17:7894379-7894401 CGGTGGAGGGATAAGGAAGCAGG - Intronic
1143742373 17:8964145-8964167 CTTTGGAAGGCCAAGGTAGACGG + Intronic
1143743338 17:8970952-8970974 CTGAGGAAGGAGAAGACAAAAGG + Intergenic
1143975132 17:10823925-10823947 TTGGGGAAGGAGAAGCATGATGG - Exonic
1143983472 17:10891252-10891274 TTGTGGAGGGAGGAGGAAAAGGG - Intergenic
1144058667 17:11562258-11562280 CTGTGGAAGGAATATGAAGTTGG - Exonic
1144163333 17:12582602-12582624 CTGGGCAAGGACAGGGAAGAAGG - Intergenic
1144218392 17:13077863-13077885 TTTTGGAAGGCCAAGGAAGACGG + Intergenic
1144354988 17:14436722-14436744 TTTTGGAAGAAAAAGGAAGATGG + Intergenic
1144645859 17:16972922-16972944 CTGTGGCAGGAGAATGAACCTGG + Intergenic
1144938481 17:18919120-18919142 CTGTGGAAGGCTAAGGTGGAAGG + Intronic
1145079015 17:19879294-19879316 CTTTGGGAGGAGAAGGCAGTAGG - Intergenic
1145822552 17:27850722-27850744 CTGTGGAAGGAGAGTGATGCTGG + Intronic
1146194301 17:30798425-30798447 CTGTGGAAGGACATAGAAGTTGG - Intronic
1146323301 17:31863942-31863964 CTTTGGAAGGCCAAGGTAGAAGG - Intronic
1146364516 17:32210688-32210710 CTGAGGGAGGAGGAGGAGGAGGG + Intronic
1146554770 17:33813923-33813945 CAGTGGAGGGAGAATGAGGAAGG + Intronic
1146646156 17:34578901-34578923 CTGTTGCTGGGGAAGGAAGACGG - Exonic
1146790776 17:35749324-35749346 CTGGGGAATGAGAAGCAAGGAGG + Intronic
1147109571 17:38251993-38252015 CTGTGGGAGGCCGAGGAAGATGG + Intergenic
1147178563 17:38671554-38671576 TTGTGGGAGGAGGAGGAAGAAGG - Intergenic
1147380012 17:40049095-40049117 CTTTAGGAGGACAAGGAAGAAGG + Intronic
1147387387 17:40090442-40090464 GTGTGGAAGGAGGAGGTGGATGG - Intronic
1147752325 17:42744133-42744155 CCGTGGAATGTGAAGGAATATGG - Intronic
1147800696 17:43084616-43084638 GTGTAGCAGGAGAAAGAAGATGG - Intronic
1147802960 17:43107608-43107630 CTCTGGAAGGCCAAGGCAGATGG - Intronic
1147869514 17:43577696-43577718 CTGTGGCAGGACAAAGAAGCTGG - Intronic
1148093099 17:45034391-45034413 CTGTGGCAGGAGGAAGAAGCTGG + Intronic
1148098170 17:45069200-45069222 CTTTGGGAGGACAAGGAGGATGG - Intronic
1148464775 17:47858213-47858235 CTGGGCAAGGAGGAGAAAGATGG - Intergenic
1148516857 17:48227163-48227185 CTGTGAATGGAGAGGGAACATGG + Intronic
1148672836 17:49424964-49424986 CTGTGGGAGGCCAAGGAAGGGGG - Intronic
1148806713 17:50267473-50267495 CTGGGGCCGGAGGAGGAAGAGGG + Intergenic
1148920870 17:51032405-51032427 CTTTGGGAGGCCAAGGAAGATGG - Intronic
1149069196 17:52519430-52519452 CTTTGGAAGGCTAAGGAAGGAGG + Intergenic
1149336522 17:55641670-55641692 CTGTGGGAGGGAAAGAAAGAAGG - Intergenic
1149451209 17:56751375-56751397 GTGCGGACGGAGGAGGAAGAGGG + Intergenic
1149623969 17:58066689-58066711 CTGTGAAAGGAAAAGAAAGAAGG + Intergenic
1149734024 17:58975391-58975413 CTGTGGAAGGCCAAGGAGGGAGG + Intronic
1150150901 17:62808235-62808257 TCGGGGAAGGAGGAGGAAGAGGG - Exonic
1150157720 17:62868361-62868383 CAGTGGGAGGAGTAGGAATAGGG - Intergenic
1150352299 17:64455050-64455072 TTGTGAAAGGAAAAGGAAGAAGG + Intronic
1150488224 17:65558735-65558757 CTCTGGAAAGAAAAGGAAGGGGG + Exonic
1150602016 17:66659367-66659389 CTGGTGGAGGAGGAGGAAGAAGG - Intronic
1150833128 17:68541253-68541275 CTGTGGAGGGACGAGGAAGCAGG - Intronic
1151224712 17:72639942-72639964 TACTGGAAGGAGGAGGAAGATGG + Intergenic
1151483654 17:74385147-74385169 CAGGGGAAGGAAAAGGAAAAGGG + Intergenic
1151696046 17:75718157-75718179 CTTTGGGAGGACAAGGCAGACGG + Intergenic
1151820849 17:76496016-76496038 CTGAGGAATGAGGAGGAATAAGG + Intronic
1151847679 17:76668820-76668842 CTTTGGGAGGTGAAGGCAGAAGG + Intergenic
1151887552 17:76932130-76932152 CTGTGTAAGAAGAAGAAAGAAGG - Intronic
1151922446 17:77167585-77167607 AGGTGGAAGGAGAAGGTATATGG - Intronic
1152070283 17:78130866-78130888 CAGTGGAGGGAGAATGCAGAGGG + Intronic
1152158099 17:78648104-78648126 CTGTGGAGTCAGAAGGAAGCCGG + Intergenic
1152231419 17:79115749-79115771 CTGTGGAAGGAGAGAGAGCAAGG + Intronic
1153463974 18:5368215-5368237 GTGTGAAAGGAGAGGGAGGAAGG - Intergenic
1153587575 18:6639120-6639142 CTTTGGAAGGCCAAGGAAGGAGG + Intergenic
1153625348 18:7018090-7018112 CTTTGGGAGGACAAGGAAGGCGG + Intronic
1153638048 18:7129904-7129926 ATGTGGAGCGAGAATGAAGAAGG + Intergenic
1153778982 18:8477950-8477972 CAGTGGAAGCAGCAGGAAGGTGG + Intergenic
1153828428 18:8898426-8898448 CTTTGGAAGGAGGAGAAAGATGG + Intergenic
1154132603 18:11750242-11750264 CTGAGAAAGGAGCAGGTAGAAGG + Intronic
1155014132 18:21815424-21815446 CTTTGGGAGGACAAGGCAGAAGG - Intronic
1155110647 18:22710983-22711005 CTTTGGAATGAGAAGGAATGAGG - Intergenic
1155382129 18:25235373-25235395 CTGGGGAAGCAGAAGGTAAAGGG + Intronic
1155530050 18:26757936-26757958 CTGACAAAGGAGAAGGAAAATGG - Intergenic
1155670258 18:28362097-28362119 CTGTGGAAGGAGAAAGGTAATGG - Intergenic
1155775187 18:29752628-29752650 TGGTGGAAGGTGAAGGAAGGAGG + Intergenic
1156076579 18:33286216-33286238 CTTTGGGAGGCTAAGGAAGATGG - Intronic
1156170211 18:34474020-34474042 CTCTGGAAGGAGGAGGAGTAGGG - Intergenic
1156215183 18:34990775-34990797 CTTTGGCAGGACAAGGCAGAAGG + Intronic
1156536798 18:37872185-37872207 CCATGTAAGGAGCAGGAAGAGGG + Intergenic
1156604855 18:38654568-38654590 CGTTGGAAGGAGAAGGCACAAGG + Intergenic
1156791755 18:40984096-40984118 CAGGGGGAGGAGGAGGAAGAGGG - Intergenic
1156811103 18:41252800-41252822 ATGTGTAATGAGAAGGAAGAAGG + Intergenic
1157246012 18:46056059-46056081 CTGTAGAGAGAGAAGGGAGAGGG - Intronic
1157421934 18:47554989-47555011 GTGTGGAAGGTGAGGGAAGAGGG - Intergenic
1157605317 18:48922771-48922793 CTGTGGAAGGAGGGGAGAGAGGG - Intronic
1157625208 18:49045186-49045208 CGGTGGAAGGCTGAGGAAGAGGG + Intronic
1157948076 18:52003633-52003655 CTGAGGGAGGAGAAGCCAGAAGG - Intergenic
1158092308 18:53728414-53728436 TTGCTGAAGAAGAAGGAAGAGGG + Intergenic
1158310108 18:56149023-56149045 AAGAGGAAGAAGAAGGAAGAGGG + Intergenic
1158424463 18:57326649-57326671 CTGGGGAAGGAGAGGCAAGGAGG + Intergenic
1158454666 18:57595494-57595516 CTGTGGAGGGAAAAAGAAGAGGG - Intergenic
1158463154 18:57664898-57664920 CTTTGGAAGGAGAAGAACAATGG - Intronic
1158737391 18:60098789-60098811 AAGAGGAAGGAGGAGGAAGAAGG - Intergenic
1158972431 18:62680692-62680714 CTTTGGAAGGCCAAGGAAGGAGG - Intergenic
1158976925 18:62717196-62717218 CTGTGGAGGGTGCAGGAGGAAGG + Exonic
1159075960 18:63682460-63682482 GTGAGGGAGGAGAAGGACGAAGG - Intronic
1159116122 18:64114970-64114992 GGGTGGGAGGAGAAGGGAGAAGG - Intergenic
1159837666 18:73358792-73358814 CTGACCAAGGAGAAGGCAGAAGG - Intergenic
1159972934 18:74676333-74676355 CTTTGGAAGGAGAAGGCAGGCGG - Intronic
1160078350 18:75699911-75699933 CTTTGGAAGGACAAGGCAGGTGG - Intergenic
1160196981 18:76763780-76763802 CTTTGGAAGGAGGAGGCAGGAGG - Intergenic
1160239026 18:77109401-77109423 GTGTGGAAGGTGAGGAAAGAGGG + Intronic
1160344311 18:78120208-78120230 CTGTGATATGAGAAGGAATAAGG + Intergenic
1160476495 18:79194408-79194430 GTGTGGAAGTACAAGGAAGTCGG + Intronic
1160503960 18:79417089-79417111 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160503987 18:79417181-79417203 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160503994 18:79417205-79417227 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504006 18:79417246-79417268 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504018 18:79417287-79417309 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504031 18:79417335-79417357 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504043 18:79417375-79417397 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504055 18:79417416-79417438 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504062 18:79417440-79417462 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504075 18:79417488-79417510 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504087 18:79417528-79417550 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504099 18:79417569-79417591 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504111 18:79417610-79417632 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504124 18:79417658-79417680 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504136 18:79417698-79417720 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504143 18:79417722-79417744 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504155 18:79417763-79417785 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504167 18:79417804-79417826 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504180 18:79417852-79417874 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504192 18:79417892-79417914 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504199 18:79417916-79417938 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160535524 18:79589551-79589573 CGGGGGAGGGAGAAGGGAGATGG + Intergenic
1160676607 19:394531-394553 GAGAGGATGGAGAAGGAAGATGG + Intergenic
1160899904 19:1422424-1422446 CTGAGGGAGGAGCAGGGAGAAGG - Intronic
1160914414 19:1489971-1489993 CTGGGGAAGGACAAAGAAGGGGG - Intronic
1161466550 19:4433841-4433863 CTTTGGGAGGACAAGGCAGACGG - Intronic
1161509544 19:4662919-4662941 CTGGGGTAGGAGGAGGAGGAAGG - Intronic
1161530140 19:4783823-4783845 CTTTGGGAGGAGAAGGAGGGAGG + Intergenic
