ID: 975713179

View in Genome Browser
Species Human (GRCh38)
Location 4:77180642-77180664
Sequence AAACACATGAAGCTACTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 256}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975713179 Original CRISPR AAACACATGAAGCTACTGAA GGG Intronic
909823189 1:80092377-80092399 AACCAAATGAAGCTGCTGAAGGG - Intergenic
909848596 1:80431697-80431719 AAAGACATGGAGTGACTGAATGG - Intergenic
911645926 1:100337174-100337196 GAACACATGAAGATGCTGAGAGG + Intergenic
912034762 1:105299126-105299148 AAAGACATAAAGTGACTGAAGGG - Intergenic
912213443 1:107580184-107580206 AAGCAACTGAAGCTGCTGAATGG + Intronic
913051227 1:115118528-115118550 AAAAAAATGAAGCTCCTCAAAGG + Intergenic
916388371 1:164303051-164303073 AAACTCATGAAACTACTAAGGGG + Intergenic
916872092 1:168926509-168926531 AAAGATATGATGTTACTGAAAGG - Intergenic
917103145 1:171465798-171465820 AAACACCTGAAGCTGGTGATCGG - Intergenic
917152948 1:171964365-171964387 AAACACAGGAATCAACAGAAGGG - Intronic
917262215 1:173182480-173182502 AAACGCATGCAGCTACTAAGTGG - Intergenic
918766814 1:188497667-188497689 AAAGACATGGAGTGACTGAATGG - Intergenic
919455320 1:197814162-197814184 AAAAAAATGAAGGTACTAAATGG + Intergenic
923892637 1:238233358-238233380 AAAGAGATGAAGCCAATGAAAGG + Intergenic
923953888 1:238992878-238992900 AAATACATGAAACTAATGAATGG + Intergenic
924128315 1:240879150-240879172 AGACACAGAAATCTACTGAAAGG - Intronic
924843327 1:247737860-247737882 AAACACAGGAAGCGACAGACAGG - Intergenic
1063359907 10:5444304-5444326 AAACACACATAGCTACAGAAGGG + Intronic
1064068351 10:12203131-12203153 GAACACATGGAGCTTCTGGAAGG - Intronic
1065079354 10:22112314-22112336 TAACACATGAAGTTACTTAGAGG + Intergenic
1066466738 10:35658202-35658224 AAACTGATCAATCTACTGAAAGG - Intergenic
1066949849 10:42106099-42106121 AAACAAATGAAATTATTGAATGG + Intergenic
1069328945 10:67267282-67267304 AAAAACACGAAATTACTGAAAGG + Intronic
1070014171 10:72508628-72508650 AAACACATGAAAAAACTAAAAGG + Intronic
1072843298 10:98798980-98799002 AAAGACATAAAGTGACTGAATGG + Intronic
1073586726 10:104717547-104717569 AAACAAAGGTAGCAACTGAAAGG - Intronic
1074428417 10:113372238-113372260 AAAAAAATGAATCTACTGGAAGG - Intergenic
1074431561 10:113399172-113399194 AACCAGATGATGCTAATGAATGG - Intergenic
1076289699 10:129335530-129335552 AAACACATGAAGCCAATGAAAGG + Intergenic
1077151397 11:1074604-1074626 GAACACATGCAGCTACTAGAGGG - Intergenic
1078586049 11:12590137-12590159 AAACACTGGATGCTACAGAAAGG - Intergenic
1078860038 11:15238587-15238609 TAATACATGAGGCTACTGGAAGG + Intronic
1078862356 11:15261192-15261214 ATACACATGAAGACACTTAAAGG - Intergenic
1078988950 11:16625757-16625779 AAACACATGAAGGTGCTCAGAGG + Intronic
1079358330 11:19748842-19748864 AAACAGATGATGCTGCTGAAAGG + Intronic
1081318669 11:41663603-41663625 AAACACAAGGAGCTATTAAAGGG + Intergenic
