ID: 975722606

View in Genome Browser
Species Human (GRCh38)
Location 4:77262817-77262839
Sequence GTCCCTGACCTTTCTGTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 226}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975722606_975722611 0 Left 975722606 4:77262817-77262839 CCTACCACAGAAAGGTCAGGGAC 0: 1
1: 0
2: 0
3: 14
4: 226
Right 975722611 4:77262840-77262862 CCTATCTCCCCGTGGAAAAAAGG 0: 1
1: 0
2: 0
3: 13
4: 71
975722606_975722612 1 Left 975722606 4:77262817-77262839 CCTACCACAGAAAGGTCAGGGAC 0: 1
1: 0
2: 0
3: 14
4: 226
Right 975722612 4:77262841-77262863 CTATCTCCCCGTGGAAAAAAGGG No data
975722606_975722613 2 Left 975722606 4:77262817-77262839 CCTACCACAGAAAGGTCAGGGAC 0: 1
1: 0
2: 0
3: 14
4: 226
Right 975722613 4:77262842-77262864 TATCTCCCCGTGGAAAAAAGGGG 0: 1
1: 0
2: 0
3: 6
4: 120
975722606_975722608 -8 Left 975722606 4:77262817-77262839 CCTACCACAGAAAGGTCAGGGAC 0: 1
1: 0
2: 0
3: 14
4: 226
Right 975722608 4:77262832-77262854 TCAGGGACCCTATCTCCCCGTGG 0: 1
1: 0
2: 0
3: 2
4: 80
975722606_975722614 6 Left 975722606 4:77262817-77262839 CCTACCACAGAAAGGTCAGGGAC 0: 1
1: 0
2: 0
3: 14
4: 226
Right 975722614 4:77262846-77262868 TCCCCGTGGAAAAAAGGGGTAGG 0: 1
1: 0
2: 0
3: 9
4: 93
975722606_975722618 9 Left 975722606 4:77262817-77262839 CCTACCACAGAAAGGTCAGGGAC 0: 1
1: 0
2: 0
3: 14
4: 226
Right 975722618 4:77262849-77262871 CCGTGGAAAAAAGGGGTAGGAGG 0: 1
1: 0
2: 0
3: 12
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975722606 Original CRISPR GTCCCTGACCTTTCTGTGGT AGG (reversed) Intronic
900945754 1:5830584-5830606 GCCCAGGACCTTTCTGTGGCTGG - Intergenic
903340404 1:22650874-22650896 CCCCCTCACCTTCCTGTGGTTGG - Intergenic
903739934 1:25552843-25552865 TTTCCTGACATTTGTGTGGTTGG + Intronic
904329138 1:29746520-29746542 GTGTCTGACCTTTCTGGAGTAGG + Intergenic
905049523 1:35038137-35038159 GGCCCTCAACTTTCTGTGGGTGG + Intergenic
905371417 1:37484491-37484513 CTCCCTGACCCTTCTCTGGAAGG + Intergenic
905788596 1:40777889-40777911 GTCCCTGGCATTTTTGAGGTTGG + Intergenic
908611145 1:65862675-65862697 GTCCTGGACCTTTTTTTGGTTGG + Intronic
911424078 1:97684861-97684883 GGCCCTGAGCTTTTTTTGGTTGG - Intronic
912565232 1:110582773-110582795 GTCCCAGACCTTTCTCAGCTTGG + Intergenic
913438800 1:118875422-118875444 GTGCTTGGCTTTTCTGTGGTGGG + Intergenic
914920920 1:151847072-151847094 GCCCAGGGCCTTTCTGTGGTTGG - Intergenic
915612048 1:157001678-157001700 ATCCCAGACCATTCTGTGGGAGG + Intronic
915753216 1:158232283-158232305 GTCCCAGCCTTTTCTGTGCTGGG - Intergenic
916322234 1:163517651-163517673 GTCCCTGGCTTTTCTTTGCTGGG - Intergenic
919089639 1:192962502-192962524 GTCCTGGACTTTTCTTTGGTGGG - Intergenic