1161787026 19:6333120-6333142 CTGTGGTAGGGGGAGGCAGAGGG - Intronic
1161821539 19:6533551-6533573 CTCTGGAGGGGGAAGGAAGGGGG - Intronic
1161821587 19:6533667-6533689 CTCTGGAGGGAGAGGGAAGGGGG - Intronic
1161934344 19:7362304-7362326 AGGAGGAAGAAGAAGGAAGAAGG + Intronic
1161961780 19:7527423-7527445 CTGGGGAAGCACAGGGAAGAAGG + Intronic
1161983648 19:7642960-7642982 CTGGGGAAGTAGGGGGAAGAGGG - Intronic
1162279762 19:9686272-9686294 CTGTGGGAGGCCAAGGCAGATGG - Intergenic
1162556955 19:11392984-11393006 CTGTGACAGGAAGAGGAAGAAGG + Intronic
1163044726 19:14631870-14631892 AAGTGGAAGTAGCAGGAAGAGGG + Intronic
1163113042 19:15173001-15173023 AAGAGGAAGAAGAAGGAAGAGGG - Intronic
1163624406 19:18380636-18380658 CTGTGAGAGGACAAGGAAGGAGG + Intronic
1164225287 19:23240066-23240088 CTTTGGAAGGCCAAGGAAGGTGG + Intronic
1164269486 19:23658436-23658458 CTTTGGGAGGCCAAGGAAGATGG + Intronic
1164431824 19:28195542-28195564 GTGGGGAGGGAGAAGGCAGAAGG + Intergenic
1164640099 19:29818684-29818706 CTTTGGAAGGCCAAGGCAGAAGG + Intronic
1164644181 19:29845709-29845731 GGGTGAAACGAGAAGGAAGAAGG - Intergenic
1164911118 19:32012724-32012746 CTTTTCAAGGACAAGGAAGATGG - Intergenic
1165043215 19:33083636-33083658 CTTTGGGAGGTGAAGGCAGATGG - Intronic
1165106007 19:33470034-33470056 CTGCTGAAGCAGCAGGAAGATGG - Intronic
1165156319 19:33790892-33790914 CTTTGGGAGGAGAAGGCAGGAGG + Intergenic
1165312487 19:35037249-35037271 CTGTGTTAGGAGAAGGCAGATGG + Intronic
1165333516 19:35154396-35154418 CTGGGGGAGGAGAATGAAGAGGG - Intergenic
1165416055 19:35694179-35694201 TGAAGGAAGGAGAAGGAAGAAGG - Intergenic
1165454580 19:35903328-35903350 CTGTGGAAAGAGAAAGAAGGTGG - Intronic
1165637573 19:37355102-37355124 CTGAGAAAGGGGAAGGAAGGAGG - Intronic
1165736625 19:38180989-38181011 CTTTGGAAGGAGAGGAGAGAAGG - Intronic
1165775584 19:38402815-38402837 CTGAGGGAGGAAAAGGAAAATGG + Intergenic
1165854621 19:38871871-38871893 CTGTGGTGGGGGGAGGAAGAAGG + Intronic
1166007343 19:39916573-39916595 CTGGGGAAAGGGAAGGCAGAGGG - Intronic
1166178823 19:41092971-41092993 ATTTGGAAAGAGAAGGATGAGGG - Intronic
1166182103 19:41116384-41116406 TGGTGGAAGGATAAGGAGGAGGG + Intronic
1166377231 19:42334342-42334364 CTCTGGAAGGAGAGGGAAGTGGG - Intronic
1166551995 19:43671911-43671933 CTTTGGAAGGACAAGGCAGGTGG - Intergenic
1166569642 19:43785301-43785323 CTGGTGAAGGAGAGTGAAGAGGG + Intergenic
1166690957 19:44821017-44821039 CTGGGCAGGGAGAGGGAAGAGGG - Exonic
1166936917 19:46339637-46339659 CTGGGGGAGGAGAAGGCAGATGG - Exonic
1166988950 19:46679097-46679119 CTTTGGGAGGCCAAGGAAGATGG + Intronic
1167196829 19:48034919-48034941 CTTTGGAAGGACAAGGTGGAAGG - Intronic
1167294149 19:48639668-48639690 CTGGGGGAGGAGAAGGTTGAGGG - Intronic
1167307352 19:48716744-48716766 CTGTGGAGGGAGGAGGGAGGTGG + Intronic
1167421103 19:49403855-49403877 GTGTGGAGGGGGAAGGTAGAGGG - Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1167776957 19:51564720-51564742 CTGGGGTAGGAGAAGGAGCAGGG + Intergenic
1167798452 19:51725876-51725898 CTTTGGAAGGCCAAGGCAGATGG - Intergenic
1167986031 19:53316897-53316919 CTGTGGGAGGCCAAGGCAGAAGG + Intergenic
1168471524 19:56644046-56644068 CAGTGAATGGAGGAGGAAGAAGG - Intronic
925169736 2:1743628-1743650 CTGGGGGAGGAGAAGGAAGGGGG + Intronic
925198456 2:1947015-1947037 CTGATGAAGGAGAAGGAAGCTGG - Intronic
925306138 2:2849264-2849286 CTGTGGAGGGGGCAGGCAGATGG - Intergenic
925604994 2:5650515-5650537 CTGTGGAGTGATATGGAAGAAGG + Intergenic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
925670802 2:6308027-6308049 CTTTGGGAGGACAAGGAAGGAGG + Intergenic
926206936 2:10840473-10840495 CTGTGGAAGGAGACTGTAGATGG + Intergenic
926212028 2:10878436-10878458 CTGTGGAAGGTGCTGGCAGAGGG + Intergenic
926321215 2:11749445-11749467 CTGTGGAAAGAGGAAGAGGAAGG - Intronic
926377017 2:12240703-12240725 CAGAGGAAAGAGAAGGAACATGG - Intergenic
926702837 2:15815308-15815330 CTGAGGAAACAGAAGGAAGGAGG - Intergenic
926820606 2:16847783-16847805 CTTTGGAAGGCTAAGGCAGAAGG - Intergenic
927325514 2:21800823-21800845 CTTTGGGAGGACAAGGCAGAAGG - Intergenic
927686540 2:25175070-25175092 CTATGGAGAGAGAATGAAGAAGG - Intergenic
927707805 2:25307707-25307729 CTGTGGGAGGCCAAGGCAGATGG - Intronic
927710810 2:25324740-25324762 CTGGGGATGGATAAGGAGGAGGG + Intronic
927869906 2:26616727-26616749 GTGTGGTAGGAGGAGGAAGGAGG - Intronic
927951757 2:27175023-27175045 CTGAGGATGCAGAAGGCAGAGGG - Intergenic
927955812 2:27206648-27206670 ATTTGAGAGGAGAAGGAAGAGGG - Intronic
927996934 2:27493479-27493501 CTGAGAAGGGAGAAGGCAGAAGG + Intronic
928099432 2:28427317-28427339 CTGAGGAAGGAGGAGGAGAAGGG - Intergenic
928116550 2:28549146-28549168 CTGTGGAAGGCATAGGAACAAGG + Intronic
928262099 2:29777265-29777287 CTATGGCAGGAGTAGGAAAAAGG + Intronic
928849290 2:35723809-35723831 CTTTGGAAGGCGAAGGAGGGAGG - Intergenic
928950506 2:36809155-36809177 CTGAGTAGGGAGAAGGAACAAGG + Intronic
929594464 2:43167742-43167764 CTGGAGCAGAAGAAGGAAGAAGG - Intergenic
929818741 2:45257082-45257104 CTGTGGAAGCGGGAGGAACATGG + Intergenic
929934136 2:46282065-46282087 ATGGGGAAGGAGAAGGAACAAGG + Intergenic
930359137 2:50357031-50357053 CTTTGGAAGGCGAAGACAGAAGG + Intronic
930535268 2:52637988-52638010 AAGTGGAAGAAGAAGGAAGAAGG - Intergenic
930673573 2:54176942-54176964 CTGTGAAAGGAGAGGGAAGCTGG - Intronic
930768131 2:55105723-55105745 CTTTGGGAGGGGAAGGAAGCAGG + Intronic
931000174 2:57770884-57770906 CTGAGGAAGGAAAGGGAAGAAGG - Intergenic
931178865 2:59879978-59880000 TTGTCGAAGGAGATGAAAGATGG - Intergenic
931364473 2:61606856-61606878 CTTTGGAAGGCTAAGGCAGAAGG - Intergenic
931412300 2:62044750-62044772 CTTTGGTAGGTGAAGGGAGAAGG - Intronic
931419756 2:62116088-62116110 CTGTGGAAGGCCAAGGCAGATGG - Intronic
931459189 2:62435456-62435478 CTTTGGGAGGCCAAGGAAGAAGG - Intergenic
931593544 2:63913993-63914015 CTGTGGAGTAAGAAGGAAGCAGG + Intronic
931701478 2:64912798-64912820 CTTTGGGAGGAGAAGGCAGGTGG + Intergenic
931889384 2:66654115-66654137 CTGTGGAAATAGAAGGTAGATGG + Intergenic
931914027 2:66933462-66933484 CTGTGGCAGCTGATGGAAGAGGG - Intergenic
931957112 2:67439684-67439706 CTTTGGAAGGCCAAGGCAGATGG + Intergenic
931992776 2:67807774-67807796 GAGAAGAAGGAGAAGGAAGAAGG - Intergenic
932023172 2:68108727-68108749 TTGTGGAAGGAAAGGGATGAAGG - Intronic
932050753 2:68395657-68395679 CTGGGGAAAGAGAAGGCAAATGG - Intronic
932208151 2:69902231-69902253 AGGAGGAAGGAGAAGAAAGAAGG - Intronic
932208155 2:69902255-69902277 AGGAGGAAGGAGAAGAAAGAAGG - Intronic
932220534 2:69995674-69995696 CTGTGGTGGGAGCAGGAAGAGGG + Intergenic
932394658 2:71433453-71433475 CTGTTCAAGGAAAAGGAATAAGG - Intronic
932397643 2:71459094-71459116 ATGTGAAGGGAGAGGGAAGAAGG + Intronic
932442148 2:71744214-71744236 CTGAGGAAGGAGCATGCAGAAGG - Intergenic
932909618 2:75792010-75792032 CTGTGGAAGAAGGAGGACTATGG + Intergenic
933274934 2:80273626-80273648 GTGTGGCAGGAGAAGGGTGATGG - Intronic
933361198 2:81287191-81287213 TTGAGGAAGGAAAACGAAGATGG - Intergenic
933441107 2:82315400-82315422 GAGGGGGAGGAGAAGGAAGAGGG - Intergenic
933925192 2:87085594-87085616 GTGAAGAAGAAGAAGGAAGAAGG + Intergenic
934126235 2:88893701-88893723 CTGTGGAAAAGGAAGTAAGAGGG + Intergenic
934187759 2:89762279-89762301 CTGGGGCAGGGGAAGGAAAATGG - Intergenic
934308858 2:91845669-91845691 CTGGGGCAGGGGAAGGAAAATGG + Intergenic
935187321 2:100745879-100745901 CACTGGAAGAAGAAGGAAGCTGG + Intergenic
935269233 2:101419420-101419442 CTGTGGAAGGAAAAGGAGACTGG + Intronic
935277057 2:101484181-101484203 CTAGGGAAGGAGAAGGGGGAAGG - Intergenic
935294239 2:101634951-101634973 CTGGGGAAGGAGGAGGCAGGTGG - Intergenic
935635830 2:105248979-105249001 CTGTGGAAGAAGATGGGAGCTGG + Intergenic
936073878 2:109389291-109389313 CTGTGCAAACAGGAGGAAGAGGG + Intronic
936281955 2:111149330-111149352 TTTTGAAAGGAGAAGAAAGAGGG - Intronic
936387787 2:112045261-112045283 CTTTGGAAGGCCAAGGCAGAGGG - Intergenic
936659221 2:114523608-114523630 CTGTAGAGGGAAAAGGAAGTGGG + Intronic
936690492 2:114882499-114882521 CTATGGAAGAAGAAGAAAGGTGG + Intronic
936765948 2:115848661-115848683 CTGAGGAGGCAGAAGGCAGAAGG - Intergenic
936922195 2:117700215-117700237 ATGTGGAAGAAGGAGGTAGAAGG + Intergenic
937345216 2:121121163-121121185 CTGTGGAAGGGGAGGGCAGGGGG + Intergenic
937584328 2:123527423-123527445 CTGTGGAAGGGGAAGGGGAATGG + Intergenic
937624974 2:124033983-124034005 ATCTGGAAGGAGAAAGAACAGGG + Intronic
937814065 2:126231673-126231695 AGGAGGAAAGAGAAGGAAGAGGG - Intergenic
937985027 2:127634573-127634595 CTGGGGAAGGGGAAGGTACAGGG - Intronic
938047262 2:128132948-128132970 CTTTGGAAGGACAAGGCAGGAGG - Intronic
938452242 2:131431659-131431681 CTGTGGAAGGTGAGGGAGGAAGG + Intergenic
938555855 2:132423620-132423642 CTGGGGAAGGGGATGGAAGTGGG - Intronic
938605898 2:132892247-132892269 ATCTGGAAGCAGAAGTAAGAAGG - Intronic
938916426 2:135945550-135945572 CTTTTGAATGAGAAAGAAGAGGG - Intronic
939037980 2:137155920-137155942 CTATGGAAGGAAAACCAAGAAGG + Intronic
939113743 2:138037690-138037712 CTGTGGAAGCAGTAAGGAGAAGG + Intergenic
939183682 2:138834389-138834411 TTTTGAAAAGAGAAGGAAGAAGG + Intergenic