1081910672 11:46697877-46697899 AAGCACATGTAGATATTGAAGGG - Intronic
1083977519 11:66135404-66135426 AAACCCATAAAGATTCTGAAGGG - Intronic
1084391688 11:68881406-68881428 TTACACATGAAGAAACTGAACGG - Intergenic
1085918803 11:80926110-80926132 AAACACATAAAGCTCTAGAAAGG - Intergenic
1087539901 11:99503190-99503212 AAACACATTAAGGAAGTGAAGGG - Intronic
1088780997 11:113134036-113134058 AAATACTTAACGCTACTGAAGGG - Intronic
1090189025 11:124756430-124756452 GAACAAATGAAGCGACAGAAGGG - Intronic
1092010332 12:5104881-5104903 AAATCCATGCAGCTTCTGAATGG - Intergenic
1092504690 12:9084720-9084742 AAAGACATAAAGTGACTGAATGG + Intronic
1093581431 12:20788070-20788092 AAACACATAAAGTGGCTGAATGG - Intergenic
1093900582 12:24626775-24626797 TTGCACATGTAGCTACTGAAAGG - Intergenic
1093917130 12:24816956-24816978 ATACAGATGAAGCTCCTCAATGG + Intronic
1094104396 12:26795164-26795186 AAACACATTAAGGTAAGGAAAGG + Intronic
1094823265 12:34244594-34244616 AAATACATGCAGCTACTTAAGGG - Intergenic
1095091413 12:38110447-38110469 AAATACATGCAGCTACTTAAGGG + Intergenic
1096773189 12:53949480-53949502 GAACAGATGGAGCCACTGAAGGG - Intergenic
1098687761 12:73446588-73446610 AAACATCTGTAGTTACTGAATGG + Intergenic
1099215927 12:79853416-79853438 AAACACAAGAAGACTCTGAAAGG - Intronic
1099217387 12:79869781-79869803 AAGCACACAAAGCTAGTGAATGG + Intronic
1099419347 12:82435952-82435974 ATACACATGAAGAGACTGTAAGG + Intronic
1099745454 12:86697113-86697135 GAACTCATGAAGCTTATGAAAGG - Intronic
1099934603 12:89110371-89110393 AAGCAAAGGAAGTTACTGAAAGG - Intergenic
1101151343 12:101885444-101885466 AACCACATTAAGCTTTTGAAGGG + Intronic
1101945920 12:109137179-109137201 AAACACATGATGATCTTGAAAGG + Intronic
1102907211 12:116686004-116686026 AATCAAATGATGCTACTGGATGG + Intergenic
1103161066 12:118729791-118729813 AAACACTGGAAGCTAGAGAAGGG - Intergenic
1103988348 12:124781751-124781773 AAACACAAGAAACAACAGAAGGG - Intronic
1104120725 12:125797013-125797035 TCTCACATGAAGCAACTGAATGG + Intergenic
1104819722 12:131668509-131668531 AAAGACATGGAGTGACTGAATGG + Intergenic
1105974135 13:25458508-25458530 TAACACATGAGGCTTCTGCAGGG - Intronic
1106902724 13:34371189-34371211 AAACACATGAGGAAACAGAAAGG - Intergenic
1108785607 13:53897740-53897762 AAACAAATGATGATAATGAAAGG - Intergenic
1109271540 13:60261111-60261133 AAATACAAGAAGACACTGAAAGG - Intergenic
1109675419 13:65669567-65669589 AAAGACATAAAGTGACTGAATGG - Intergenic
1109984046 13:69952247-69952269 AAACACATGAAAATAATCAATGG + Intronic
1110007131 13:70287162-70287184 CAACACATAAATCTACTGTAAGG + Intergenic
1110262780 13:73504380-73504402 AAACACATTAAGATACTTAAGGG - Intergenic
1112039680 13:95534297-95534319 AACCATATGAAGCTACTGCCAGG + Intronic
1112180511 13:97074552-97074574 AAACACTTGAAGTTACCTAAAGG - Intergenic
1112774685 13:102831416-102831438 AAAAACAAGAAGCTATTGATAGG - Intronic
1112958202 13:105087953-105087975 ATACCCATGAAGTAACTGAAAGG - Intergenic
