ID: 975721192

View in Genome Browser
Species Human (GRCh38)
Location 4:77250196-77250218
Sequence TAGAAACCACAACTAGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975721187_975721192 18 Left 975721187 4:77250155-77250177 CCCTGGAAATTGCTATGAGCATG 0: 1
1: 0
2: 1
3: 10
4: 147
Right 975721192 4:77250196-77250218 TAGAAACCACAACTAGAGCATGG No data
975721188_975721192 17 Left 975721188 4:77250156-77250178 CCTGGAAATTGCTATGAGCATGA 0: 1
1: 0
2: 0
3: 10
4: 143
Right 975721192 4:77250196-77250218 TAGAAACCACAACTAGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975721192 Original CRISPR TAGAAACCACAACTAGAGCA TGG Intronic
No off target data available for this crispr