939199800 2:139019003-139019025 AGGTTGAAGGAGAAGGAAGCTGG - Intergenic
939492712 2:142895923-142895945 CTTTGGAAGGCCAAGGAATAAGG - Intronic
939534524 2:143410958-143410980 CTTTGGAAGGCCAAGGCAGACGG + Intronic
939553129 2:143640284-143640306 ATGGGGAATCAGAAGGAAGAGGG + Intronic
939835990 2:147130595-147130617 TGTTGGAAGGTGAAGGAAGAAGG - Intergenic
940249546 2:151659542-151659564 CTTTGGAAGGTGAAGGCAGGTGG - Intronic
940307126 2:152238539-152238561 CTTTGGGAGGACAAGGAGGAAGG + Intergenic
940687856 2:156876441-156876463 TACTGAAAGGAGAAGGAAGAAGG - Intergenic
940716492 2:157230848-157230870 GTGTGCAAGGAGAAGGAAGCAGG - Intergenic
940818078 2:158318876-158318898 CTGTGGGAGGCTAAGGCAGAAGG - Intronic
940987383 2:160062669-160062691 TTGGGGAAGGAGGAGGAGGAGGG + Intergenic
941624432 2:167815130-167815152 ATGTGAGAGGAGAAAGAAGAAGG - Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942014998 2:171804666-171804688 CTTTGGGAGGAGGAGGCAGAAGG + Intronic
942023839 2:171894001-171894023 CTGGGGGAGGGGAAGGAGGAGGG - Intronic
942117575 2:172743219-172743241 CTGAGGAAAGAGAAAGAGGATGG + Intronic
942117591 2:172743362-172743384 CTGGGGCAGGGGAAGCAAGAGGG - Intronic
942417397 2:175773293-175773315 GTGGGGAAGGAGAAGAAAAAAGG + Intergenic
942798695 2:179851205-179851227 CTGTGGGAGGACAAGGCAGGAGG + Intronic
943256569 2:185601177-185601199 CTGTGGAAAGTGAATGAAGGGGG + Intergenic
943329668 2:186543593-186543615 CTGTGGGAGGCCAAGGCAGATGG - Intergenic
943449377 2:188028764-188028786 CTAGGGAAGGGGAAGGAAGCCGG + Intergenic
943566908 2:189526780-189526802 GTGTTGATGGAGAAGGAGGAGGG - Intergenic
943612291 2:190047286-190047308 ATGGGAAAGAAGAAGGAAGAAGG - Intronic
943725903 2:191251088-191251110 CTGGGGAAGGAGAATGACGCAGG - Intronic
944098342 2:195994933-195994955 CTGTCTAAAGAAAAGGAAGAAGG - Intronic
944162501 2:196679320-196679342 CAGGGGAAGGAGGTGGAAGAAGG - Intronic
944220656 2:197301028-197301050 CTTTGGAAGGCCGAGGAAGATGG - Intronic
944401544 2:199332365-199332387 CAGTGGAAAAAGAAGGAAGTTGG + Intronic
944718911 2:202403439-202403461 CTTTGGAAGGAGAAGGCAGGAGG - Intronic
944747651 2:202674674-202674696 CTGTGGATGGAGAAGAAACTGGG - Intronic
945042710 2:205755511-205755533 CTCTGTAGGGAGAAGGAAAATGG - Intronic
945693460 2:213071632-213071654 GTGTGGAAGGAGAAGTATAAAGG + Intronic
945808437 2:214518610-214518632 CTGTTGAAGGACAAGGAAGGGGG - Intronic
946109622 2:217403183-217403205 AGGTGGGAGGAGAAGGGAGAGGG + Intronic
946440297 2:219689396-219689418 TTGTGGAAGGAGAGGGAGGACGG - Intergenic
946522303 2:220479714-220479736 CTGTGGAGAGGTAAGGAAGAAGG - Intergenic
946587139 2:221202347-221202369 CTCTGGGAGGATAAGGAAAAAGG + Intergenic
946668768 2:222079598-222079620 TAGAGGAGGGAGAAGGAAGAAGG - Intergenic
947222672 2:227808577-227808599 CTTTGGGAGGCCAAGGAAGACGG - Intergenic
947231533 2:227892623-227892645 CTGTGGGAGAAGATGGTAGAAGG + Intronic
947341177 2:229141371-229141393 CTCTGGAAGGAGAATAAAGAGGG + Intronic
947396743 2:229694468-229694490 CTGTGAAAGCAGACAGAAGAGGG + Intronic
947721469 2:232371958-232371980 CTTTGGAAGGACAAGGCTGAAGG - Intergenic
947721987 2:232375718-232375740 CTGTGGAAGGCCAAGGCAGGTGG + Intergenic
947778763 2:232738158-232738180 CTTTGGGAGGACAAGGTAGACGG - Intronic
947815623 2:233034488-233034510 CTGAGGAAGCAGAAGGCAGAGGG - Exonic
948189607 2:236047431-236047453 AGGTGGCACGAGAAGGAAGAGGG - Intronic
948288608 2:236807495-236807517 CTGTGGGAGGCCAAGGCAGATGG + Intergenic
948307146 2:236956769-236956791 CTGTGAAAGGAAAAGGGAGGAGG - Intergenic
948674603 2:239589492-239589514 AGGAGGAAGGAGAAGGAAGTGGG + Intergenic
948732569 2:239976402-239976424 CAGTTGAGGGAGAAGGAGGATGG - Intronic
948807306 2:240458628-240458650 CTGAGGATGGGGAAGGAGGAAGG - Intronic
1168797705 20:622538-622560 GTGTGGCTGGAGAAGGGAGAGGG - Intergenic
1169045531 20:2531841-2531863 GTGAAGAAGAAGAAGGAAGAAGG + Intergenic
1169085492 20:2823076-2823098 CCGTGGAGGGAGACGGGAGAGGG - Intergenic
1169342248 20:4805354-4805376 CTGTGGACGAAGATGGAGGAAGG + Intronic
1169474284 20:5916964-5916986 ATGTGGAGGGAGTAGGAACAAGG - Intronic
1169571844 20:6914767-6914789 TTGTTGCTGGAGAAGGAAGAGGG + Intergenic
1170331328 20:15213986-15214008 CTTTGGGAGGACAAGGCAGAAGG - Intronic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1170417394 20:16159075-16159097 CTGTAGGGGGAGAAGGAAGTGGG - Intergenic
1170633333 20:18083606-18083628 GTGTGGAAGGGAAAGGAAGGTGG + Intergenic
1170829905 20:19830971-19830993 CTGTGGAATGGGAAGGAAGCAGG - Intergenic
1170967440 20:21087470-21087492 TTGAGGAAGGACAAAGAAGAAGG + Intergenic
1170992040 20:21311742-21311764 CTTTGGGAGGCCAAGGAAGATGG + Intronic
1171201838 20:23247945-23247967 CTGTGAAAGGAGGAGGGGGACGG + Intergenic
1171469382 20:25357765-25357787 CTTTGGAAGGACAAGGCAGGAGG + Intronic
1171941129 20:31330955-31330977 AAGGAGAAGGAGAAGGAAGAAGG + Intergenic
1172060702 20:32185413-32185435 ATGTGAAAGGAGGTGGAAGAAGG + Intergenic
1172297836 20:33826157-33826179 GTATGGTAGGAGAAGGAAGGAGG + Intronic
1172340246 20:34151988-34152010 CTGTGGGAGGCCAAGGAAGGAGG - Intergenic
1172500639 20:35424135-35424157 CTTTGGAAGGCCAAGGCAGACGG + Intergenic
1172845780 20:37929305-37929327 CTGTGGCAGGAGTAGGAGCAGGG + Intronic
1172951888 20:38727569-38727591 CTGTACGAGGAGAATGAAGACGG + Exonic
1173138340 20:40459874-40459896 CTTTGGAAGGCCAAGGTAGATGG + Intergenic
1173302442 20:41816228-41816250 ATGTGGAAGCAGAAGGCAGAAGG - Intergenic
1173375228 20:42476985-42477007 TGGTGGAAGGAGAAGGGGGAAGG - Intronic
1173433834 20:43015275-43015297 ATGTGGAAGGTGAAGCAAGGAGG - Intronic
1173549815 20:43924863-43924885 CTGTGTGTGGAGAAGGGAGAGGG - Intronic
1173619514 20:44426067-44426089 CTGTGGAATCAGGGGGAAGATGG + Intronic
1173856850 20:46255724-46255746 CTGGAGCAGGAAAAGGAAGAAGG - Intronic
1173900384 20:46583447-46583469 CAGTGAAAGGAGAAGCAGGAAGG + Intronic
1173997925 20:47353698-47353720 CTGAGGAGGCAGAAGGAAAAAGG + Intronic
1174316419 20:49705934-49705956 CTTTGGAAGGCCAAGGAGGACGG + Intronic
1174642173 20:52054087-52054109 CTGTGGGAGGCCAAGGCAGAAGG - Intronic
1175148922 20:56917623-56917645 CTGGAGTGGGAGAAGGAAGACGG - Intergenic
1175455997 20:59114687-59114709 CTTTGGAAGGCTGAGGAAGAAGG + Intergenic
1175919671 20:62444791-62444813 CTGGGGCAGGAGAAGGAGGGTGG + Intergenic
1176294293 21:5062794-5062816 CTGTGGCACGAGCAGGTAGACGG - Intergenic
1177207380 21:18025793-18025815 CCGTGGAAGATGAAGGGAGAAGG - Intronic
1177216020 21:18130042-18130064 CGGAGCAAGGAGAAGGAATAGGG + Intronic
1177366107 21:20139893-20139915 CTTTGGAAGGAGAAGAAATGGGG - Intergenic
1177392349 21:20492553-20492575 CTGAGGAAGAAGAATGAAGTAGG - Intergenic
1177702281 21:24654364-24654386 CTTTGGAAGGCCAAGGAAGGTGG - Intergenic
1178276892 21:31247074-31247096 CTTTGGGAGGACAAGGTAGAAGG + Intronic
1178296385 21:31413800-31413822 CTGTGGAAGGAGATGGCATCTGG - Intronic
1178434480 21:32545909-32545931 CTAGGGAAAGGGAAGGAAGAAGG - Intergenic
1178716911 21:34973327-34973349 CTGTGAATGGAGAAGAACGAGGG + Intronic
1178881747 21:36455451-36455473 CTGTGGAAGGAGGGTGAGGATGG + Intergenic
1179206988 21:39290886-39290908 CTTTGGGAGGTGGAGGAAGAAGG + Intronic
1179350684 21:40607922-40607944 CTTTGGATGGAGAAGGAAGTTGG + Intronic
1179409874 21:41154220-41154242 CTGTGGCAGGTGAGGGAGGATGG + Intergenic
1179442698 21:41406456-41406478 CTGTTGAAGGAGCAGAAAGCTGG + Intronic
1179862967 21:44200854-44200876 CTGTGGCACGAGCAGGTAGACGG + Intergenic
1180517817 22:16164440-16164462 CTTTGGGAGGAGAAGGCAGGTGG - Intergenic
1180535941 22:16392757-16392779 CTGGGGCAGGGGAAGGAAAATGG + Intergenic
1180598051 22:16992177-16992199 CTAAGGAAGGAGTAAGAAGAGGG + Intronic
1180684382 22:17653745-17653767 CTTTGGAAGGACAAGGGAGGAGG - Intronic
1181037382 22:20176426-20176448 ATGTGGAGGGAGAAGGAAGAAGG - Intergenic
1181527877 22:23500483-23500505 GTGGGGGAGGAGAAGGAAGGTGG + Intergenic
1181780706 22:25190896-25190918 CTGTGTAAGGGGAAGAATGAGGG + Intronic
1182242976 22:28931928-28931950 CTATGGACAGAGAAGGCAGATGG + Intronic
1182294426 22:29304844-29304866 CTGAGGCAGGAGAAGGAGAATGG - Intergenic
1182431950 22:30304467-30304489 CTTGGGGAGGAGGAGGAAGAGGG - Intronic
1182833524 22:33322877-33322899 CTTTGGGAGGCGAAGGAAGGCGG + Intronic
1182852653 22:33489258-33489280 TCGTGGAGGGAGAGGGAAGAGGG + Intronic
1183460508 22:37947220-37947242 CTGGGGGAGGACAAGGGAGAGGG - Intronic
1183562263 22:38584519-38584541 CTTTGGAAGGACAAGGCAGGAGG + Intronic
1183630827 22:39031671-39031693 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183634343 22:39052051-39052073 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183783066 22:40011080-40011102 CTGTGGAAGGAGAAAGGAGTGGG - Intronic
1183813002 22:40273888-40273910 CTTTGGAAGGACAAGGCAGGAGG - Intronic
1183825243 22:40381390-40381412 CTTTGGAAGGCCAAGGCAGAAGG - Intronic
1184030775 22:41893094-41893116 CTGTGGAAGGACAAGGACCAGGG - Intronic
1184321208 22:43743507-43743529 CTGTGAAATGAGAATGAATAAGG + Intronic
1184376584 22:44117328-44117350 CTGTAGAGGGTGAAGGAGGAGGG + Intronic
1184407353 22:44307748-44307770 CTGGGGAAGGAGAGGAAGGAGGG + Intronic
1184418293 22:44364561-44364583 CTGCTTAAGGAGAAGGATGAGGG + Intergenic