1114949987 14:27737833-27737855 AAAAACATGAAGCAAGTTAAGGG - Intergenic
1115318493 14:32052181-32052203 GAACACATGAACATAGTGAAAGG - Intergenic
1120626243 14:86830560-86830582 AAACAAATGAAACTAATGATTGG + Intergenic
1122474137 14:101994573-101994595 AAAGACATGAACCTTCTTAATGG + Intronic
1123960408 15:25393029-25393051 AAACACAAGGAGTCACTGAAGGG + Intronic
1123961261 15:25403277-25403299 AAACTTAGGAAGCTACTGAGGGG - Intronic
1124170169 15:27366100-27366122 AAACACATGAAGCTTCTTTCAGG + Intronic
1130033589 15:80337823-80337845 AAACAAATGAAGCTAATCATTGG - Intergenic
1130582632 15:85152294-85152316 AAACACATCAAGGTACTGGGAGG + Intergenic
1130845920 15:87745442-87745464 AAAAAAATGAATCTACTGAAAGG + Intergenic
1130870539 15:87968028-87968050 TGACACATGAATCTCCTGAAAGG - Intronic
1137841396 16:51643948-51643970 AAACACAGGGAGATAATGAATGG + Intergenic
1138262479 16:55635023-55635045 AAATACATGAAGCTGGTGATCGG + Intergenic
1138983687 16:62300909-62300931 ACACACCTGCAGCTCCTGAAAGG + Intergenic
1140143718 16:72285328-72285350 ACACACATGAAGCTCTTTAAAGG + Intergenic
1140846674 16:78895472-78895494 AAACACAAGAAGCTACGGGATGG - Intronic
1141501799 16:84449782-84449804 AAGAACAGGGAGCTACTGAATGG - Intronic
1142532274 17:588594-588616 AAAGACATGGAACTCCTGAAAGG - Intronic
1143142960 17:4752971-4752993 AAATACATGAAGGAACTTAAGGG + Intergenic
1143318169 17:6048607-6048629 AAACACAAGATGTAACTGAAAGG - Intronic
1146351795 17:32101620-32101642 AGACACATGGAGCTAGGGAATGG - Intergenic
1146517362 17:33499660-33499682 AAACACCTGATGATACTGACTGG + Intronic
1146966207 17:37032699-37032721 AAAAACAGGAAAATACTGAAAGG - Intronic
1148916972 17:50989799-50989821 AAGCAACTGAAGCTACAGAAGGG - Exonic
1149166222 17:53756717-53756739 AATCACATGAAAATACTAAATGG + Intergenic
1149272404 17:54994623-54994645 GAACAAACGATGCTACTGAAAGG - Intronic
1149491491 17:57087942-57087964 AAACAGACCAAGCTACAGAAAGG - Intronic
1149586917 17:57795956-57795978 AAAAAAATAAAGCTTCTGAAAGG + Intergenic
1150924020 17:69513807-69513829 AAAAATATGAAGCAACAGAAAGG - Intronic
1151503517 17:74509996-74510018 AAAGACATGGAGCAGCTGAATGG - Intergenic
1153082236 18:1241339-1241361 AAAGCCATGAAGTTAATGAATGG - Intergenic
1153366582 18:4264119-4264141 AAATACAGGAAGCTCCTGGATGG - Intronic
1153966520 18:10187804-10187826 AAACACAAGCAGCTACTGTGTGG - Intergenic
1155348445 18:24882207-24882229 AAATACATGAAGAAACTAAAAGG - Intergenic
1155740182 18:29279726-29279748 AAATACATGAAGTTTCTGAAGGG - Intergenic
1156267458 18:35501512-35501534 GACCACAGGAAGCCACTGAATGG - Intergenic
1156925884 18:42578067-42578089 AAAAACATTAAGCTCCTAAATGG + Intergenic
1157053278 18:44195731-44195753 AAACACATGAATCTTCTCAGGGG + Intergenic
1157572025 18:48719064-48719086 GGACACATGAGGCTACTGATGGG - Intronic
1160728145 19:627537-627559 GAACACTTGAAGCTGGTGAAAGG - Intronic
1162892192 19:13741754-13741776 AAACAAAAGAAGCTATTGGAGGG + Intronic