921461241 1:215429778-215429800 GGCCCTGAACTTTTTTTGGTTGG + Intergenic
923801757 1:237216976-237216998 GTACCTGAAATTTCTGTGGCTGG + Intronic
924042427 1:239997516-239997538 GCCCCTCCCCTTTCTGTGGGCGG - Intergenic
924814381 1:247429263-247429285 GGCCCTGAACGTTCTGTGCTGGG - Intronic
1063352239 10:5366203-5366225 GTCCCTCACGTTTCAGTGCTTGG + Intronic
1066784145 10:38983558-38983580 GTCCCTCACTCTTCAGTGGTAGG + Intergenic
1066983913 10:42446913-42446935 GTCCCTCACTCTTCAGTGGTAGG - Intergenic
1067445616 10:46341845-46341867 GTCCCTCACTCTTCGGTGGTAGG + Intergenic
1067591758 10:47518898-47518920 GTCCCTCACTCTTCGGTGGTAGG - Intronic
1067638873 10:48026972-48026994 GTCCCTCACTCTTCGGTGGTAGG - Intergenic
1067874609 10:49993327-49993349 GTCCCTCACTCTTCAGTGGTAGG + Intronic
1068630137 10:59289767-59289789 GTCCCTCATCTTTCTGTAGAGGG - Intronic
1068832819 10:61517266-61517288 GGCCCTGAGCTTTTTCTGGTTGG + Intergenic
1070135862 10:73693128-73693150 GTCCCTCACTCTTCAGTGGTAGG - Intronic
1071590001 10:86863748-86863770 GCCCCTGAACTTTTTGTGGCAGG + Intronic
1072673990 10:97452064-97452086 CTCCCTGACCTTGCTGGTGTTGG + Intronic
1073149792 10:101303921-101303943 CTCCCTGCCCAATCTGTGGTTGG + Intergenic
1073496384 10:103895115-103895137 GTCCCTCACATTGCTCTGGTTGG - Intronic
1074777691 10:116778369-116778391 TTCTCTGACCTTTCTGTGTAAGG - Intergenic
1075657675 10:124172948-124172970 CTCCCTGAGCTTCCTGGGGTGGG - Intergenic
1075782616 10:125026862-125026884 GTTCCTGGCCTTTCTGCGGGCGG - Exonic
1077148388 11:1056138-1056160 GTCCCTGTCCTGTCTGTGGAGGG - Intergenic
1082924937 11:58535035-58535057 GTCCCGGACTTTTTTTTGGTCGG - Intronic
1084241033 11:67820114-67820136 GTCCCTGAACTTGATGTAGTTGG + Intergenic
1084595862 11:70116670-70116692 GTCCGTGAGCTTTGTGTGGCTGG + Intronic
1084954407 11:72683822-72683844 GGCCCAGACCTTTCTCTGCTGGG - Intergenic
1087753823 11:102034044-102034066 GTCCTGGACCTTTTTTTGGTTGG + Intergenic
1088503498 11:110507420-110507442 GTCCCTGACATTTATGTAGCAGG - Intergenic
1088728119 11:112657331-112657353 TTTCCTGAGCTTTCTGTGGAAGG + Intergenic
1090936376 11:131346490-131346512 GTCCATGAGGTTTCTGAGGTGGG + Intergenic
1092170915 12:6373679-6373701 GTGCCTGACCTTTACGTGCTTGG - Intronic
1092411260 12:8254729-8254751 GTCCCTGAACTTCATGTAGTTGG + Intergenic
1093291149 12:17323248-17323270 GTCTATGACCTTACTATGGTAGG - Intergenic
1093335730 12:17902666-17902688 GTTCCTGAGCTTTTTTTGGTTGG + Intergenic
1094861046 12:34466675-34466697 GGTCCTGAGCTTTTTGTGGTTGG + Intergenic
1095194498 12:39297137-39297159 TTCCTTGACATTTCTGTGCTTGG - Intronic
1095829212 12:46565976-46565998 GTCCCAGACTTTTCTTTGCTGGG + Intergenic