1184509013 22:44921212-44921234 CAGGGTAAGGAGAAGGGAGATGG + Intronic
1184959356 22:47917867-47917889 AGGAGGAAGGAGAGGGAAGAAGG - Intergenic
1184959365 22:47917906-47917928 GGGAGGAAGGAGAAGGAGGAAGG - Intergenic
949347769 3:3092782-3092804 CAGTAGAAGGAAAAAGAAGAAGG - Intronic
949551631 3:5116634-5116656 ATGTGGATGGAGAAGGAGGAAGG - Intergenic
949588183 3:5464238-5464260 CTGGGGGAGTAGAAGGAAGTGGG + Intergenic
949674459 3:6437319-6437341 GTAGGGAATGAGAAGGAAGATGG - Intergenic
949829519 3:8198987-8199009 CTGAGGAAGGATAAGTGAGAGGG - Intergenic
949948264 3:9207574-9207596 GGGAGGGAGGAGAAGGAAGAAGG + Intronic
949951259 3:9230625-9230647 CTTTGGAAGGATAAGGCAGGAGG + Intronic
949976974 3:9469968-9469990 TGGAGGAAGGAGAAGGTAGACGG - Intronic
950506581 3:13398674-13398696 CTGTGGGAGGCCAAGGCAGAAGG + Intronic
950734873 3:14998766-14998788 CTTTGGAAGGCCAAGGAGGAAGG + Intronic
950958640 3:17081248-17081270 GTGAGGGAGGAGAAGGAGGAGGG - Intronic
951314292 3:21169411-21169433 CTATGGAAGGAAAAAGAATAAGG - Intergenic
951393970 3:22141663-22141685 CTGGGGGAGGAGGAGGAGGAGGG + Intronic
952405024 3:32997792-32997814 CTGGGAAAGGAGAACAAAGAAGG - Intronic
952422259 3:33142895-33142917 CTGTGGGAGGCCAAGGCAGATGG - Exonic
952841976 3:37654259-37654281 CTGTGGCAGGAGAGGGCTGAAGG + Intronic
952875290 3:37939848-37939870 CTTTGGAAGGCCAAGGCAGATGG + Intronic
952960439 3:38586042-38586064 CTGGGGAAGGAGGAAGAGGAGGG + Intronic
953003338 3:38954743-38954765 CTGTGGGAGGCTAAGGCAGATGG + Intergenic
953142043 3:40238145-40238167 GAAGGGAAGGAGAAGGAAGAAGG - Intronic
953188438 3:40660665-40660687 GTGAGGAGGGAGAAAGAAGAAGG + Intergenic
953457136 3:43052379-43052401 CTGTGGAAGGAGGAGGACAGAGG - Intronic
953469438 3:43154592-43154614 CTGTGGAAGGAAAGGGATGCAGG - Intergenic
953858348 3:46519532-46519554 CTGTGAAGGGAGAGAGAAGAGGG - Intronic
954023236 3:47760746-47760768 CTTTGGAAGGCCAAGGCAGAAGG + Intronic
954867832 3:53744717-53744739 CTAGGGAAGGAGCAGAAAGACGG - Intronic
954966350 3:54614586-54614608 CTGGGGAATGAGAAGGAAGGAGG - Intronic
955014906 3:55060881-55060903 CCATGGAATGAAAAGGAAGAGGG - Intronic
955263861 3:57422557-57422579 CTTTGGAAGGCCAAGGAAGAAGG + Intronic
955324452 3:57999207-57999229 CTGTGGTAAGAGAATGAAGGCGG - Intergenic
955406902 3:58631321-58631343 CTGAGGAAGGAGTGGGAAGCTGG + Intergenic
956081975 3:65566996-65567018 CTGTGGAGGGAGCAGGGAGCAGG - Intronic
956082001 3:65567299-65567321 GTGTGGAGGGAGCAGGAAGCAGG - Intronic
956492285 3:69785892-69785914 CCGTGGATGAAGGAGGAAGAGGG + Intronic
956608960 3:71102592-71102614 CTTGGGAAAGAGAAGAAAGACGG - Intronic
956617783 3:71190175-71190197 CTATGGAGGCAGTAGGAAGATGG - Intronic
956913133 3:73842195-73842217 CTGGGGGAGGCTAAGGAAGAAGG + Intergenic
957133663 3:76256461-76256483 CTTTGGGAGGCCAAGGAAGATGG + Intronic
957311556 3:78526151-78526173 CTGGGGAAGGAGAGGGGAGGAGG - Intergenic
958122512 3:89309838-89309860 TTGTGAAAAGAGAAGAAAGAAGG - Intronic
958717979 3:97809789-97809811 TTATAGAAGGAAAAGGAAGAAGG + Intergenic
959134541 3:102400511-102400533 CTGAGCATGGAGAAGGCAGAGGG - Intronic
959753498 3:109867453-109867475 CTTTGGGAGGTCAAGGAAGAAGG - Intergenic
959917838 3:111837797-111837819 CTGTGGAAGGCCAAGGCAGGAGG + Intronic
960706367 3:120485934-120485956 CTGGGGCAGGAGAAGGGATAAGG - Intergenic
960832494 3:121864570-121864592 CTTTGGGAGGACAAGGCAGATGG + Intronic
960937279 3:122911847-122911869 CTTCAGAAGGAGAAGGAAGTTGG + Intronic
960972669 3:123150706-123150728 CAGTGTCTGGAGAAGGAAGAGGG - Intronic
961426008 3:126848650-126848672 CTGGGGGTGGAGAAGGTAGAGGG + Intronic
961635778 3:128331447-128331469 CTGAGGAAGGGGAGGGAAGAGGG - Intronic
961635794 3:128331507-128331529 TTGAGGAAGGAGAGGGAAGAGGG - Intronic
961747877 3:129077143-129077165 GAGAGGAATGAGAAGGAAGAGGG - Intergenic
961763543 3:129189874-129189896 CTTTGGAAGGTGGAGGAGGATGG - Intergenic
961959673 3:130841705-130841727 CTCTGCAGGGAGAAGGAAGCAGG + Intergenic
962089830 3:132231307-132231329 CTGGGGAAAGCGAAGGAATAGGG - Intronic
962488080 3:135864216-135864238 CCTTGGTAGCAGAAGGAAGAGGG - Intergenic
962534102 3:136311581-136311603 CTTTGGAAGGCCAAGGCAGAAGG - Intronic
962662613 3:137619038-137619060 CTAAGGATGGAGAAGGAAGGTGG + Intergenic
963224907 3:142852575-142852597 CTGAGGAAGGAGGAGGAAATGGG - Intronic
963358809 3:144244542-144244564 TTGTGGAAGAAGAAGGAAGCAGG + Intergenic
963498210 3:146095897-146095919 CTGTGGAGGGAGAGGGGGGAGGG - Intronic
963546518 3:146666072-146666094 CTGTGGAAGTAAGAAGAAGAGGG - Intergenic
963923642 3:150929020-150929042 CTGTGGAAAAACAAGAAAGAGGG + Intronic
964394237 3:156228800-156228822 CTGTGGAAGGAGAAATAGGGTGG - Intronic
964560997 3:157996520-157996542 AAGTGGAAGCAGAAGGCAGAAGG + Intergenic
964598490 3:158466816-158466838 CTTTGGAAGGCCAAGGAAGGAGG + Intronic
964751758 3:160060184-160060206 CTGTGGGAGGCCAAGGCAGAGGG + Intergenic
964762000 3:160143026-160143048 CAGGGGCTGGAGAAGGAAGAGGG + Intergenic
965888840 3:173484607-173484629 CTCTAAAAGGAGAATGAAGATGG + Intronic
966145815 3:176810824-176810846 ATCTGGAAAGAGAAGTAAGAAGG - Intergenic
966402543 3:179562687-179562709 CAGTGGGAGAAGAAGGAGGAAGG - Intergenic
966443477 3:179974276-179974298 CTGTGGGAGGAGAAGCCACAGGG + Intronic
966486588 3:180477947-180477969 ATGTGGAATCAGAAGGAAAAAGG - Intergenic
966519092 3:180854070-180854092 CTTTGGAAGGCGAAGGCAGGAGG + Intronic
966521895 3:180882295-180882317 CGGAGGAAGAAGAAGGAAGAAGG - Intronic
968075825 3:195815767-195815789 CTGTGTAAGAAGAAGGAGGCCGG - Intergenic
968075836 3:195815812-195815834 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075848 3:195815857-195815879 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075860 3:195815902-195815924 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075872 3:195815947-195815969 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075897 3:195816037-195816059 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075909 3:195816082-195816104 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075921 3:195816127-195816149 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075933 3:195816172-195816194 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075945 3:195816217-195816239 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968075969 3:195816307-195816329 CTGTGTAAGGAAAAGGAGGCCGG - Intergenic
968076095 3:195816780-195816802 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076131 3:195816908-195816930 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076231 3:195817253-195817275 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076293 3:195817475-195817497 CTGTGTAAGGAGAACGAGGCCGG - Intergenic
968276218 3:197442306-197442328 GTGGGGAGGGAGAAGGCAGATGG + Intergenic
968754700 4:2409261-2409283 CTCTGGATGGAGAAAGTAGATGG - Intronic
969239408 4:5888922-5888944 CTATGGAAGGAGAGGCAAGAGGG - Intronic
970166861 4:13247755-13247777 AAGTAGAAGGAGAAAGAAGATGG - Intergenic
970276016 4:14402155-14402177 CTGCTGAAGCAGAAGGAAAAGGG + Intergenic
970397887 4:15689269-15689291 CTATGGAAAGAGTAGTAAGAAGG + Exonic
970432441 4:16001270-16001292 CTCTGGAAGGAAAGAGAAGATGG + Intronic
971222217 4:24718734-24718756 CAGTTGAAGCAGAAGCAAGAGGG + Intergenic
971364158 4:25963576-25963598 CTGAGTAGGGAGTAGGAAGATGG - Intergenic
971443388 4:26715284-26715306 ATGTGGAAGTTGAAGGTAGAAGG - Intronic
971570946 4:28210010-28210032 GAGGGGAAGGAGGAGGAAGAGGG - Intergenic
972271017 4:37510934-37510956 TTGTGAAAGGGGAGGGAAGAAGG - Intronic
972452454 4:39216003-39216025 CTGTTGAAGGAGTATGAAAATGG + Exonic
972498109 4:39652777-39652799 CTTTGGCAGGCCAAGGAAGAAGG - Intergenic
972580776 4:40394056-40394078 CTTTGGAAGGCCAAGGCAGATGG + Intergenic
972591737 4:40494510-40494532 CTGTGGGAGGGCAAGGAACAAGG + Intronic
973726765 4:53784724-53784746 CTTTGGGAGGCGAAGGCAGAAGG - Intronic
973765973 4:54163242-54163264 GAGGGGAAGGAGAAGGAAGTGGG - Intronic
973808432 4:54547626-54547648 AGGTGGAAGCAGAAGGCAGAAGG - Intergenic
973826390 4:54711122-54711144 CTTTGGGAGGACAAGGCAGAAGG - Intronic
974006316 4:56560669-56560691 CTTTGGAAGGCTAAGGCAGAAGG - Intronic
974218756 4:58936912-58936934 CTGAGGAAAGAGAAAGAAGTAGG + Intergenic
974229113 4:59086588-59086610 CTGCGGAAAGAGAAGGATGGAGG + Intergenic
974370426 4:61009794-61009816 CTTTGGGAGGACAAGGAAGGCGG + Intergenic
975276263 4:72505552-72505574 CCCTGGAAGGAGACGGTAGAGGG + Intronic
975442029 4:74421808-74421830 GAGGGGAAGGGGAAGGAAGATGG + Intergenic
975622844 4:76310974-76310996 GTATGAAAGGAGAGGGAAGAGGG - Exonic
975641582 4:76505892-76505914 CTTTGGGAGGAGGAGGCAGAAGG - Intronic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
975814734 4:78205899-78205921 CTGAGGAAGGAAGAGGAAAAGGG + Intronic
975851399 4:78576538-78576560 CTTTGGGAGGACAAGGCAGAAGG - Intronic
976288885 4:83397207-83397229 CTTTGGAAGGCCAAGGCAGATGG + Intergenic
976292411 4:83433738-83433760 CTTTGGAAGGCGAAGGCAGGAGG + Intronic
976895160 4:90100398-90100420 CTGTGAAATTAGAAGCAAGATGG + Intergenic
977014034 4:91670161-91670183 CTGTGAAAGCAGCTGGAAGAAGG - Intergenic
977017500 4:91710277-91710299 CTGTGGGAGGCCAAGGAAGAGGG + Intergenic