1164482151 19:28620074-28620096 ACACACAGCCAGCTACTGAATGG + Intergenic
1165815059 19:38636910-38636932 AAACACCTGAAGTTACTGGGAGG - Exonic
1166319640 19:42008796-42008818 AAAAACATGAACGTAATGAAAGG + Intronic
1166800169 19:45451600-45451622 GGTCACATGAAGCTACTGGATGG - Intronic
1166920042 19:46222987-46223009 GAACACATGGAGGTGCTGAAAGG - Intergenic
925437236 2:3849718-3849740 AAACATATCAGGCAACTGAAAGG - Intergenic
926707868 2:15849437-15849459 AAACTCCTGAAGCTATGGAAAGG + Intergenic
928606090 2:32946667-32946689 AAACGCATGGGGCTTCTGAAAGG + Intergenic
928829683 2:35465502-35465524 AAGCACATGAAGCTACTTGCAGG - Intergenic
929267724 2:39937964-39937986 AAATACATGAAGCAAGTAAAAGG + Intergenic
929347936 2:40909276-40909298 TGACATAAGAAGCTACTGAATGG - Intergenic
930394762 2:50807366-50807388 GAACACTTGAAGCTCATGAATGG - Intronic
930534496 2:52629848-52629870 AAACTCGTAAAGCTACGGAACGG + Intergenic
932535762 2:72593100-72593122 GAACACATCAAGATGCTGAAAGG + Intronic
932720503 2:74135403-74135425 AAACAACTGAAGCTTTTGAAGGG - Exonic
936733924 2:115417252-115417274 AAACACACAAAGTCACTGAATGG + Intronic
937490865 2:122365824-122365846 TAACACAGGAAGCTACAGAAGGG + Intergenic
939011549 2:136852850-136852872 AAACACATGAAGAAATTTAATGG - Intronic
939261783 2:139819982-139820004 GAACACATCAAGATACTGCAAGG - Intergenic
940853908 2:158714978-158715000 AAACACATAAAGACTCTGAAAGG - Intergenic
941125477 2:161578967-161578989 AAACACAGGAAGACTCTGAAAGG - Intronic
941238587 2:163008412-163008434 AAACTCAAGAACCTACTGAAAGG - Intergenic
944042353 2:195369869-195369891 ATGCAAATGATGCTACTGAAAGG + Intergenic
944243266 2:197506331-197506353 AAATACAAAAAGCTACTCAAGGG + Intronic
945746716 2:213727485-213727507 AAAAACAGGAAGCCAGTGAAAGG + Intronic
1169975150 20:11316916-11316938 TAAAACATGAATCCACTGAAAGG + Intergenic
1170402800 20:16005929-16005951 AAAAACATAAAGCTTTTGAAAGG - Intronic
1170404057 20:16018034-16018056 ACTAACATGAAGCTACAGAAAGG + Intronic
1172516746 20:35540165-35540187 AAACACATAAAGTAACAGAAGGG - Intergenic
1173383521 20:42567457-42567479 AATCACAGGAAGCTTCTTAATGG - Intronic
1173763181 20:45583165-45583187 ATACACAAGAAGATTCTGAAAGG + Intergenic
1173874113 20:46359001-46359023 AAGCACTGGAAGCTGCTGAAGGG - Intronic
1174986940 20:55465586-55465608 ATACACATGTATCTACTGATAGG + Intergenic
1175140387 20:56856490-56856512 AATCACGTGCAGCCACTGAAGGG + Intergenic
1175394072 20:58646707-58646729 AAAAAAATGAAGCTAATTAATGG - Intergenic
1176001825 20:62835485-62835507 AAACACATGCTGCAATTGAACGG - Intronic
1178335784 21:31741907-31741929 AAATACACAAAGCTATTGAAAGG - Intergenic
950320327 3:12046336-12046358 AAGAACATGAAGCTTGTGAAAGG + Intronic
950685784 3:14617851-14617873 ACACACATGAAGCTGATGAAAGG + Intergenic
950803122 3:15571382-15571404 AAAGACCTGAAGTTTCTGAAAGG - Intronic
951203806 3:19904209-19904231 AACCACATGAAACTAATGCATGG - Intronic