1095837625 12:46655628-46655650 GGCTCTGCCCATTCTGTGGTAGG + Intergenic
1096891930 12:54780242-54780264 GTCCTGGACCTTTTTTTGGTTGG - Intergenic
1098139556 12:67437827-67437849 GTCCCAGACCTGTCTATGGCTGG - Intergenic
1098173160 12:67766779-67766801 GTCCCTGTCCTTGGGGTGGTGGG + Intergenic
1100296571 12:93268207-93268229 GTCCAGGACCTTTCTTTGTTGGG - Intergenic
1102379364 12:112450499-112450521 GTTACTGACCTTTCAGAGGTAGG - Exonic
1102909690 12:116703428-116703450 GTCCCTGACCTTTCATTGCCCGG - Intergenic
1104086595 12:125480625-125480647 GGTCCTGAACTTTTTGTGGTTGG - Intronic
1106527760 13:30557940-30557962 GTCCCTGAGGTTCCTGTGCTTGG + Intronic
1116156929 14:41217600-41217622 GTTCCTGGGCTTTCTTTGGTTGG - Intergenic
1116956662 14:50930722-50930744 GTCCCTGAGCGTTCTCTTGTTGG + Intronic
1117891169 14:60423804-60423826 GTCCCAGACTTTTTTTTGGTTGG + Intronic
1118097157 14:62549930-62549952 GTCCCAGAGTTTTCTGTGCTGGG - Intergenic
1119395567 14:74323736-74323758 TTCCCTGACCTTCCAGTGGGAGG - Intronic
1119569182 14:75655076-75655098 GGACCTGACCTCTCTGTGGCTGG + Intronic
1122066656 14:99178416-99178438 GTCCCTGCCCTATCTTAGGTGGG - Intronic
1125757884 15:42077099-42077121 GTCCTTGACTTTTCTTTGATGGG - Intronic
1127570656 15:60237856-60237878 GTCCCTGACCCTCGTGTAGTGGG + Intergenic
1127704686 15:61535316-61535338 GAAACTGACCTTTCTGTGGCAGG + Intergenic
1128258317 15:66214360-66214382 GTCCCTGTCCTTGCTGTAGGTGG + Intronic
1128545458 15:68563878-68563900 GTCCTGGACCTTTCTTTGTTGGG - Intergenic
1128748401 15:70131229-70131251 GTCCTTGATCCTTCTGTGATAGG + Intergenic
1128884914 15:71277829-71277851 CTCCCAGCCCTTTCTGTGCTGGG + Intronic
1130014327 15:80175304-80175326 GTCACTGAGCTCTCAGTGGTAGG + Intronic
1130320312 15:82835822-82835844 GAGCCTGGCCTGTCTGTGGTGGG - Exonic
1131819904 15:96261899-96261921 GTCCCTGACATTTGTGTGCAGGG + Intergenic
1137516781 16:49151778-49151800 ATCCTTTACATTTCTGTGGTAGG - Intergenic
1137697066 16:50468498-50468520 GTCCCTGGCCTTTCTGAGCCGGG - Intergenic
1139560921 16:67741504-67741526 GTCCCTGACCTGTGTCTGTTTGG - Intronic
1141942815 16:87289698-87289720 GTCCTTGGCATTTCTGTGGCTGG - Intronic
1142139513 16:88466535-88466557 TCCCCTGCCCTTTCTGTGCTTGG - Intronic
1203139875 16_KI270728v1_random:1755674-1755696 TTGCCTGTCCTTTCTGTGGCTGG - Intergenic
1143988189 17:10933608-10933630 GTCCCTGAGCTTTCTCTGCTGGG + Intergenic
1144682068 17:17202853-17202875 TTCCGTGACTTTTCTTTGGTGGG + Exonic
1147348309 17:39820073-39820095 GTACCTGGCCCTACTGTGGTAGG - Intronic
1148671365 17:49412988-49413010 GCCCCTGACCTTTCAGTCATAGG - Intronic
1149979752 17:61300720-61300742 TTCTCTGAACTTTCTGTGGTAGG - Intronic
