ID: 975714576

View in Genome Browser
Species Human (GRCh38)
Location 4:77193368-77193390
Sequence CTTCCAGCACTTAGACAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 139}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975714576_975714579 5 Left 975714576 4:77193368-77193390 CCATGTTGTCTAAGTGCTGGAAG 0: 1
1: 0
2: 1
3: 12
4: 139
Right 975714579 4:77193396-77193418 TTGATTCAGCCACTTTTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975714576 Original CRISPR CTTCCAGCACTTAGACAACA TGG (reversed) Intronic
901239755 1:7686102-7686124 CTTCCATCACCTGGTCAACATGG + Intronic
905954211 1:41978557-41978579 CTTCCAGAACTTCGAGAAAATGG + Intronic
907648067 1:56264187-56264209 CTTCCCCCAATTAAACAACATGG + Intergenic
908932056 1:69328969-69328991 CTTTCAGCTCTTAGACAAAAAGG + Intergenic
909202533 1:72709535-72709557 CTGCCAGCAGTTGGGCAACATGG - Intergenic
909406121 1:75291622-75291644 CTTCCAGCAGATGAACAACATGG + Intronic
910676866 1:89823282-89823304 TTTCCAGCATTTAAAAAACATGG + Intronic
911535853 1:99099205-99099227 TTTCCAGCACATATACACCATGG - Intergenic
911596961 1:99808926-99808948 CTTCCAGCAGTCAGACAGAAAGG - Intergenic
911678629 1:100688960-100688982 CTTCCAGCACTATGTCAAAAAGG + Intergenic
911991276 1:104699709-104699731 CTGCCAGCCCTGAGACAGCAAGG + Intergenic
912179091 1:107196043-107196065 CTCCCAGCACTTAGAACCCAGGG + Intronic
912738818 1:112174712-112174734 CCTCCAGCACTGAGTCAACAGGG - Intergenic
914314258 1:146494995-146495017 CTTCCATCCTGTAGACAACAGGG - Intergenic
914500090 1:148238386-148238408 CTTCCATCCTGTAGACAACAGGG + Intergenic
914681567 1:149942467-149942489 CTCCCAGCCCCTAGAGAACAGGG + Exonic
915979467 1:160410931-160410953 CTGCCATCACCTAGGCAACAGGG + Intronic
917780395 1:178389151-178389173 CTTCCAGATCTTAGAAAACAAGG - Intronic
918207010 1:182318395-182318417 ATTCCAGCATTTAGGCTACATGG - Intergenic
920430843 1:205918025-205918047 CTTTCAGCACTTAGAACAGATGG + Intronic
921269240 1:213452510-213452532 CTTCTAGCACCTAGATAAAATGG + Intergenic
922513944 1:226192684-226192706 CTGCAAGCACTTAGAGATCAAGG + Intergenic
922649812 1:227327957-227327979 CTTCCAGGTCTTAGCCAAGAAGG + Intergenic
924424407 1:243938018-243938040 CTTGCAGCTCTCAGACAAGAGGG - Intergenic
924643119 1:245852280-245852302 CTTCCAGAAGTAAGACTACAAGG + Intronic
1064030539 10:11880184-11880206 CTTCCTGCTCAGAGACAACACGG + Intergenic
1066591115 10:36995489-36995511 CTTCCTGGACTAAGCCAACATGG + Intergenic
1068019751 10:51566678-51566700 TTTCCAGCAGTGAGAAAACAAGG + Intronic
1069836316 10:71310649-71310671 ATTCCAGATCTTTGACAACAGGG + Intergenic
1071216968 10:83416678-83416700 CTTCCAGGTCTTAGAAAAAATGG + Intergenic
1078146130 11:8722879-8722901 TTTGGAGCACTTAGAGAACAGGG - Intronic
1079719898 11:23797160-23797182 CTGCAAGAACTTAGATAACATGG + Intergenic