951944169 3:28115386-28115408 AAACACATGCAGCTTTTTAAGGG - Intergenic
953298065 3:41741807-41741829 AAACACAGGAAGACTCTGAAAGG + Intronic
956039015 3:65126365-65126387 AAACACATGAAGGAACAGATTGG - Intergenic
956611042 3:71123252-71123274 AAACACAGGATGCTGCTGCAGGG - Intronic
958757510 3:98268570-98268592 AAAGACATGAAGTGGCTGAATGG - Intergenic
959109086 3:102100232-102100254 AAATAAATGAAGCTAATGCATGG - Intronic
959113628 3:102150639-102150661 AAATACATAAAGTGACTGAATGG + Intronic
960499280 3:118417200-118417222 AAAGCAATGAAGCTACTGAAAGG + Intergenic
962937101 3:140091128-140091150 AACCTCATGAAGCTGCTGTAAGG + Intronic
964457917 3:156888526-156888548 AAACACATAAAAAGACTGAAAGG + Intronic
965447738 3:168796634-168796656 AAACACATGATGAAGCTGAAAGG - Intergenic
970396701 4:15675081-15675103 AAACAGATGAAGCAACTGTAAGG + Intronic
971804363 4:31336100-31336122 AAGCCCATAAACCTACTGAATGG - Intergenic
973170210 4:47132897-47132919 AAAGACATGAAGATATTAAAGGG - Intronic
973181967 4:47279938-47279960 AAAGACATCAAGTGACTGAATGG - Intronic
974936696 4:68417556-68417578 AAAGACATGAAACTACATAATGG - Intergenic
975330327 4:73105439-73105461 GAACAAATGAGGCTTCTGAAAGG + Intronic
975335714 4:73173004-73173026 AAACACATGCAGAGGCTGAATGG + Intronic
975713179 4:77180642-77180664 AAACACATGAAGCTACTGAAGGG + Intronic
976313143 4:83632726-83632748 AAAGTCATGAAGCTACTAAATGG - Intergenic
977872509 4:102108935-102108957 AAATACATAAAGTGACTGAATGG + Intergenic
978093715 4:104749490-104749512 AAACAGATGCAACTACAGAAAGG + Intergenic
978343222 4:107739198-107739220 AAACACCTGTAGCCACTCAATGG + Intergenic
978748965 4:112225588-112225610 AAACAGATGTAGCTCCTGCAGGG - Intergenic
981390054 4:144179163-144179185 AAATGCATGCAACTACTGAAAGG + Intergenic
981739411 4:147986274-147986296 AGACACATGAAGCTCATGGAGGG + Intronic
981866373 4:149425015-149425037 GAAGTCATGCAGCTACTGAATGG - Intergenic
981870831 4:149484250-149484272 AAAGACATAAAGCGGCTGAATGG - Intergenic
982121023 4:152143885-152143907 AAACACATGAAACACATGAAAGG - Intergenic
982348018 4:154383302-154383324 AAACACAGGAAACTACTAGAAGG + Intronic
982618327 4:157671394-157671416 AATAACATGAAGCTATTTAATGG + Intergenic
982905580 4:161065718-161065740 AAAGACATGATGCCATTGAAAGG - Intergenic
983221479 4:165048162-165048184 AAACAATTGAAACTAATGAAAGG + Intergenic
983779199 4:171646434-171646456 AATAACAGGAAGCCACTGAAAGG - Intergenic
983989405 4:174099315-174099337 AGACACTGGAAGCTACTGAAGGG + Intergenic
984002178 4:174262801-174262823 AAACACATGAAGCCAAGCAAAGG + Exonic
984091263 4:175378313-175378335 AACCACAAGAAGATTCTGAACGG + Intergenic
984420489 4:179514886-179514908 AAACTCATGAAGATTCTGCAGGG + Intergenic
985355527 4:189115537-189115559 AAACATATGAACCCCCTGAAAGG + Intergenic
986967383 5:13290670-13290692 GAACACATGAACATACTGAGGGG - Intergenic
987552617 5:19403512-19403534 AAACACCTGAAGCTGGTGATCGG - Intergenic
