ID: 975715023

View in Genome Browser
Species Human (GRCh38)
Location 4:77197298-77197320
Sequence ATGTCAGAGGGCCCGTTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 69}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975715023_975715030 13 Left 975715023 4:77197298-77197320 CCTACAAACGGGCCCTCTGACAT 0: 1
1: 0
2: 0
3: 1
4: 69
Right 975715030 4:77197334-77197356 GGTTGGGATCTTTTTCCTCAGGG 0: 1
1: 0
2: 1
3: 7
4: 139
975715023_975715026 -8 Left 975715023 4:77197298-77197320 CCTACAAACGGGCCCTCTGACAT 0: 1
1: 0
2: 0
3: 1
4: 69
Right 975715026 4:77197313-77197335 TCTGACATCTGACTTTCAAATGG 0: 1
1: 0
2: 2
3: 20
4: 255
975715023_975715028 -3 Left 975715023 4:77197298-77197320 CCTACAAACGGGCCCTCTGACAT 0: 1
1: 0
2: 0
3: 1
4: 69
Right 975715028 4:77197318-77197340 CATCTGACTTTCAAATGGTTGGG No data
975715023_975715029 12 Left 975715023 4:77197298-77197320 CCTACAAACGGGCCCTCTGACAT 0: 1
1: 0
2: 0
3: 1
4: 69
Right 975715029 4:77197333-77197355 TGGTTGGGATCTTTTTCCTCAGG 0: 1
1: 0
2: 2
3: 21
4: 189
975715023_975715027 -4 Left 975715023 4:77197298-77197320 CCTACAAACGGGCCCTCTGACAT 0: 1
1: 0
2: 0
3: 1
4: 69
Right 975715027 4:77197317-77197339 ACATCTGACTTTCAAATGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975715023 Original CRISPR ATGTCAGAGGGCCCGTTTGT AGG (reversed) Intronic
906019595 1:42615636-42615658 ATGTTAGAGGTCCTGTCTGTAGG + Intronic
906381612 1:45335844-45335866 ATGTCAGAGGGCCATATTTTGGG - Intronic
908858542 1:68456199-68456221 ATGTCAGAGTGCCCTCTTGCTGG + Intergenic
912192404 1:107354794-107354816 CTCTCAGAGAGCCCTTTTGTGGG + Intronic
912491427 1:110064819-110064841 AAGTTAGAGGGCCCGTCTCTGGG + Exonic
915449488 1:155994726-155994748 ATGGCACAGGGCCCATTTGTAGG - Intronic
921342657 1:214149907-214149929 CTGGCAGAGGTCGCGTTTGTTGG - Intergenic
1063236830 10:4126036-4126058 ATGTCAGAGATCCAGTTTATAGG - Intergenic
1064465545 10:15576557-15576579 ATGTCATAGGGCCCTTTTAAAGG + Intronic
1066101268 10:32120839-32120861 ATGTCAAAGATCCCGTCTGTAGG - Intergenic
1076186232 10:128451735-128451757 ATGTCAGAGGGAACGTTGGCAGG + Intergenic
1079324463 11:19479616-19479638 ATGTTAGTTGGCCTGTTTGTAGG + Intronic
1086411919 11:86552309-86552331 TTGTCAGAGGGCTGGGTTGTAGG - Intronic
1087551426 11:99655180-99655202 ATGTCAGAGGTCCTGTCTGAAGG + Intronic
1087798459 11:102478695-102478717 ATGTCAGAGATCCTGTCTGTAGG + Intronic
1090471585 11:126985640-126985662 ATGTCAGCGGCTCCGTGTGTTGG + Intronic
1098909767 12:76196913-76196935 ATGTCAGAGAGCCTGTCTATAGG + Intergenic
1104216796 12:126741717-126741739 ATGACAGAGGGCCTCTTTGAGGG + Intergenic
1107206204 13:37791890-37791912 ATGACAGAGGGCCAGTTGGCAGG + Intronic
1109335949 13:60993819-60993841 ATGCCATAGGGTCTGTTTGTTGG - Intergenic
1110804198 13:79736079-79736101 ATGGCAGAGGAGCTGTTTGTTGG + Intergenic
1121319089 14:92980645-92980667 ATGAGAGAGGGACCCTTTGTAGG - Intronic
1122583223 14:102784875-102784897 CTGGCAGAGGGCCCGTGAGTCGG + Intronic
1126301628 15:47203165-47203187 ATGTCAAAGTGCCAGTTTGGGGG - Intronic
1143503359 17:7351431-7351453 ATGGCAGAGGGCCCGGTGGCGGG - Exonic
1145735238 17:27225039-27225061 ATGTCTGAGGGCCTGATGGTGGG - Intergenic