1080815551 11:35753040-35753062 TTTTCTGCACTTAGAAAACAGGG - Intronic
1085028629 11:73256164-73256186 ATTCCAGCACTTAGAGGCCAAGG - Intergenic
1089760074 11:120716742-120716764 CTTCCAGCAGTGAGAGAAGAAGG + Intronic
1089852471 11:121512041-121512063 CTTCCAGCTCTAAAAGAACATGG - Intronic
1090732935 11:129587409-129587431 CTTCCAGAACTTAAACAACCTGG + Intergenic
1092440676 12:8499042-8499064 CTTCCATCACTCAGATCACATGG + Intergenic
1094335240 12:29343083-29343105 CTTTCAGAAATTAGACAAAAAGG + Intronic
1099110680 12:78556589-78556611 CTTCCATCATTTACACAACCAGG + Intergenic
1109198127 13:59401695-59401717 CTTCTAGCTCTTAGAAAACATGG - Intergenic
1111918365 13:94384967-94384989 CTTACAGCACTTAATCTACAGGG - Intronic
1112006377 13:95257343-95257365 CTTCCACCTCTGAGACAGCAAGG - Intronic
1112019469 13:95359247-95359269 ATTCCAGCATTTGGACACCAAGG - Intergenic
1112380176 13:98881717-98881739 CTATCAGCACTTAGGAAACAAGG + Intronic
1112922935 13:104637626-104637648 CTTCCAGCCCTAAGAGACCAAGG - Intergenic
1116479490 14:45381623-45381645 CTACCAGCTCTGTGACAACAGGG + Intergenic
1116760831 14:49011551-49011573 CTTCCTGCAGGTAGGCAACAAGG - Intergenic
1117260396 14:54026888-54026910 CTAGCAGCACTTACTCAACAAGG - Intergenic
1117757927 14:58995706-58995728 CTTCCCACACTCAGCCAACAAGG - Intergenic
1121039874 14:90737183-90737205 CTTCCAAAAATTAGACAAAAAGG + Intronic
1122564794 14:102645447-102645469 TTTCCACTACTTAGACAACAGGG + Intronic
1124600598 15:31130024-31130046 CTTCCAGGACAAAGACATCAGGG + Intronic
1125915525 15:43483855-43483877 CTACCAGCATTTAGAGATCAGGG - Intronic
1126316234 15:47372940-47372962 CTTCCAGCTCTTTGATGACAAGG + Intronic
1127648658 15:60984704-60984726 CTTACAGCACTTTGACAATGGGG + Intronic
1132937906 16:2490956-2490978 CAGCCAGCAGATAGACAACAGGG + Intronic
1138744366 16:59346265-59346287 TTTCCATCACTTACACTACATGG - Intergenic
1143457765 17:7078770-7078792 CTTCCAGTACTTGGAGAATAAGG - Exonic
1143972290 17:10804330-10804352 CTTCCAGGGATTAGAGAACAAGG - Intergenic
1145012952 17:19380003-19380025 TTTCCAGAACTTCGGCAACATGG - Intronic
1152152180 17:78609034-78609056 GATGAAGCACTTAGACAACATGG - Intergenic
1155609834 18:27654002-27654024 CTTCCATCACTTAGACTACAAGG + Intergenic
1156006554 18:32449472-32449494 AGTCCAGAAGTTAGACAACATGG + Intronic
1159171366 18:64772466-64772488 ATTCCTGCACTTACAGAACAAGG - Intergenic
1161678051 19:5664103-5664125 CTTCCACGACTTTGACCACAGGG + Exonic
1164403028 19:27915534-27915556 CTTCCATCACTTTTACAATATGG + Intergenic
1165225244 19:34350160-34350182 TTTCCAGCACTTAGTCAATGAGG + Intronic
1167692960 19:50998206-50998228 CTTCCTGCCCTCAGACAACCGGG + Intronic
1168412850 19:56150610-56150632 TTTCCAGCAATGATACAACATGG + Intronic
925662563 2:6218347-6218369 CCTCTCCCACTTAGACAACAAGG + Intergenic
925982677 2:9189954-9189976 CTTCCAGCTCATAGTCATCAGGG + Intergenic