1155803878 18:30142182-30142204 GTCTCTGACCTTACTTAGGTGGG + Intergenic
1156377130 18:36524784-36524806 GGCCCTGATTTTTCTATGGTTGG + Intronic
1156827764 18:41452553-41452575 GTCCATGGCTTTTCTGTGTTAGG - Intergenic
1157607084 18:48932713-48932735 GGCCCTGGCCTGTCTGGGGTTGG - Intronic
1159723490 18:71923092-71923114 GGCCCTGGCCTTTCTCTGGCTGG - Intergenic
1159911736 18:74152252-74152274 GACCCTGACCTTGGTGTGGGAGG + Intronic
1160939397 19:1613351-1613373 TTCCCAGACGTTTCTGTGGAGGG + Intronic
1162654218 19:12116673-12116695 GGCGCTGTCCCTTCTGTGGTTGG + Intronic
1163815495 19:19462414-19462436 GTGCCTGTCCTTCCTGAGGTGGG + Intronic
1164482382 19:28622363-28622385 CTCCATTCCCTTTCTGTGGTTGG + Intergenic
1165432447 19:35780564-35780586 GACCCTGACCTTCCTCAGGTCGG + Exonic
1167884984 19:52493055-52493077 GTCCCTGGTCTTTCTGCTGTAGG + Intronic
1168493584 19:56832260-56832282 GGCCCTGCCCTTTCTCTGCTGGG + Intronic
925671138 2:6310958-6310980 GTCCCTCTCCTTTCTGTGCTTGG - Intergenic
926137290 2:10345875-10345897 GTCCTTGCCCCTTTTGTGGTGGG - Intronic
927315882 2:21681512-21681534 GTCCAGGACTTTTCTGTGTTGGG - Intergenic
931093989 2:58919256-58919278 GTTCCTGGTTTTTCTGTGGTTGG + Intergenic
931367338 2:61630138-61630160 GTCCCTGAGCTTCCTATGGCTGG - Intergenic
932162811 2:69477923-69477945 GTTACTGAACTTTCTGTGATTGG - Intronic
935288306 2:101586386-101586408 GTACTTGACTTTTCTTTGGTGGG + Intergenic
935852423 2:107236926-107236948 GTCCCGGGCTTTTCTTTGGTTGG - Intergenic
936463179 2:112726294-112726316 GACCCTGGCCTTTCTGGGGGTGG + Intronic
936517095 2:113187809-113187831 GACCCTGACCCGTCTGTGTTAGG - Intronic
936776796 2:115984349-115984371 GTCCCAGACCTTTCTGCTGGTGG - Intergenic
937096881 2:119241364-119241386 TTCCTTGACCTTTCTGATGTAGG - Intronic
937197957 2:120176894-120176916 GTCTGTGACCTTTATGTCGTTGG + Exonic
937484765 2:122303708-122303730 GGCCCTGGCCTTTTTCTGGTTGG - Intergenic
938599710 2:132824654-132824676 CTTCCTGACCCCTCTGTGGTTGG + Intronic
939054185 2:137343255-137343277 GTCCTTGGCTTTTCTGTGATGGG + Intronic
940396874 2:153199571-153199593 TTGCCTGTCCTTACTGTGGTGGG + Intergenic
945390978 2:209264886-209264908 GTCCTGGACCTTTTTTTGGTTGG - Intergenic
945554008 2:211256545-211256567 GTCCCGGACTTTTTTTTGGTTGG + Intergenic
947404867 2:229764703-229764725 GTCCCTTGGCCTTCTGTGGTAGG + Intronic
948229641 2:236340716-236340738 ATCCCTGCCCTTTCTGAGGCAGG + Intronic
1169335858 20:4756112-4756134 GTCCTGGACTTTTCTGTTGTCGG + Intergenic
1169993098 20:11525444-11525466 ATCCCTGGTCTTTCTGTGGTTGG - Intergenic
1170285305 20:14701799-14701821 GTCCCTGAGCTTGGTGTGATAGG + Intronic
1170542947 20:17407205-17407227 GTCCCAGGCCTCTCTGAGGTTGG + Intronic