977125310 4:93158437-93158459 CTGGGGAAAGAGAAAGGAGAAGG + Intronic
977277084 4:94991164-94991186 CAGTAGAAGGAGAATGAAAAAGG - Intronic
977433360 4:96960899-96960921 CTGAGGATGGGGAAGGAATATGG - Intergenic
977472276 4:97455879-97455901 CTCTGGGAGGAGAATGTAGATGG - Intronic
977743139 4:100511654-100511676 CTTTGAAATGAAAAGGAAGAAGG + Intronic
978010323 4:103674406-103674428 CTGTGGAAATAGATGGAAGTAGG + Intronic
978128982 4:105170942-105170964 GTGTAGAAGGAGGAGGAAGTTGG - Intronic
978523131 4:109637070-109637092 CTATGGAAGGAAGAGGAAGCAGG + Intronic
978721179 4:111911457-111911479 CTGCGGAGAGAGAAGGGAGATGG + Intergenic
978784603 4:112595472-112595494 CTTTGGAAGGCGAAGGCAAAAGG + Intronic
978808888 4:112829410-112829432 CTTTGGGAGGCGAAGGCAGAAGG + Intronic
979048927 4:115904848-115904870 ATGTTGAAGGAGAATGAAGAGGG + Intergenic
979309358 4:119184056-119184078 CTTTGGGAGGAGAAGGTGGATGG - Intronic
979472648 4:121118809-121118831 GTCTGGAAGTAGGAGGAAGAGGG - Intergenic
979822948 4:125196530-125196552 CTTTGGAAAGAATAGGAAGACGG + Intergenic
980348121 4:131651306-131651328 CTTTGGAAGGCCAAGGCAGATGG - Intergenic
980453291 4:133005548-133005570 AGGTGGAAGGATAAGGAAGCAGG + Intergenic
980835708 4:138189296-138189318 TTGTGGAATGAGAAGGAGCATGG + Intronic
980873636 4:138638574-138638596 CTGTGGCAGGAGTGGGGAGATGG - Intergenic
980938934 4:139254178-139254200 CTGAGCAAGGAGACAGAAGATGG + Intergenic
981280829 4:142956092-142956114 CTTTGGGAGGACAAGGAAGGTGG + Intergenic
981295430 4:143125856-143125878 CTCTGGAAGGTGGAGGAGGAAGG - Intergenic
981321377 4:143395962-143395984 CTGTTGAAGGAGAGGGCATATGG + Intronic
981869962 4:149474204-149474226 TAGTGGAAGGAAAAGGAATAGGG + Intergenic
982048126 4:151469777-151469799 CTGTGGAAGGCAAAAGAAGAGGG - Intronic
982116616 4:152103731-152103753 CTGGGGCAGGAGGAGGAGGAGGG - Intergenic
982558481 4:156899569-156899591 CTTTGGAAGGCCAAGGCAGATGG + Intronic
982560457 4:156923214-156923236 CTGGTGAAGGAGCAGCAAGAAGG - Intronic
982817179 4:159900523-159900545 CTGTGGGAGGCCAAGGCAGATGG - Intergenic
983025942 4:162738318-162738340 CTCAGGAATGAGAATGAAGAAGG - Intergenic
983112731 4:163772916-163772938 ATATGGAAGGAGAAGGAGGTGGG + Intronic
983201770 4:164868624-164868646 CTTTGGGAGGACAAGGCAGATGG - Intergenic
983301067 4:165926530-165926552 CTCAGGAAGCAGAAGGCAGAGGG + Intronic
983344872 4:166515531-166515553 ATGTGTGAGGAGAAGGATGATGG - Intergenic
983363096 4:166752121-166752143 CTGAGGCAGGAGAAGGAGGTTGG - Intronic
983599202 4:169505316-169505338 CTGAGGAAGGAGGAGTAAGAGGG - Intronic
983620052 4:169751525-169751547 CCGTGAATAGAGAAGGAAGATGG - Intronic
983650079 4:170028348-170028370 CTGTCTAAGGAGGAGGAGGATGG + Intronic
984035097 4:174657407-174657429 TTGTATAAGGAGAAGGAAAAAGG + Intronic
984782875 4:183541839-183541861 CTGTGCAAGGGGAATGCAGAAGG - Intergenic
985126690 4:186701681-186701703 CTGTGACAGGAGAAGGAATGTGG - Intronic
985243671 4:187957917-187957939 CTTTGGAAGGCCAAGGCAGAAGG + Intergenic
985282367 4:188300119-188300141 CTGAGGAAGCAGAGGGAACAGGG - Intergenic
985362786 4:189193148-189193170 CTTTGGGAGGAGAAGGAGGGTGG - Intergenic
985746763 5:1652429-1652451 CTGTGGTGGGAGCAGGCAGAGGG - Intergenic
985951576 5:3225511-3225533 CTGTGGGAGGAGAAGCAGGCTGG - Intergenic
986129375 5:4912731-4912753 GAGAGAAAGGAGAAGGAAGAAGG + Intergenic
986178584 5:5372867-5372889 CTGAGGAGGCAGAAGGCAGAAGG + Intergenic
986291997 5:6407589-6407611 CTCTGGAAGGAGAAGAGGGAAGG - Intergenic
986350796 5:6877947-6877969 CTACAGAAGAAGAAGGAAGAGGG - Intergenic
986431440 5:7685040-7685062 TTGTGGGAGGAGGATGAAGAAGG - Intronic
986504396 5:8433630-8433652 CTATGGAAGGGGAAGGATGTGGG - Intergenic
986526222 5:8680242-8680264 TTTTGGGAAGAGAAGGAAGAAGG - Intergenic
987341387 5:16942560-16942582 CTTTGGAGGGAGAAGGAGAAGGG - Intergenic
988080911 5:26414226-26414248 CTTTGGAAGGCCAAGGTAGATGG + Intergenic
988658490 5:33238507-33238529 CTCTGGAAGGCCAAGGCAGAAGG - Intergenic
988688381 5:33547966-33547988 CAGGGGAAGGAGGATGAAGAGGG + Intronic
988796893 5:34659509-34659531 CTGTGGAAGGCTGAGGTAGAAGG - Intronic
988942979 5:36164540-36164562 ATGTGGAGGGAGAAGCCAGACGG - Intronic
989160249 5:38384117-38384139 GAGAGGAAGGAGAAGGAATAAGG + Intronic
989193739 5:38695674-38695696 ATGGGGAAAGAGGAGGAAGAAGG - Intergenic
989333810 5:40291011-40291033 CTTTGGGAGGACAAGGTAGATGG - Intergenic
989398394 5:40982787-40982809 CTGTGGGAGGAGAAATGAGAGGG + Exonic
989474128 5:41855277-41855299 GACTGGAAGGAGCAGGAAGAGGG + Intronic
989564303 5:42886202-42886224 CTGCTGTAGGAAAAGGAAGAAGG - Intronic
989756216 5:44958768-44958790 AGGAGGAAGGAGAAGGAAGGAGG - Intergenic
990194163 5:53294243-53294265 CTGGGGAGGGAGAATGAAAAAGG + Intergenic
990415850 5:55585702-55585724 CTTTGGGAGGACAAGGAAGGAGG - Intergenic
990504126 5:56427794-56427816 CTGGGGTGGGAGAAGGCAGAGGG - Intergenic
990689170 5:58343469-58343491 GTGTGGAGAGAGTAGGAAGAGGG + Intergenic
990889911 5:60636677-60636699 TAGTGGAAGAAGAAAGAAGAAGG - Intronic
991186154 5:63810617-63810639 ATCTGGAAGGTGAAGGAACATGG - Intergenic
991275408 5:64841199-64841221 CCATGGTAGGAGGAGGAAGATGG + Intronic
991574544 5:68089406-68089428 CTTTGGGAGGCCAAGGAAGAAGG + Intergenic
991623761 5:68575552-68575574 CTTTGGAAGGCCAAGGTAGAGGG - Intergenic
991642337 5:68767668-68767690 GTGTGTAAGGATTAGGAAGAGGG - Intergenic
992233242 5:74684060-74684082 CTTTGGAAGGCGAAGGAGGGCGG - Intronic
992319898 5:75603481-75603503 CAGTGGAATGAGTAGGAAAAGGG + Intergenic
992341071 5:75823945-75823967 CTGTGGGAGGAGGAGGCAGAAGG + Intergenic
992376186 5:76190044-76190066 TGGTGGAAGCAGAAGGAAGATGG + Intronic
992518802 5:77525619-77525641 CCCTGCAAGGTGAAGGAAGAGGG - Intronic
992557338 5:77916409-77916431 CTTTGGAAGGCCAAGGCAGATGG + Intergenic
992846442 5:80753832-80753854 CAGTGGAAGGAGAAAGAACAGGG + Intronic
993070416 5:83155070-83155092 CTGGGGCAGGAGAAAGAGGAAGG + Intronic
993227034 5:85180790-85180812 CTGAGGAATGAAAAGGCAGAAGG + Intergenic
993317674 5:86431554-86431576 CTTTGGAAGGCCAAGGAAGCAGG + Intergenic
993364170 5:87016566-87016588 CTGTAAAAAGAGAAAGAAGAAGG + Intergenic
993484220 5:88462569-88462591 CTGTGGAAAGAGAAAGCAGGGGG + Intergenic
994110765 5:96001357-96001379 CTGGGGAAGAAGAATCAAGAAGG + Intergenic
994356483 5:98799152-98799174 CTTGGGAAGGAAAAGGAAAAAGG + Intergenic
994438153 5:99764072-99764094 CTGTGGAAGGAGAGAGAAGCAGG - Intergenic
994630713 5:102283760-102283782 CTGTGGAAGGACAAGGCATTAGG - Intronic
994630748 5:102284243-102284265 CTGTGGAAGGACAAGGCATTAGG + Intronic
994723732 5:103410202-103410224 CAGTGGTAGGACAAGGATGAGGG + Intergenic
995721919 5:115144342-115144364 CTGAGGGAAGAGAAGGATGAAGG - Intronic
995951351 5:117717976-117717998 CTTTGGGAGGTGAAGGCAGATGG - Intergenic
996448531 5:123588318-123588340 CTTTGGAAGGCCAAGGCAGAAGG - Intronic
996656095 5:125938386-125938408 AAGGCGAAGGAGAAGGAAGAAGG - Intergenic
997301649 5:132810595-132810617 GTGGGGAAGGATAGGGAAGAGGG - Intergenic
997465696 5:134086683-134086705 AAGGGGAAGGGGAAGGAAGAAGG - Intergenic
997565467 5:134882825-134882847 CCGTGGAAAGAGGAGGGAGAGGG + Intronic
997632541 5:135379721-135379743 CACTGAAAGGAGAAGGAAGAAGG - Intronic
997674682 5:135703924-135703946 TTGTGCAAGGAGAACCAAGAGGG - Intergenic
997737495 5:136224783-136224805 CTGTGGAAGCAGAGGGTGGAGGG - Intronic
998138546 5:139687315-139687337 CTGTGCAGGAAGAAGGAAGAAGG + Intergenic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998305553 5:141072736-141072758 CTGTGGGAGGACAAGGCAGGAGG + Intergenic
998357347 5:141551204-141551226 CTTTGGAAGGCCAAGGAGGAAGG + Intronic
998447917 5:142212465-142212487 CTTTGGGAGGACAAGGAAGGAGG + Intergenic
998491479 5:142550944-142550966 CTTTGGAAGGATAAGGTGGACGG - Intergenic
998627615 5:143863479-143863501 CTGCTGGAGGACAAGGAAGATGG - Intergenic
998651995 5:144131190-144131212 CTTTGGAAAATGAAGGAAGAAGG + Intergenic
998679883 5:144455236-144455258 ATGTGGAAGCAGAAGGAAGTTGG - Intronic
998936705 5:147236647-147236669 CTGTGGAAGGGGGAAGCAGATGG - Intronic
999072795 5:148765349-148765371 ATGAGAAAGGAGAGGGAAGAGGG - Intergenic
999686512 5:154108046-154108068 CTTTGGCAGGAGATGGAACAGGG - Intronic
999701806 5:154235095-154235117 CTGTGGAAGGACAAGGAACCTGG + Intronic
999835255 5:155363553-155363575 ATGGGGAAGGAGGAGAAAGATGG - Intergenic
1000097375 5:157983900-157983922 GAGAGGAAGGAGAAGGAACAGGG + Intergenic
1000152747 5:158519294-158519316 CTGTTCCAGGAGAAGGAACAGGG + Intergenic
1000170437 5:158697505-158697527 GGGTGGAAGGAAGAGGAAGAAGG + Exonic
1000648670 5:163787737-163787759 ATGTGGAAGAGGAAGGCAGAAGG - Intergenic
1000680185 5:164174166-164174188 AAGTGGAAGGGCAAGGAAGAAGG + Intergenic
1000865535 5:166509658-166509680 CTGAAGAAGGACAAGAAAGAGGG + Intergenic
1001737807 5:174021114-174021136 AAGAAGAAGGAGAAGGAAGAAGG + Intergenic
1001737812 5:174021150-174021172 AGAAGGAAGGAGAAGGAAGAAGG + Intergenic
1001741243 5:174054620-174054642 CTTTGGAAGGCCAAGGCAGAAGG - Intronic
1002002555 5:176206272-176206294 TGGTGAAAGCAGAAGGAAGAGGG + Intergenic
1002061876 5:176630186-176630208 CTGGGGAAGGGGATGGAAAATGG - Intronic
1002108416 5:176891740-176891762 ATGGGGCAGGAGGAGGAAGAAGG - Intronic