987966100 5:24876475-24876497 AGACACTTTAAGTTACTGAAAGG - Intergenic
995232324 5:109781608-109781630 AAATACATGTAGCTATAGAAAGG - Intronic
995954656 5:117761980-117762002 AAACACACAAAGCCACTGCAGGG - Intergenic
996062862 5:119051320-119051342 AACCACACAAAGCTACTGAAGGG + Intronic
996757533 5:126950252-126950274 ACACATATGACTCTACTGAATGG + Intronic
996903557 5:128572543-128572565 AAACATATGAAGCAACTTGATGG + Intronic
998636992 5:143966517-143966539 AAACAAAAAAAGCTACTGATGGG - Intergenic
1000937224 5:167317202-167317224 AGAATCATGAACCTACTGAAGGG - Intronic
1000981491 5:167821265-167821287 ACAGACATGAAGCTTCAGAATGG + Intronic
1004680830 6:17892750-17892772 GAACACAAGAAGGTACTGGAAGG + Intronic
1005560006 6:27030261-27030283 AACCACATGAAGATACAGGAAGG - Intergenic
1006402185 6:33824294-33824316 ACACACATGCAGCAACCGAAGGG - Intergenic
1010640721 6:78323100-78323122 AAATGCATGAGGCTACTCAATGG + Intergenic
1012292790 6:97479807-97479829 AAAGATATGAAGTGACTGAATGG - Intergenic
1012539977 6:100351394-100351416 AAACACATGGAGGTACTGGAAGG + Intergenic
1012646500 6:101690194-101690216 AATTAAATTAAGCTACTGAATGG - Intronic
1013904813 6:115202751-115202773 AAACACAAGAAGGTTCTGAAAGG - Intergenic
1013936816 6:115606161-115606183 AAGTACATGCAGTTACTGAAGGG - Intergenic
1013989718 6:116239475-116239497 AGATTCATGAAGTTACTGAAAGG - Intronic
1014500603 6:122184371-122184393 AAAAACATGAAGCAACTTTAAGG + Intergenic
1016674007 6:146741931-146741953 AAAGACATAAAGCTGCAGAAAGG - Intronic
1017480045 6:154844195-154844217 AACCACTTGAAGCTACAAAAAGG - Intronic
1019280341 7:196618-196640 ACACACATGAAGCTAATGCCTGG - Intronic
1021266753 7:18534217-18534239 ACACACATGTACCCACTGAAAGG - Intronic
1022296523 7:29060551-29060573 AAACATCTGAAATTACTGAAAGG + Intronic
1023001797 7:35815738-35815760 AATAACATGAAGACACTGAAGGG - Intronic
1025316255 7:58034202-58034224 AAACAAATGGAACCACTGAATGG + Intergenic
1025555687 7:62305245-62305267 ACTCAAATGGAGCTACTGAATGG + Intergenic
1026028816 7:66771096-66771118 AAACACAGGAACCAACTGACAGG - Intronic
1027886652 7:83916271-83916293 AAAGAAATGAAGCTTCTTAATGG + Intergenic
1029154384 7:98504793-98504815 AAACAGATGAAGACTCTGAATGG + Intergenic
1030601026 7:111592405-111592427 AAGCTCAAGAAGCTACTGTATGG + Intergenic
1030985102 7:116231917-116231939 AAACCCATGAAGCATCTGAATGG - Intronic
1031351571 7:120738301-120738323 AAACAGATGAAGCAAATGACTGG - Intronic
1032274196 7:130440444-130440466 AAACAGATGAAGAAACTGAAGGG + Intronic
1032368627 7:131324615-131324637 AAATAAATCAAGCTACTGATTGG + Intronic
1033530098 7:142253352-142253374 AAACATATAAAGCTAGTAAATGG + Intronic
1033594883 7:142851489-142851511 ATACATATGAAGTCACTGAATGG + Intergenic
1033867674 7:145712991-145713013 AAACACATGAAGCTGGGGATGGG + Intergenic
1034559313 7:151869916-151869938 AGATGCATGAAGCCACTGAAGGG + Intronic
1035246051 7:157562522-157562544 AACCACATGTGGCTACTGTATGG + Intronic