1170904645 20:20502652-20502674 GTCCCTTGCATTTATGTGGTAGG + Intronic
1171049186 20:21839742-21839764 GTTCCTGAACTTTCTATGGAGGG - Intergenic
1174487317 20:50869538-50869560 GGGCCTGACTTTTATGTGGTTGG - Intronic
1174837027 20:53866180-53866202 TTGCCTGTCCTTTCTGTGGCTGG - Intergenic
1177087386 21:16723590-16723612 TTCCCTTGCCTTTGTGTGGTTGG + Intergenic
1177660710 21:24079715-24079737 GTCCTGGACCTTTCTTTGATAGG - Intergenic
1178134353 21:29610223-29610245 GTTTCTTACCTTTGTGTGGTAGG + Intronic
1179051347 21:37891077-37891099 GTCACTCACCTTTCTGAGATAGG - Intronic
1179103042 21:38373446-38373468 GGTACTGACCTTTCTGTGGAGGG - Intergenic
1179118198 21:38515438-38515460 GTCCTTGACTTTTCTTTGTTGGG - Intronic
1180060943 21:45384729-45384751 CTCCCTGACCTTGGTGTGCTCGG + Intergenic
1180706813 22:17815324-17815346 CTCCCTCACGTTGCTGTGGTGGG - Intronic
1180982037 22:19883109-19883131 TTTCCTTTCCTTTCTGTGGTGGG - Intronic
1182825464 22:33260956-33260978 AACCCTGACATTTCTGGGGTGGG - Intronic
1183235154 22:36611279-36611301 GTCCCGGCCCATTCTGTGCTTGG + Intronic
1183810586 22:40253732-40253754 GGGCCTGACCTTTCTATTGTTGG + Intronic
1184071809 22:42151526-42151548 GTCCCAGATCATTCTGTGCTCGG + Intergenic
949453637 3:4214912-4214934 GTCCCGGAACTTTTTTTGGTTGG - Intronic
951742016 3:25935007-25935029 GTCCCTGGGCTTTTTTTGGTTGG - Intergenic
952012935 3:28922067-28922089 GTCCTTGTCTTTTATGTGGTAGG + Intergenic
952682832 3:36115388-36115410 AACACTGACCTTTCTTTGGTTGG + Intergenic
953964004 3:47288298-47288320 GTCCCTTCCCTTTCTGGGCTTGG - Intronic
955050994 3:55410877-55410899 GTGGTTGACCTTTCTGAGGTTGG - Intergenic
961297902 3:125901822-125901844 GTCCCTGAACTTGATGTAGTTGG - Intergenic
961334706 3:126165547-126165569 GGCCCTGAGCTTTCCTTGGTTGG + Intronic
962466524 3:135664893-135664915 GTCCCTGGCTTTTCTTTAGTGGG - Intergenic
962666359 3:137657705-137657727 GTCCTTGACTTTTTTTTGGTTGG - Intergenic
962890553 3:139668650-139668672 GTCCCTGCCATTTCTGTGAATGG - Intronic
963624864 3:147658657-147658679 GTTCCTAACCAATCTGTGGTTGG + Intergenic
963913623 3:150837377-150837399 GCCCCTGGCCTTTTTTTGGTAGG + Intergenic
963979342 3:151519141-151519163 GTCACTGAGATTTTTGTGGTTGG - Intergenic
968403485 4:318329-318351 GTCCCAGAGCTTTCTGGGGTGGG + Intergenic
968645795 4:1739949-1739971 GTCCATGATCTTCCTGTGGGAGG - Exonic
968999307 4:3967246-3967268 GTCCCTGAACTTGATGTAGTTGG + Intergenic
969275205 4:6130076-6130098 TTCTCTGATCTTTCTGGGGTTGG - Intronic
969485835 4:7472019-7472041 GACCCTGACCTCTCTGAGATGGG + Intronic
969493106 4:7511022-7511044 TCCCCAGACCTTTCTGTTGTGGG + Intronic
969754695 4:9141373-9141395 GTCCCTGAACTTGATGTAGTTGG - Intergenic