1002290059 5:178194292-178194314 CTGTGCAGGGAGAAGGGAGGTGG + Intergenic
1002295473 5:178228501-178228523 CTCTGGAAAGAGAAGGGAGCTGG - Intronic
1002366486 5:178716595-178716617 CTGGGGAAGGAGGGGGATGAAGG + Intronic
1002397314 5:178968153-178968175 TTGTGGTAGGAAAAGGGAGAGGG - Intergenic
1002523006 5:179801615-179801637 GTGTGGCAGGTGATGGAAGACGG + Exonic
1002969125 6:1996093-1996115 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1003099530 6:3166509-3166531 ATGTGAAAGGAGGAGGTAGAAGG - Intergenic
1003191566 6:3879594-3879616 TTGTGGAAGGACAGGGATGAAGG + Intergenic
1003285667 6:4731889-4731911 CTGTGGAAGGAGGGGGAAGATGG + Intronic
1003331651 6:5134853-5134875 GAGAGGAAGGAGAAGGAATAGGG - Intronic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1003513207 6:6798852-6798874 CTGTGGCTGGCAAAGGAAGATGG + Intergenic
1003595351 6:7469534-7469556 CTTTGGGAGGAGAAGGCAGGAGG - Intergenic
1003974134 6:11326775-11326797 GAGTGGAGGGGGAAGGAAGATGG - Intronic
1004118134 6:12791195-12791217 CTGCAGAAGGAGAAGGAAGCAGG + Intronic
1004475602 6:15968322-15968344 CTGGGGCTGCAGAAGGAAGATGG + Intergenic
1004551711 6:16654300-16654322 CTTTGGAAGGCCAAGGCAGATGG + Intronic
1004578379 6:16922523-16922545 CAGTGGCAGGAGATGGGAGAGGG + Intergenic
1004947041 6:20626968-20626990 CTGTAGACGGGGAAGGGAGAAGG + Intronic
1005016259 6:21377981-21378003 CAGGGGAAGGAGAGGGATGAGGG + Intergenic
1005407129 6:25501290-25501312 CTTGGGGAGGGGAAGGAAGATGG - Intronic
1005622012 6:27628876-27628898 TGGGGGAAGGAGAAAGAAGAGGG + Intergenic
1005777110 6:29146238-29146260 CTGGGGCAGGGGAAGGAAGGGGG - Intergenic
1005882155 6:30070065-30070087 CTCTGGGAGAGGAAGGAAGAGGG + Exonic
1005912931 6:30326785-30326807 CTGCGGAAGAAGGAGGAGGAGGG - Intronic
1006216517 6:32448572-32448594 CTTTGGGAGGCCAAGGAAGAAGG + Intergenic
1006330742 6:33388927-33388949 CTTTGGAAGGCCAAGGCAGAAGG - Intergenic
1006461009 6:34158073-34158095 CTGAGGAAGTGGAAGGGAGAGGG + Intergenic
1006644692 6:35508062-35508084 CTTTGGGAGGAGGAGGCAGATGG - Intronic
1006699754 6:35962484-35962506 CTGAGGAAGGGGAGGGCAGAGGG - Intronic
1006926299 6:37657353-37657375 CTGTGGAAGGGGCAGAATGATGG - Intronic
1006934532 6:37708158-37708180 AAATGGAAGGAGAAGGGAGATGG + Intergenic
1007392904 6:41560900-41560922 TTGTGGAAGGAGAAAAGAGAAGG - Intronic
1007470547 6:42087465-42087487 AAATGGAATGAGAAGGAAGAAGG - Intergenic
1007593200 6:43035915-43035937 CTATGGAAGGAGGGGGAAGGGGG - Intergenic
1007724132 6:43904275-43904297 CTGTAGAAGAACAAGAAAGAAGG - Intergenic
1007748252 6:44056484-44056506 CTGAAGAAGGAGAAAGGAGATGG + Intergenic
1008045158 6:46844400-46844422 CTGTGGAAGGCAAAGAGAGATGG - Intergenic
1008274694 6:49529177-49529199 CTTTGGAAGGCCAAGGCAGATGG + Intergenic
1008278712 6:49570788-49570810 TTCTGGAAGGAAATGGAAGAAGG + Intergenic
1008292612 6:49736329-49736351 CTGTGGAAGGAGTAGGCGGCTGG - Intronic
1008336693 6:50314671-50314693 CTGTGGGAGGAGAAAGCAGTGGG + Intergenic
1008581707 6:52913980-52914002 CAGTGGAAGGAGATGGGACAAGG + Intergenic
1008626249 6:53319673-53319695 TTGTGGAAAGAAAAGGAAGTTGG - Intronic
1008966908 6:57322043-57322065 CAGTGGTTGGAGAAGGAAGGTGG + Intronic
1009583800 6:65569977-65569999 ATGTGGAAGGACAAGGGAGTTGG + Intronic
1009628205 6:66163514-66163536 CTGGGGAAGGAGAAAGGAAAGGG + Intergenic
1009908634 6:69899394-69899416 CTGTGGGAGGCCAAGGCAGATGG - Intronic
1010113289 6:72269059-72269081 CTCTGAAAGGCCAAGGAAGAAGG - Intronic
1010190060 6:73185979-73186001 CTTTGGAAGGCCAAGGCAGATGG + Intronic
1010432067 6:75788846-75788868 CTGAGGAAGGAGGTGGGAGAAGG + Intronic
1010737123 6:79455476-79455498 CAGGTGCAGGAGAAGGAAGAGGG + Intergenic
1010747923 6:79585248-79585270 AAATGGAAGGAGAAGAAAGAAGG - Intergenic
1011043567 6:83057605-83057627 CTGTGGGTGGAAAAGAAAGAAGG + Intronic
1011140627 6:84151681-84151703 TTGGGGATGGAGAAGGAAGAAGG + Intronic
1011771285 6:90676225-90676247 TTGGGGAGGGAGAAGGAGGATGG + Intergenic
1011791797 6:90906966-90906988 CTGTGGAAAGAGAAAGAGAAAGG - Intergenic
1011885685 6:92092045-92092067 CTGAGGCAGGAGAATGAAGCCGG + Intergenic
1011914295 6:92483883-92483905 CTTTGGAAGGCAAAGGCAGAAGG - Intergenic
1012072422 6:94639844-94639866 CTGTGGAAGGAGGTGGAATTCGG + Intergenic
1012175737 6:96080657-96080679 CTGTGGATTGAAATGGAAGAAGG - Intronic
1012685542 6:102243487-102243509 GTGTGGAAAGAGAATGGAGAAGG - Intergenic
1012745195 6:103078107-103078129 CTGTCAAAGGAGATGGAAAATGG - Intergenic
1012979725 6:105816733-105816755 CTTTGAAGGAAGAAGGAAGAGGG - Intergenic
1013233962 6:108180973-108180995 CTGGGGAAGGAGAAGAAACAGGG - Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013349131 6:109290312-109290334 CTTGGGAAGGTGAAGGAAGCCGG + Intergenic
1013588361 6:111599149-111599171 CTTTGGAAGGACGAGGCAGAAGG - Intronic
1013838080 6:114356629-114356651 CTGTGGAAGCAGAAAGAATGAGG + Intergenic
1014059431 6:117053096-117053118 TTGTGGAGGGAGATGGGAGAGGG + Intergenic
1014302131 6:119694802-119694824 ATGAGGAAGGAGAGGCAAGAAGG - Intergenic
1014813041 6:125906666-125906688 CTGGGGAGAGAGGAGGAAGAGGG + Intronic
1015033182 6:128621467-128621489 CTGTGGGGGGAGTAGGGAGAGGG - Intergenic
1015036937 6:128667431-128667453 CTGTGGTAGTTGAAGGTAGAGGG + Intergenic
1015240758 6:131021039-131021061 CTGTGGGAGGCCAAGGCAGAAGG - Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015427987 6:133094650-133094672 CTTTGGAAGGCCAAGGCAGAAGG + Intergenic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1016544139 6:145201704-145201726 CTGGGAAAGAAGAAAGAAGAAGG - Intergenic
1016763527 6:147767257-147767279 CTGTGGAGGAAGAAGGAAGCAGG + Intergenic
1016792366 6:148079173-148079195 GTGAGGAAGGAGAGTGAAGAGGG + Intergenic
1017438736 6:154442772-154442794 CTGTGGAAGGAGCAGAGAGAAGG - Intronic
1017758606 6:157550931-157550953 CCATGGAAGGGGAAGGATGATGG + Intronic
1017988214 6:159463201-159463223 CTGTGGCTGGCGAAGGTAGACGG - Intergenic
1018162264 6:161056747-161056769 CTGAGGAAGGTGAAGGAAAAAGG - Intronic
1018282780 6:162206027-162206049 CGAGAGAAGGAGAAGGAAGAAGG + Intronic
1018596102 6:165482344-165482366 CTGGGGATAGAGAAGGAAGAGGG + Intronic
1018617013 6:165696103-165696125 TTGGGGAGGGGGAAGGAAGATGG + Intronic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019484077 7:1280492-1280514 AGGAGGAAGAAGAAGGAAGAAGG + Intergenic
1019581264 7:1764170-1764192 CTTTGGAAGGCCAAGGAAGGAGG + Intergenic
1019869267 7:3743702-3743724 ATGTCGGAGGAGGAGGAAGAGGG + Intronic
1020024545 7:4889656-4889678 CTTTGGGAGGCCAAGGAAGATGG + Intergenic
1020241196 7:6396419-6396441 CTGGGGACGAAGAAGGAACAAGG + Intronic
1020378439 7:7514760-7514782 CTGTGGAAGGAGTTGGAGGTGGG - Intronic
1020577731 7:9955454-9955476 CTGGGGAAAGAAAAGGGAGAAGG + Intergenic
1020748770 7:12112253-12112275 CTTTGGGAGGGGAAGGAAGCAGG - Intergenic
1020803172 7:12756842-12756864 CTGGGAAAGGAGAAGGAAACTGG + Intergenic
1021295909 7:18905799-18905821 TTGATGAGGGAGAAGGAAGAAGG - Intronic
1021488785 7:21196218-21196240 CTGGTGAAGCAGCAGGAAGATGG - Intergenic
1021530510 7:21639439-21639461 CTCTGGAGGGAGGAGTAAGAAGG - Intronic
1021767144 7:23961337-23961359 CTTTGGCTGGAGTAGGAAGATGG + Intergenic
1022063592 7:26826659-26826681 ATATAGAAGGAGAAAGAAGACGG - Intronic
1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG + Intronic
1022547238 7:31200756-31200778 CTGTGGGAAGACAATGAAGATGG + Intergenic
1022591585 7:31668988-31669010 TTGAGGAAGGAGAAGGAAGTAGG + Intergenic
1022637768 7:32153453-32153475 GTGTGGATGGAGAAGAATGAAGG + Intronic
1022645433 7:32224927-32224949 CTCTGGAAGGGGATGGGAGAAGG + Intronic
1022656083 7:32320354-32320376 CTGTGGGAGGAGTGGGAGGAGGG + Intergenic
1023027456 7:36063628-36063650 CTGTGGATGGAGCAGGAAGCAGG + Intergenic
1023542184 7:41277443-41277465 GTCTGGGAGAAGAAGGAAGAAGG - Intergenic
1023570816 7:41569617-41569639 CTCTAGAAGCAGAAGCAAGAAGG + Intergenic
1023689315 7:42769949-42769971 GCTTGGAAGGAGAAGGTAGAGGG - Intergenic
1023968794 7:44977188-44977210 CTGAGAGTGGAGAAGGAAGAAGG + Intronic
1024229910 7:47355870-47355892 ATGAGGGAGGGGAAGGAAGATGG + Intronic
1024782474 7:52867005-52867027 CTGTTTAAGGAGATTGAAGATGG - Intergenic
1024928594 7:54645150-54645172 ATGTGGAATGAGAAGGAGAAGGG + Intergenic
1025061309 7:55810941-55810963 CTGTACAAGGAAAAGGCAGAAGG - Intronic
1025797932 7:64757388-64757410 CTGTGGAAGGGGACGGCAGCAGG + Intergenic
1025996236 7:66529251-66529273 CTGTGGGAGAGGAAGGAGGATGG + Intergenic
1026060707 7:67023338-67023360 CTTTGGGAGGCCAAGGAAGATGG - Intronic
1026464782 7:70644745-70644767 TTCTGGAATGAGGAGGAAGAGGG - Intronic
1026494618 7:70891730-70891752 CTGTGGGAGGCCAAGGAAGGTGG + Intergenic
1026524475 7:71142363-71142385 GGATGGCAGGAGAAGGAAGAAGG - Intronic
1026539819 7:71269817-71269839 CTGGGGGAGGTGATGGAAGACGG + Intronic
1026688497 7:72532983-72533005 CAGTGGAAGGCCAAGGAGGAAGG - Intergenic
1026723731 7:72854874-72854896 CAGTGGAAGGCCAAGGAGGAAGG - Intergenic
1026737559 7:72958800-72958822 CTTTGGAAGGCCAAGGCAGAAGG - Intergenic
1026792071 7:73340615-73340637 CTGTGGAGAGGGAAGGCAGATGG - Intronic
1026988200 7:74568157-74568179 CTGTGGGAGAGGAAGGAGGATGG + Intronic
1027106174 7:75406268-75406290 CTTTGGAAGGCCAAGGCAGAAGG + Intronic