929421422 2:41793722-41793744 CATCTAGCACTTAGAGACCAAGG + Intergenic
930790758 2:55325827-55325849 ATTCCAGCACAAAGATAACAAGG - Intronic
932910156 2:75798028-75798050 TTTCCTGCCCTCAGACAACATGG - Intergenic
933097632 2:78207103-78207125 CTTCCAGTTCTTAGAGAAAATGG - Intergenic
935202060 2:100865812-100865834 CTTCCAGAACTTAGAGAGTATGG - Intronic
941106224 2:161357084-161357106 TTTTTAGCACTTAGTCAACAAGG + Intronic
943547269 2:189295694-189295716 TATACAGCACATAGACAACATGG + Intergenic
944084605 2:195830745-195830767 CAGCCAGCACTGAAACAACATGG - Intronic
944668737 2:201977785-201977807 CTCCCAACACATACACAACAGGG + Intergenic
945735838 2:213599406-213599428 CTGCCAGCCCTGGGACAACATGG + Intronic
947946978 2:234113058-234113080 CTTTCAGCACTTTAAAAACATGG + Intergenic
1170671630 20:18439726-18439748 CTTCCATCACTAAGATATCAAGG - Intronic
1173799187 20:45884176-45884198 CTTCCAGAACAAGGACAACAAGG + Exonic
1175570222 20:60012532-60012554 CTTCCAGCACATTGGCAACATGG - Exonic
1178713110 21:34937734-34937756 CTTCCTGCACCCAGGCAACAGGG - Intronic
1182261926 22:29079362-29079384 CTCCCTGCATTTATACAACAGGG + Intronic
1183205013 22:36412990-36413012 ATTCTAGCATGTAGACAACAGGG - Intergenic
1183792306 22:40082497-40082519 CTTCAAGCTCTTAAGCAACATGG - Intronic
951646334 3:24895839-24895861 CGTCCAGCACTTCCACAACCAGG + Intergenic
957877726 3:86171155-86171177 CTCCCAGGACCTAGCCAACATGG + Intergenic
958148494 3:89658222-89658244 ATTCCAGCACTCAGTCAACTTGG + Intergenic
958627008 3:96639359-96639381 CATCCAGCAGGTAGACACCAGGG + Intergenic
960363048 3:116736932-116736954 CCTTGAGCTCTTAGACAACAGGG + Intronic
960906858 3:122610289-122610311 CTTCCAAAACTTAGACATTAAGG - Intronic
961964742 3:130890695-130890717 CTTCCAGCACTGCCAAAACATGG + Intronic
962947445 3:140184888-140184910 CTTCCCGCACATATACACCATGG + Intronic
963240106 3:142994694-142994716 CTGCAAGCCCTTTGACAACAGGG + Intronic
963608091 3:147430694-147430716 CTTACAGCACTTAGAAAAAGTGG + Intronic
963845406 3:150150776-150150798 CTTCCAGCTCTTTGACATCGTGG - Intergenic
964578484 3:158202427-158202449 CTGCCACCACTGAGACAGCAAGG - Intronic
967234245 3:187368768-187368790 CTTCCAGCAGTTAAACAAAATGG - Intronic
967941884 3:194772545-194772567 GTTCCACCACTTAGAACACAAGG + Intergenic
971954068 4:33393007-33393029 CTTCCAACTCTTAGACATCTGGG - Intergenic
975714576 4:77193368-77193390 CTTCCAGCACTTAGACAACATGG - Intronic
976803599 4:89020654-89020676 CTTCCAGGACTTACCCAAGAAGG - Exonic
977389039 4:96384196-96384218 TCTCAAGCACTTACACAACAGGG + Intergenic
979627500 4:122861781-122861803 CTTCCAGCAATTAGGTAGCATGG - Intronic
979832186 4:125316549-125316571 CTTCCAGCACTTGGAACACCTGG - Exonic
980016919 4:127660389-127660411 CTGCCAGCTGTTAGCCAACAGGG + Intronic
988670277 5:33373997-33374019 ATTCCAGCCATTAGAAAACAAGG + Intergenic
988809843 5:34773871-34773893 CATCCAGCACTTCCACAACTGGG + Intronic