970097674 4:12482880-12482902 GTCCTTGTCCTTTCTTTGCTGGG + Intergenic
970771511 4:19618719-19618741 GTCCTTGACTTTTCTTTGTTGGG - Intergenic
972271974 4:37520382-37520404 GTCCCTGGCTTTTCTTTGCTGGG + Intronic
973196302 4:47446232-47446254 GTCCTTGACTTTTCTGTGTTGGG - Intergenic
973787344 4:54344973-54344995 GTCCCGGACATTTTTTTGGTTGG - Intergenic
973826528 4:54712579-54712601 GTTTCTGACTTTTCTCTGGTGGG + Intronic
975374960 4:73632521-73632543 GTCCCAGAACTTTCTGTGGATGG + Intergenic
975722606 4:77262817-77262839 GTCCCTGACCTTTCTGTGGTAGG - Intronic
976073305 4:81267410-81267432 GTCCTGGACCTTTCTATGATGGG + Intergenic
976128763 4:81861304-81861326 GTCCCAGACTTTTCTTTGCTGGG - Intronic
977538314 4:98282234-98282256 GTCCCTGGACTTTTTTTGGTTGG + Intronic
978491431 4:109315553-109315575 GACCCTGTCCAATCTGTGGTGGG + Intergenic
979742706 4:124171008-124171030 GTTCCTGGGCTTTTTGTGGTTGG - Intergenic
980540000 4:134180896-134180918 GGCCCTGAACTTTTTCTGGTTGG - Intergenic
987460780 5:18207037-18207059 GTCCCTGATCTTTCTTGGGATGG + Intergenic
989082952 5:37644604-37644626 GTCCCAGACTTTTCTTTGCTGGG + Intronic
992654895 5:78899319-78899341 TTCTCTGACCTTTCTGTAGCTGG + Intronic
994335350 5:98558592-98558614 GTCCCAGATCTTGGTGTGGTTGG + Intergenic
995037168 5:107547384-107547406 GTCCCAGAGGTTTCTGTTGTTGG - Intronic
995093599 5:108209936-108209958 GTCCCAGACTTTTTTTTGGTTGG + Intronic
995307384 5:110669496-110669518 GTCCTTGACTTTTTTTTGGTTGG - Intronic
996236290 5:121134825-121134847 GTCACTTATCTTTCTGTGTTTGG + Intergenic
996608289 5:125349707-125349729 GTCCCAGCTTTTTCTGTGGTAGG + Intergenic
996646240 5:125821598-125821620 GACCCTGAACTTTCAGTGTTTGG - Intergenic
998113800 5:139521522-139521544 GTCCCTCCCCTCTCTGAGGTTGG - Intergenic
1000819889 5:165970294-165970316 GGTCCTGAGCTTTTTGTGGTTGG + Intergenic
1004760436 6:18659912-18659934 GTCCCTGGGCTTTTTTTGGTTGG - Intergenic
1006115957 6:31776367-31776389 GTCCCGGACCTTTCTAAGGAGGG + Intronic
1010061834 6:71631844-71631866 GTCCCAGACTTTTCTCTGCTGGG + Intergenic
1010514532 6:76757428-76757450 GTCCTGGACTTTTCTTTGGTGGG - Intergenic
1011447360 6:87455873-87455895 GTCCCTGGCTTTTCTTTGCTGGG - Intronic
1013482279 6:110563057-110563079 GTCCCTGTCCTTGGTGTTGTTGG + Intergenic
1019607867 7:1919046-1919068 GTCCCTGTCCTTGCTGGGGAGGG - Intronic
1020678027 7:11203330-11203352 GTCCCTGCCCTTCCTGTCATTGG - Intergenic
1020694470 7:11396646-11396668 GTTCCTGGGCTTTTTGTGGTTGG - Intronic
1023232267 7:38046785-38046807 GTCCCAGACTTTTCTTTGTTGGG + Intergenic
1023981878 7:45075173-45075195 GTGCCTGCCCCTTCTGTGCTGGG + Intronic
1023987628 7:45106058-45106080 GTGCCTGCCCTGTCTATGGTAGG - Intronic