1027208498 7:76123887-76123909 CTGTGGAAGAAGCATGGAGACGG - Intergenic
1027893539 7:84009799-84009821 AAGTAGAAGGGGAAGGAAGAAGG + Intronic
1027957600 7:84900971-84900993 ATGTGGAAGGAGGGGAAAGAGGG + Intergenic
1028193696 7:87880206-87880228 CTGTGGAGATAGAAGAAAGAAGG - Intronic
1028399037 7:90404668-90404690 CGGTGAAAGGATAAGGAAGGTGG - Intronic
1028742255 7:94288957-94288979 CTGGGGGAGGAGAAAAAAGAAGG + Intergenic
1028941482 7:96526729-96526751 CTCTGAAAGGAGAAAGGAGAGGG - Intronic
1029527134 7:101101691-101101713 CTTTGGGAGGCGAAGGAAGGAGG + Intergenic
1029745718 7:102514757-102514779 CTGTGGAAGGAGGAGGACCAGGG + Intronic
1029763657 7:102613736-102613758 CTGTGGAAGGAGGAGGATCAGGG + Intronic
1029974987 7:104825348-104825370 CTGTGAAAAGAGAAGCAACATGG + Intronic
1030046631 7:105502941-105502963 CTTTGGAAGGCCAAGGCAGATGG - Intronic
1030210825 7:106994111-106994133 ATATGGAAGTAGAAGGAAGCAGG - Intergenic
1031074194 7:117197261-117197283 CTTTGGGAGGACAAGGTAGAAGG - Intronic
1031157967 7:118133573-118133595 TTGTGGTAGGAGTAGGGAGATGG - Intergenic
1031221518 7:118972481-118972503 CTTTGGGAGGACAAGGCAGACGG - Intergenic
1031471112 7:122170301-122170323 CTGTAGGAGGACAAGGAAGGCGG - Intergenic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1031630201 7:124034481-124034503 CGGGGGAAGGAGGAGAAAGAGGG - Intergenic
1031863845 7:127015094-127015116 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031863849 7:127015122-127015144 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031870332 7:127083829-127083851 CTCTGGAAGGACAGGGATGAAGG - Intronic
1032072743 7:128818978-128819000 CTGGGGAGGGAGCAGGAGGAAGG - Intronic
1032180079 7:129668006-129668028 CTTTGGAAGGACAAGGCAGGAGG - Intronic
1032229903 7:130065459-130065481 CTTTGGAAGGACAAGGCAGGTGG - Intergenic
1032400169 7:131619270-131619292 CTGAGGGAGGTGAAGGAGGATGG - Intergenic
1032540352 7:132697707-132697729 ATGTGCAAGGAGAAGGGAAAGGG + Intronic
1032606283 7:133357862-133357884 CTGTGGCAGGAGAAGGATAAAGG - Intronic
1033115216 7:138619162-138619184 CTTTGGAAGGACAAGGCAGGAGG + Intronic
1033184184 7:139210862-139210884 TGGTGGAAGGTGAAGGAGGAAGG + Intergenic
1033475560 7:141688787-141688809 CTGTGGCAGGGCAGGGAAGATGG - Intronic
1033636513 7:143217143-143217165 CACTGGAAGAAGAAAGAAGAGGG - Intergenic
1033652159 7:143351785-143351807 CTGGGGAAGGAGATGGCACAGGG - Exonic
1033890425 7:146006381-146006403 AGGAGGAGGGAGAAGGAAGAGGG - Intergenic
1033975228 7:147092920-147092942 CTGTGGAAGGAAAAGGGGTATGG + Intronic
1033982612 7:147184719-147184741 AGTTGGAAGGAGAAGAAAGAAGG + Intronic
1034011937 7:147538406-147538428 CTTTGGAAGGCCAAGGAGGAAGG + Intronic
1034235760 7:149567786-149567808 CTTTGGGAGGCCAAGGAAGAAGG + Intergenic
1034384785 7:150731971-150731993 GTGTGGAAGGGAAAGGAAAAAGG - Intronic
1034410465 7:150938752-150938774 CTGTGGGAGGACAAGGAAAAAGG + Intergenic
1034413345 7:150952666-150952688 CTGCTGAAGGAGACGGAAGAAGG - Exonic
1034603351 7:152285739-152285761 CTCTGGAAGGCCAAGGAAGGTGG + Intronic
1035110346 7:156476348-156476370 CTTTTGGAGGAGAAGGAAGGTGG - Intergenic
1035113017 7:156500228-156500250 ATTTGGAAGAAGATGGAAGAAGG + Intergenic
1035117130 7:156533839-156533861 CAGTGAAGGCAGAAGGAAGAGGG + Intergenic
1035419704 7:158717345-158717367 CAGGAGGAGGAGAAGGAAGAAGG - Intergenic
1035524463 8:301341-301363 CTGGGGAAGGAAGAGCAAGAAGG + Intergenic
1035671950 8:1424869-1424891 CTGGGGAGGGAGAATGAGGAGGG + Intergenic
1036174825 8:6527406-6527428 ATGAGGGAGGAGAAGGGAGAGGG - Intronic
1036440718 8:8779393-8779415 CTTTGGAAGGCCAAGGAAGGAGG - Intergenic
1036796051 8:11757568-11757590 GTGGGGAAGGAGGAGGAAGCTGG + Intronic
1036828331 8:11998203-11998225 CTTTGGAAGGTTAAGGAAGGTGG + Intergenic
1037606250 8:20439861-20439883 CTGTGGAAGAGGAAGAAACATGG - Intergenic
1037683694 8:21119621-21119643 CTGTGGAAGGAGGATGAAGTTGG + Intergenic
1037793480 8:21969460-21969482 CTGTGAAAAGAGAGGGAAAAAGG - Intronic
1038008057 8:23450979-23451001 ATTTGGAAGATGAAGGAAGAGGG - Intronic
1038256031 8:25952047-25952069 CTGTGGAAGGCCAAGGCAGGAGG + Intronic
1038541827 8:28396186-28396208 CTATAGAAGGATAAGGAAGAAGG - Intronic
1038624508 8:29177656-29177678 CTTTGGGAGGACAAGGAAGGAGG + Intronic
1038913304 8:31991757-31991779 TTGGGGAAGGAGGAGGGAGAAGG - Intronic
1039674505 8:39646885-39646907 AAGTAGAAGGAGAATGAAGAGGG + Intronic
1040661180 8:49577643-49577665 CTGAGGAATGGGAGGGAAGAAGG - Intergenic
1040685058 8:49861700-49861722 CTTTGGAAGGCCAAGGCAGAAGG - Intergenic
1040726010 8:50382534-50382556 CTTTGGAAAGAGCAGGAAGTAGG + Intronic
1041306011 8:56461735-56461757 CTGTGAAAGTAGAAGGAAGTGGG - Intergenic
1041456631 8:58067459-58067481 CAGTGGATGGAGGAGGAAGGAGG - Intronic
1041524384 8:58789179-58789201 CTGTGGAACAAGAGGGAAGGAGG + Intergenic
1041910813 8:63086481-63086503 TGATGGAAGGAGAAGGGAGAGGG - Intergenic
1042104884 8:65315797-65315819 CTGTGGAAGAGGATGGCAGAAGG - Intergenic
1042223571 8:66497124-66497146 CTTTGGAAGGCCAAGGCAGATGG - Intronic
1042833155 8:73053434-73053456 ATGGGGAAGGAGGAGGAGGAGGG - Intergenic
1042927396 8:73979960-73979982 CTTTGGAAGGTGTAGGCAGAAGG - Intronic
1043109900 8:76167974-76167996 CTTTGGAAGGTCAAGGGAGAAGG + Intergenic
1043137472 8:76546527-76546549 CTGTAAAAGGAGCAGGAACAGGG - Intergenic
1043219694 8:77645022-77645044 CTATGGAAGGAGAAGGGGAAGGG - Intergenic
1043398055 8:79857815-79857837 CTGAGGGAGGAGAAGCAAAAAGG - Intergenic
1043400888 8:79883128-79883150 GTGTGGAAGGAGAGGCAAGGAGG - Intergenic
1043966038 8:86476942-86476964 CTTTGGAAGGCCAAGGCAGAAGG - Intronic
1044035582 8:87299250-87299272 ATGTGGAAGGAGAGGAAGGAAGG - Intronic
1044751095 8:95416036-95416058 CTGCTGAAAGAGAAGAAAGAAGG - Intergenic
1044864042 8:96551894-96551916 CTGTTTAAGAAAAAGGAAGAAGG - Intronic
1044892471 8:96851895-96851917 CTGAATAAAGAGAAGGAAGAGGG - Intronic
1044928212 8:97227174-97227196 CTGGGGATGGAGATGGATGATGG - Intergenic
1044973003 8:97638188-97638210 CAGTGGAAGGAGAAGGAACTAGG + Intergenic
1045290001 8:100824966-100824988 AGGTGGAAGGGGAAGGATGAAGG - Intergenic
1045332313 8:101166032-101166054 CTATAGAAAAAGAAGGAAGAGGG + Intergenic
1045534631 8:103015881-103015903 CTTTGGGAGGCCAAGGAAGACGG - Intergenic
1045698086 8:104833986-104834008 CAGCAGAAGGAGAAGGAACATGG - Intronic
1045767155 8:105686958-105686980 CTGTGTGCGTAGAAGGAAGAGGG - Intronic
1046621571 8:116533996-116534018 GTGTGGAAGGAGGAGGGATATGG + Intergenic
1046886626 8:119374727-119374749 CTGAGGGATGGGAAGGAAGAAGG + Intergenic
1047015698 8:120720849-120720871 CTGTGGAAGGGTAAGGTAGGTGG - Intronic
1047200585 8:122761818-122761840 CTCTGGCAGAAGAAAGAAGAGGG - Intergenic
1047295338 8:123565744-123565766 CTTTGGAAGGCCAAGGCAGATGG + Intergenic
1047527019 8:125642167-125642189 CTGTGGGAGCACAAGGAAGGAGG - Intergenic
1047553947 8:125908611-125908633 CTTTGGGAGGACAAGGCAGAAGG - Intergenic
1047614918 8:126556280-126556302 CTGTGGACGGGGGAGGAGGAAGG - Exonic
1047746998 8:127852748-127852770 GTGTGGATGGAGAGGGAGGAGGG - Intergenic
1048045647 8:130770304-130770326 CTGGGGAGGGAGAAGGCAGGAGG + Intergenic
1048147303 8:131857978-131858000 ATGGAGAAGGAGAAGAAAGAAGG - Intergenic
1048357780 8:133667581-133667603 GAGTGGGAGGAGGAGGAAGAGGG - Intergenic
1048591604 8:135825750-135825772 CTATGGAGGGAGGAGAAAGATGG - Intergenic
1048879166 8:138859016-138859038 CTGGGGACCGAGAAGGGAGATGG - Intronic
1048940169 8:139393570-139393592 CTTTGGAAGGCCAAGGCAGATGG - Intergenic
1049047477 8:140164444-140164466 CTGAAGAGGAAGAAGGAAGAAGG - Intronic
1049341431 8:142114646-142114668 CTTTGAGAGAAGAAGGAAGAAGG + Intergenic
1049528613 8:143142412-143142434 CTGGGGAAGGAGGAGGGACAGGG - Intergenic
1049566498 8:143341816-143341838 AAGAGGAAGAAGAAGGAAGAAGG - Intronic
1050203486 9:3173894-3173916 TCGTGGAAGGAGAAGGAGGAGGG + Intergenic
1050315681 9:4398528-4398550 GGGTGGAAGAAGAAAGAAGAAGG - Intergenic
1050426660 9:5518362-5518384 CCGTGGAAGGGCAAGGAAGAAGG + Intronic
1050712601 9:8482746-8482768 AAGTGGCAAGAGAAGGAAGAAGG - Intronic
1051235971 9:14999543-14999565 CTGTGAATAGAGAAGGAAGATGG + Intergenic
1051245106 9:15101984-15102006 CTTTGGAAGGCCAAGGCAGATGG + Intergenic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1052054622 9:23890370-23890392 CTGTTGAAGGTGTAGGGAGAGGG - Intergenic
1052406837 9:28072033-28072055 ATGTAGAAGGAGGATGAAGATGG - Intronic
1052495745 9:29221291-29221313 CAGAGGAAGAAGAATGAAGAAGG + Intergenic
1052841868 9:33298532-33298554 CTTTGGAAGGCCAAGGCAGAAGG + Intronic
1052858312 9:33421001-33421023 CTGTGGGAGGCCAAGGCAGATGG + Intergenic
1053079655 9:35164258-35164280 CTTTGGAAGGCCAAGGCAGATGG - Intronic
1053330547 9:37202723-37202745 CTGTGGAAGGCCAAGGCAGGAGG - Intronic
1053378508 9:37628953-37628975 CTGTGGGAGGCCAAGGCAGACGG + Intronic
1053480547 9:38413434-38413456 CAGTGGGAGGAGGAGGAAGGAGG - Intronic
1053892965 9:42713826-42713848 CTTTGGGAGGCGAAGGCAGACGG - Intergenic
1054150045 9:61595073-61595095 CTTTGGAAGGACAAGGCAGGAGG + Intergenic
1054469809 9:65526175-65526197 CTTTGGAAGGACAAGGCAGGAGG + Intergenic
1055486878 9:76764810-76764832 CAGTGGAGGGAGAAGGATCATGG - Intronic
1055829007 9:80358683-80358705 CTGTGGAAGGTCCTGGAAGAAGG + Intergenic