1037156102 8:15700989-15701011 AAACATAAGAAGATTCTGAAAGG - Intronic
1038768192 8:30450029-30450051 AAACAAATGAAGGTATTAAACGG + Intronic
1038784948 8:30604253-30604275 AAATACATGAAGCCAAAGAAAGG + Intronic
1039343928 8:36683022-36683044 AAACACTTGAAGCAAGAGAATGG - Intergenic
1041077755 8:54184717-54184739 CAACACAGGAAGCTTGTGAATGG - Intergenic
1041190931 8:55353440-55353462 AACCACCAGAAACTACTGAAGGG + Intronic
1041408791 8:57530668-57530690 AAGAACATGAAGCTCTTGAAAGG + Intergenic
1042287393 8:67128875-67128897 ATACACCTCAAGCTAATGAATGG - Intronic
1042297056 8:67231819-67231841 CATCTCATGAGGCTACTGAAAGG + Intronic
1042492416 8:69415129-69415151 AAGCACATGAGGTTACTTAATGG - Intergenic
1047776367 8:128074156-128074178 AGACACATGAAGCTAGAAAAAGG + Intergenic
1049538828 8:143196562-143196584 AAAAACATGAAGAGACTGAACGG + Intergenic
1049729986 8:144171671-144171693 AAACACCTAAAGCTTCTGCATGG - Intronic
1050706857 9:8409961-8409983 AACCAAATGAGCCTACTGAAGGG - Intronic
1051033866 9:12718875-12718897 CCACAAATGAGGCTACTGAAAGG - Intergenic
1051701741 9:19831299-19831321 AAACACAAGAAGGTCTTGAATGG - Intergenic
1052816150 9:33103816-33103838 AAACAAAGGAAACTACAGAATGG - Intergenic
1053046546 9:34924721-34924743 AAAGACATGGAGTGACTGAATGG - Intergenic
1055595299 9:77859662-77859684 AAACAAATGAACATCCTGAATGG - Intronic
1055778842 9:79796844-79796866 AAACACATGAAGCCAATCAATGG - Intergenic
1056034605 9:82590552-82590574 TATCACATGAAACTACAGAATGG - Intergenic
1057408145 9:94792263-94792285 AAACACATGAGACTAGGGAAGGG - Intronic
1060860215 9:126947864-126947886 AAATATATGTAGCTACTGCAGGG + Intronic
1186238359 X:7539159-7539181 AAATACATAAAGTGACTGAATGG + Intergenic
1186489611 X:9961253-9961275 AAGCAAATGAAGCAACTAAAGGG + Intergenic
1187444958 X:19352897-19352919 AAGCACATGGAACTAGTGAAAGG + Intronic
1187594201 X:20753767-20753789 AAAGACATAAAGTGACTGAATGG - Intergenic
1188206901 X:27371510-27371532 AGACATATGAAGGTTCTGAAAGG + Intergenic
1188381889 X:29504782-29504804 AAAGGCATAAAGCTGCTGAATGG - Intronic
1190023774 X:46903707-46903729 AGCCACCTGAGGCTACTGAATGG - Intergenic
1192666345 X:73091393-73091415 AAAGAAATGAAGCTACATAAGGG - Intergenic
1193305980 X:79952170-79952192 AAAGACATAAAGTGACTGAATGG + Intergenic
1194110889 X:89833258-89833280 ATAAACATGCAGCTACTGCATGG + Intergenic
1194877944 X:99212787-99212809 AAGCACATGAAGCTTTTGATTGG - Intergenic
1195132388 X:101866165-101866187 AAACACATAGAGCAGCTGAATGG + Intergenic
1196536588 X:116852293-116852315 AAACATAAGAAGATTCTGAAAGG - Intergenic
1197391718 X:125875450-125875472 AAAGACATAGAGTTACTGAATGG - Intergenic
1197791988 X:130264603-130264625 ATAGAAATGAAGGTACTGAAAGG + Intronic
1198434813 X:136606706-136606728 AAACACAAGAAGCTATTGATAGG + Intergenic
1199537741 X:148922455-148922477 AAAAACATGAAGCTCTTGAGAGG + Intronic
1200463547 Y:3487995-3488017 ATAAACATGCAGCTACTGTATGG + Intergenic