1024899445 7:54301592-54301614 GGCCCTGGCCTTTTTTTGGTTGG - Intergenic
1027276616 7:76563823-76563845 GTCCTGGACCTTTTTTTGGTTGG + Intergenic
1029433292 7:100546344-100546366 GTCAATGACCTTTTTGTGATAGG + Intronic
1029932975 7:104392812-104392834 GTCCTGGACTTTTCTTTGGTTGG + Intronic
1029969708 7:104777276-104777298 GTCCCTGCACATTCTGTGATAGG + Intronic
1031813292 7:126399704-126399726 TTCCTTGACCTTTCTGTCCTGGG + Intergenic
1034346221 7:150386899-150386921 GCTCCTGACCTTGCTGTGGTGGG + Intronic
1036099964 8:5769408-5769430 GTCCCAGACTTTTCTTTGCTGGG + Intergenic
1036377929 8:8216681-8216703 GTCCCTGAACTTGATGTAGTTGG - Intergenic
1036804202 8:11817490-11817512 GTTCCTGGACTTTCTTTGGTTGG + Intronic
1039830646 8:41211203-41211225 GTGCCTCACCTTGCTGGGGTGGG + Intergenic
1040511103 8:48095780-48095802 GTGCCAGACTTTTCTTTGGTGGG + Intergenic
1044632261 8:94291389-94291411 GAGGCTGAGCTTTCTGTGGTTGG - Intergenic
1045586328 8:103541135-103541157 CTCCCTGACCTTCCTGTAATTGG - Intronic
1045664266 8:104468477-104468499 GTCACTGGCATTTCTTTGGTGGG + Intergenic
1048043642 8:130753658-130753680 ATCCCTGCACTTTCTGTGATTGG + Intergenic
1048318164 8:133377231-133377253 GTCCCTTCCCTATCTGTGCTGGG - Intergenic
1048974690 8:139664615-139664637 GTCTGTGCCCTGTCTGTGGTTGG - Intronic
1049184074 8:141239870-141239892 GGCCCTGACCATTCTATGCTGGG - Intronic
1051998711 9:23250283-23250305 GGTCCTGACCTTTTTTTGGTTGG - Intergenic
1052548059 9:29906168-29906190 GTCTCTGACCTTTCTCTGATGGG + Intergenic
1055587133 9:77767033-77767055 TTCCCTGACATTTATGTGTTAGG - Intronic
1057006751 9:91567750-91567772 TTCCCTGACCTCTCTGTGGGTGG + Intronic
1058813913 9:108666498-108666520 GTCCATGACATATCTATGGTCGG - Intergenic
1062186589 9:135221699-135221721 GTCCCTGACCTCTCTGAGCCCGG + Intergenic
1189019555 X:37320155-37320177 GTGCCTTATCTTTCTGTGGTTGG - Intergenic
1189870359 X:45375496-45375518 GTCCCAGACATTTCTTTGCTGGG - Intergenic
1192007963 X:67237597-67237619 GATCCTGACCTTTTTTTGGTTGG - Intergenic
1192843914 X:74885663-74885685 GTCCCTGGACTTTTTTTGGTTGG - Intronic
1194901100 X:99512633-99512655 GGCCCTGAGCTTTTTTTGGTTGG + Intergenic
1195343302 X:103925701-103925723 CTTCCTGGCCTTTCTGGGGTTGG + Intronic
1195363693 X:104107767-104107789 CTTCCTGGCCTTTCTGGGGTAGG - Intronic
1195866940 X:109442794-109442816 CTCCCTGACCTTGCTCTGTTGGG - Intronic
1197514812 X:127413229-127413251 GTCCCTGACTTTTCTTTGCTGGG - Intergenic
1198648549 X:138836859-138836881 GTTGCTGACCTTTTGGTGGTGGG + Intronic
1200287146 X:154834123-154834145 TACCCTGACCTTTCTGTGGAAGG + Intronic
1200371509 X:155730056-155730078 GTCCCAGGCATTTCTGTGCTGGG - Intergenic