1148188711 17:45663813-45663835 ATGTCAGAGACCCTGTCTGTAGG + Intergenic
1149500632 17:57149688-57149710 ATGACAGAGGCTCCGCTTGTCGG - Intergenic
1154262348 18:12847280-12847302 AGTTCAGAGGGTTCGTTTGTAGG + Intronic
1157188069 18:45557651-45557673 ATGTCAGAGGCCCCATATATTGG + Intronic
1157329094 18:46690195-46690217 ATGTCAGTGTGCCTATTTGTAGG + Intronic
1162041095 19:7971491-7971513 CTGTCAGTGGGCCAGTGTGTGGG - Intronic
935872500 2:107466418-107466440 AAGACAGAGGGACCATTTGTTGG + Intergenic
939681134 2:145134584-145134606 CTGTCAGAGGGCCCTGCTGTAGG + Intergenic
944778682 2:202995368-202995390 ATGTCTGTTGGCCCTTTTGTTGG - Intronic
947115631 2:226767477-226767499 ATGGCTAAGGGCCCTTTTGTTGG - Intronic
1172753856 20:37269903-37269925 ATGCCAGAGGCCCCGCCTGTGGG + Intergenic
1172827776 20:37805063-37805085 ATGGCCGAAGGCCGGTTTGTAGG - Intronic
1174410567 20:50332269-50332291 GTGTCTGAGGGCCTGTTTCTGGG - Intergenic
1180678245 22:17603830-17603852 ATGTTAGAGGGCTCTTTTGGTGG - Intronic
1181061832 22:20285457-20285479 ATGGCTGAGGGCCTGTTTGGGGG + Intergenic
953605411 3:44410315-44410337 ATGTCAGAGGGCCTGTGGTTGGG - Intergenic
962217007 3:133531395-133531417 ATGTCAGTGGTTCCCTTTGTTGG + Intergenic
966434695 3:179870205-179870227 ATGTCAGAGATCCTGTCTGTAGG - Intronic
971076091 4:23151568-23151590 ATGTCAGAGGGGCAGCTTGACGG + Intergenic
975715023 4:77197298-77197320 ATGTCAGAGGGCCCGTTTGTAGG - Intronic
977121668 4:93108914-93108936 ATGTCAGAGGCCCAGTGTGGTGG - Intronic
978425210 4:108574989-108575011 CTGACAGTGGGCCCTTTTGTGGG + Intergenic
979065192 4:116122740-116122762 ATGTCATAGGGATAGTTTGTTGG - Intergenic
980514832 4:133841832-133841854 AGGTCAGTGGGCCCGCTTCTGGG + Intergenic
988777379 5:34489741-34489763 ATGTCACAGGGCGCCTTAGTTGG - Intergenic
1001730877 5:173955954-173955976 ATGTCAGGGGGCCCGTTGTGGGG + Exonic
1008524222 6:52391908-52391930 ATGTCACAGGATCTGTTTGTTGG + Intronic
1009324986 6:62338574-62338596 ATGCCAGAGAGCCTGTTGGTTGG - Intergenic
1010273247 6:73939127-73939149 ATGTCAGGGTGCCCCTTCGTGGG + Intergenic
1012300760 6:97585180-97585202 TTGTCAGAGAGGCCATTTGTAGG + Intergenic
1017456864 6:154608767-154608789 CTGGCAGAGGGGCCGTTGGTCGG - Intergenic
1019542634 7:1558459-1558481 ATGGCTGGGGGCCCGTTTGAAGG + Intronic
1020151520 7:5685331-5685353 ATGTCAGGAGGCCCCTTTCTGGG + Intronic
1024783736 7:52882107-52882129 ATCTCAGAGGGCTTGATTGTTGG + Intergenic
1031208105 7:118788095-118788117 GGGTAAGAGGGCCCCTTTGTTGG - Intergenic
1046358189 8:113115843-113115865 AGGACAGGGGGCCCTTTTGTAGG + Intronic
1055408765 9:76004356-76004378 ATGTCAGAAGTCCCATTTTTTGG + Intronic
1056901991 9:90608495-90608517 ATGTCAGAGGTCCTGTCTATGGG - Intergenic
1062159754 9:135073801-135073823 AAGCCAGAGGGCCCGCCTGTTGG - Intergenic
1187615988 X:20993982-20994004 AAGTCAGAGGCCCCTATTGTAGG + Intergenic
1187925238 X:24243943-24243965 ATGTCAGAGTGTCCTTTTCTAGG + Intergenic
1188882934 X:35512789-35512811 ATGTCAGATATCCTGTTTGTAGG - Intergenic
1189368047 X:40404499-40404521 ATGTCAGAGATCCTGTCTGTAGG - Intergenic
1190552882 X:51602952-51602974 ATGTCAGAGGGCTCATTTCCTGG + Intergenic
1200900498 Y:8426511-8426533 ATGTCACAATGCCCTTTTGTGGG + Intergenic