1055920676 9:81457455-81457477 CTGTGAAAGGATTAGGAACACGG + Intergenic
1056133810 9:83610771-83610793 CTTTGGGAGGACAAGGCAGAAGG - Intergenic
1056241976 9:84656809-84656831 GTGTGGAAGAAGATGGAAGGTGG + Intergenic
1056277094 9:85003970-85003992 CTATTTAAGGAGAAAGAAGAAGG + Intronic
1056328037 9:85497246-85497268 AAGAGGAAGGAGAAGGAGGAAGG + Intergenic
1056524920 9:87433981-87434003 GTGTGGCAGGAGAAGGTATATGG + Intergenic
1056608017 9:88103364-88103386 ATGAGGAAAGAGGAGGAAGATGG - Intergenic
1056818313 9:89817661-89817683 ATGTGGAAACAGAAGGAAGGAGG + Intergenic
1056989888 9:91400885-91400907 CTTTGAAAGGACAAGGCAGAAGG - Intergenic
1057115243 9:92514751-92514773 CTCTGGGAGGAGCAGGAAGCGGG + Exonic
1057345444 9:94246747-94246769 CTGTGGAAGGAGGAGGGATAAGG - Intergenic
1057743784 9:97735283-97735305 CTGTGGGAGGGGAGAGAAGAGGG + Intergenic
1057755986 9:97835944-97835966 CAGTTGAAGGATCAGGAAGAGGG + Intergenic
1057761411 9:97877655-97877677 CTGGAGAAGAAGAAAGAAGATGG + Intergenic
1057890257 9:98864578-98864600 CTGCAGATGGAGAAGGAAGGAGG - Intergenic
1058171547 9:101687048-101687070 CTGGGTAAGGAGGAGGAAGTCGG + Exonic
1058549656 9:106100628-106100650 CTGTCGAAGAAGCAGGGAGAGGG - Intergenic
1058561440 9:106233161-106233183 AGGAGAAAGGAGAAGGAAGAAGG - Intergenic
1058791808 9:108454474-108454496 CTGTGGGACAAGAAGCAAGATGG + Intergenic
1059072479 9:111153014-111153036 AGGAGGAAGGAGGAGGAAGAAGG + Intergenic
1059098705 9:111447871-111447893 CTGTGAAAGGACAAGGGAAAAGG - Intronic
1059371521 9:113843400-113843422 ATGCGGAAGGAGAGGGAGGAAGG - Intergenic
1059687405 9:116650838-116650860 CTGTGGAAGGGGAAAGAACAGGG - Intronic
1059714468 9:116900764-116900786 AGGTGGAGGGAGAAGAAAGAGGG - Intronic
1059842210 9:118230275-118230297 CAATGGAAGGAGAGGAAAGAAGG - Intergenic
1060036640 9:120261534-120261556 CTGGAGAGGGAGAAGGCAGAGGG + Intergenic
1060103235 9:120857842-120857864 CTGGGGTGGGAGAAGGAAGCAGG - Exonic
1060369828 9:123058038-123058060 CCGTGGAAAGAGAGGGGAGAGGG + Intronic
1060610377 9:124958661-124958683 CTTTGGGAGGTGAAGGCAGAGGG + Intronic
1060835353 9:126751563-126751585 CTGTGAAAGGAGAAAGGAGGAGG - Intergenic
1060921313 9:127422494-127422516 CTGAGGTGGCAGAAGGAAGATGG - Intergenic
1061147589 9:128808892-128808914 CCAGGGAGGGAGAAGGAAGAGGG + Exonic
1061170580 9:128950595-128950617 CTTTGGAAGGCCAAGGCAGAAGG + Intronic
1061246045 9:129401735-129401757 AGGGGGGAGGAGAAGGAAGAGGG - Intergenic
1061337017 9:129945922-129945944 CTGTGGGAGGCCAAGGCAGACGG + Intronic
1061679546 9:132236177-132236199 CTGTGGTGGGTGAAGGGAGAAGG + Intronic
1061723221 9:132566637-132566659 CTTTAGAAAGAGAAGGGAGATGG - Intronic
1062000142 9:134211806-134211828 CTGTGGAGAAAGAAGGCAGAGGG + Intergenic
1062212923 9:135374183-135374205 CTGTGGAAGTAGGTGGAGGAGGG - Intergenic
1062451926 9:136619375-136619397 CTGAAGGAGGAGGAGGAAGAGGG + Intergenic
1062638364 9:137503439-137503461 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638371 9:137503458-137503480 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638378 9:137503477-137503499 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638390 9:137503515-137503537 AGGAGGAAGGAGAAGGAGGAGGG + Intronic
1062638397 9:137503534-137503556 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1203704821 Un_KI270742v1:29992-30014 CTGTAGAAGAAGGAGGAACAGGG + Intergenic
1185485831 X:481466-481488 CGGAGGAAGGAGAGGGAGGAAGG + Intergenic
1185485896 X:481690-481712 CGGAGGAAGGAGAGGGAGGAAGG + Intergenic
1185485972 X:481949-481971 CGGAGGAAGGAGAGGGAGGAAGG + Intergenic
1185656587 X:1690446-1690468 CTGTGGGAGGGGAATGAGGAGGG - Intergenic
1185954035 X:4469461-4469483 CTGAGTAAAGATAAGGAAGAGGG - Intergenic
1186082954 X:5953125-5953147 CTGTGGGAGGACAAGGCAGGGGG + Intronic
1186497840 X:10026034-10026056 GGGTGTAGGGAGAAGGAAGAGGG - Intronic
1186568489 X:10689768-10689790 ATGTGTAAGGAGAAGGAAATTGG - Intronic
1187025792 X:15434140-15434162 AGGAGGAAGGAGAAAGAAGAAGG + Intronic
1187025806 X:15434240-15434262 AGGAGGAAGGAGAAAGAAGAAGG + Intronic
1187033894 X:15517428-15517450 TTCTGGAAGGAGCAGGAAAAAGG + Intronic
1187292549 X:17969183-17969205 CTTTGGAAGGCCAAGGCAGATGG + Intergenic
1187507410 X:19888172-19888194 CTGTTGGAGGGGAAGGAAAAGGG + Intergenic
1187540249 X:20186183-20186205 CTTTGGGAGGGCAAGGAAGACGG - Intronic
1187924741 X:24239324-24239346 GTGTTTAAGTAGAAGGAAGAAGG + Intergenic
1187963418 X:24587549-24587571 CTGGGGTAGGACAAGAAAGAGGG - Intronic
1188562944 X:31490449-31490471 CTGAGGCAGGAGAAGGAGAATGG + Intronic
1188575090 X:31639259-31639281 CTGTGGAGAGGGAATGAAGATGG + Intronic
1188814199 X:34691129-34691151 CTATGGAAGGCCAAGGTAGAAGG + Intergenic
1189102882 X:38209455-38209477 CCATGGAAGGCAAAGGAAGAAGG + Intronic
1189386340 X:40539811-40539833 CTGTAGGAGGAGGAGGAAGTGGG - Intergenic
1189601741 X:42634138-42634160 TTGAAGAAAGAGAAGGAAGATGG + Intergenic
1189791722 X:44611360-44611382 CTGTGGAAGGCCAAGGTAGGAGG + Intergenic
1189824092 X:44899184-44899206 CTGTGGAGGGAGGGGGAGGAAGG + Intronic
1189838245 X:45042250-45042272 CCGTGGAGGGAGAGGGGAGAGGG + Intronic
1189950555 X:46226118-46226140 CTGTGGAATGAGAAACAAGTGGG - Intergenic
1190018122 X:46846342-46846364 CTTTGGGAGGTGAAGGCAGAAGG + Intronic
1190210641 X:48443921-48443943 CTGGGGAAGGGAAAGGCAGAGGG + Intergenic
1190237505 X:48628311-48628333 GGGTGGAGGGAGAGGGAAGAAGG + Intergenic
1190330402 X:49231830-49231852 CTGTGGAAGGTGAAAGCAGTGGG - Exonic
1190885760 X:54530034-54530056 CGGAGGAGGGAGAAGGAGGACGG - Intergenic
1191678366 X:63815426-63815448 CAGAGGAAGGTGAAGGAAAATGG - Intergenic
1191885639 X:65885042-65885064 CTGAGGATGCAGCAGGAAGATGG + Intergenic
1191899078 X:66022615-66022637 TTCTGGAAGCAGAAGGCAGATGG + Intronic
1192016739 X:67339413-67339435 CTGGGGAAGCAGAAGAGAGAGGG + Intergenic
1192183973 X:68933955-68933977 CTTTGGGAGGTGAAGGAAGGAGG + Intergenic
1192239528 X:69318424-69318446 CTGTGGAAGGAGTGGGAGGTTGG + Intergenic
1192332372 X:70186583-70186605 CTGTGGAAAGAGCCAGAAGATGG - Intronic
1192448957 X:71230897-71230919 AAGGGGAAGGGGAAGGAAGAGGG + Intergenic
1192680779 X:73251474-73251496 TTTTGGATGGAGAAGGAAAATGG - Intergenic
1193102974 X:77636788-77636810 AAGAAGAAGGAGAAGGAAGAAGG + Intronic
1193102989 X:77636841-77636863 AGGTGGAAGGAGGAGGAAGGAGG + Intronic
1193103006 X:77636928-77636950 AGGAGGAAGGAGAAGGAAGAAGG + Intronic
1193160829 X:78227372-78227394 CTGTGCAAGAAGAAGAAAGCTGG - Intergenic
1193622280 X:83770298-83770320 CTGTAGGAGAAGAAGAAAGAAGG - Intergenic
1194057917 X:89160868-89160890 CTCTGGAAGGCCAAGGTAGATGG - Intergenic
1194182715 X:90733885-90733907 GTGTGGAAGGAGAGGGCATAAGG + Intergenic
1194414206 X:93590434-93590456 CTGGCGAAGGAAAAGTAAGATGG + Intergenic
1194992897 X:100564028-100564050 CTATGGAAGGAAGAAGAAGAAGG + Intergenic
1194992930 X:100564111-100564133 CAGTGGAGGAAGAGGGAAGAGGG + Intergenic
1195355287 X:104033700-104033722 CTGAGGAAGGGGCAGGAAGGAGG + Intergenic
1195551849 X:106180442-106180464 CTCTCAAAGGAGTAGGAAGATGG - Intronic
1195614342 X:106900909-106900931 CTGTGGACAGAGAAGAAACATGG + Intronic
1195638696 X:107149812-107149834 CTGTGGCAGTAGTAGTAAGAGGG - Intronic
1195965506 X:110426729-110426751 CTTAGAAAGGAAAAGGAAGACGG - Intronic
1196193682 X:112818936-112818958 CTTAGGAAGGAGCAGGATGAGGG - Intronic
1196415839 X:115470219-115470241 CTTTGGAAGGCCAAGGCAGACGG + Intergenic
1196505017 X:116431710-116431732 CTGTGGCAGGAAAAGACAGAAGG - Intergenic
1196576603 X:117325747-117325769 CCATGGAAAGGGAAGGAAGAGGG - Intergenic
1196938075 X:120749383-120749405 AAGTGGGAGGGGAAGGAAGAGGG + Intergenic
1197106243 X:122720129-122720151 TTGTGGCAGGAGAGGGATGAGGG - Intergenic
1197362234 X:125519217-125519239 CTGTGAAAGTACATGGAAGAAGG - Intergenic
1197374720 X:125668262-125668284 CTGTGGAAAGAGAATAAAGTTGG + Intergenic
1197637579 X:128932371-128932393 CTCTGGAAGAAGAAAGAAGAGGG - Intergenic
1197884087 X:131200114-131200136 TTGTGAAAGGAGAGGGGAGAAGG + Intergenic
1198069133 X:133130518-133130540 CTGGGGCAGGAGAGGGAGGAGGG + Intergenic
1198149197 X:133891523-133891545 CTTTGGAAGGCCAAGGCAGAAGG + Intronic
1198520667 X:137449246-137449268 CAGTGAAAGGAAAAGGGAGAAGG - Intergenic
1198924451 X:141772066-141772088 GTGTGGAGGGGGAAGGAAGAAGG + Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199651346 X:149947923-149947945 CTGGGAAGGGAGAAGGAAGGAGG - Intergenic
1199833553 X:151566389-151566411 CTCTGGAAGGAGAAGGCAGAGGG + Intronic
1199904955 X:152216635-152216657 CTGGGGAAGGAGAAGAGAGAGGG + Intronic
1200085103 X:153600169-153600191 CTGAGGAAGGAGAATGAGGCCGG - Intergenic
1200091333 X:153637503-153637525 CTCAGGCAGGAGAATGAAGAGGG + Intergenic
1200123428 X:153802092-153802114 TTGGGGTGGGAGAAGGAAGAGGG - Intergenic
1200259241 X:154603411-154603433 CTGTGGGAGGCTAAGGCAGAAGG - Intergenic
1200529335 Y:4315840-4315862 GTGTGGAAGGAGAGGGCATAAGG + Intergenic
1200592778 Y:5097643-5097665 TTGGGGAAAGAGAAGGAAGGTGG + Intronic
1201189234 Y:11432253-11432275 CTGTGGGAGGACAAGGCAGGTGG - Intergenic
1201422824 Y:13818956-13818978 AGGAGGAAGGAGGAGGAAGAAGG - Intergenic
1201504981 Y:14688332-14688354 CTGTGGACAGAGAAGGCAAAGGG + Intronic