993213983 5:84995203-84995225 CTGCAAGCACTTAGACATTAGGG - Intergenic
993976447 5:94488232-94488254 CTTCCCCCACTAAGACAACCTGG + Intronic
994265932 5:97716923-97716945 TTTCCAGCAGTTAGACCACAAGG + Intergenic
995194542 5:109349187-109349209 ATTCCAGCACTTTGATAACTTGG - Intronic
995408695 5:111830960-111830982 CTTCCATCACTTATGGAACAGGG - Intronic
995651630 5:114376304-114376326 CTTCCTGCACAGAGACCACACGG + Intronic
996653290 5:125908963-125908985 GTTCCAGGTCTTAGACCACAGGG + Intergenic
997276441 5:132596639-132596661 CTCCCAGAACATAGAGAACAAGG + Intronic
999135138 5:149313734-149313756 CTTCTAGCACTTACACAGCTTGG - Intronic
999565578 5:152856823-152856845 CTTACAGCTTTTTGACAACAGGG - Intergenic
1003385266 6:5661545-5661567 CTTCCAGCACTCACACACCCTGG - Intronic
1003803782 6:9702223-9702245 CTTGTAGCACCTTGACAACATGG - Intronic
1004283979 6:14303185-14303207 CATCCAGCACTAAAACAAAATGG - Intergenic
1007947882 6:45841970-45841992 CTTTCAGGCCTTAGGCAACAAGG - Intergenic
1014848317 6:126307954-126307976 CTTACAGCAATTATACTACAGGG - Intergenic
1026335615 7:69391975-69391997 ATTCCAACAATTAGAGAACAGGG - Intergenic
1029273828 7:99392790-99392812 CTTCCAGAACCTGGACAAGAAGG + Exonic
1033190447 7:139274044-139274066 CATCCAGCCCTTAGGCCACAGGG - Exonic
1034958239 7:155349331-155349353 CTTCCTGCACAAAAACAACAGGG + Intergenic
1035118616 7:156546227-156546249 CTTCCAGCAGTTAGAAATCACGG + Intergenic
1038049661 8:23796785-23796807 CTTCTAGCACTTTGAGAACAAGG + Intergenic
1038674623 8:29612552-29612574 TTTCAAGCTCTTAGAAAACAGGG + Intergenic
1042892060 8:73622919-73622941 CTTCCAGCAGTTAGAAGGCAAGG - Intronic
1043962960 8:86438272-86438294 CTGCCACCCCTGAGACAACAAGG - Intronic
1044446521 8:92283466-92283488 CTTTAAGCAATAAGACAACATGG - Intergenic
1047863388 8:128993826-128993848 CTTCCAGCACTTGTTCTACAAGG + Intergenic
1047947065 8:129891032-129891054 CTTCCAGCAGTAAGACAGCTAGG + Intronic
1048390664 8:133960913-133960935 CACACAGCACTTTGACAACACGG + Intergenic
1048985669 8:139733491-139733513 CTTCCAGGACCTCCACAACAGGG - Intronic
1049565495 8:143335844-143335866 CTTCCAGCAGCTAGATGACATGG - Intronic
1049612576 8:143562319-143562341 CCCCCAGCAGGTAGACAACAGGG - Exonic
1050839709 9:10133089-10133111 CTTCCAGCACACAGCCAACGAGG + Intronic
1186217943 X:7319733-7319755 CTTTCAGGACATAGACAACTTGG + Intronic
1193111268 X:77732877-77732899 CTTCCAGCAGTTACTCAACATGG + Intronic
1193458879 X:81765879-81765901 CCACCAGCACTAAGAAAACATGG - Intergenic
1194126361 X:90021926-90021948 CTCTCAGCACATAGAGAACAAGG - Intergenic
1194337336 X:92664699-92664721 CTTTCAGCAATTATACATCAGGG + Intergenic
1198136443 X:133755825-133755847 CATCCAGCTTTTAGAAAACAAGG - Intronic
1200645761 Y:5781433-5781455 CTTTCAGCAATTATACATCACGG + Intergenic
1201637797 Y:16144516-16144538 CTGCCATCCCTGAGACAACAAGG - Intergenic