ID: 975723663

View in Genome Browser
Species Human (GRCh38)
Location 4:77271766-77271788
Sequence TGCCCCAAACCCACCCATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 211}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975723663_975723665 2 Left 975723663 4:77271766-77271788 CCATGATGGGTGGGTTTGGGGCA 0: 1
1: 0
2: 3
3: 12
4: 211
Right 975723665 4:77271791-77271813 GTGAATCTCCCTAGTGATCAGGG 0: 1
1: 0
2: 1
3: 6
4: 111
975723663_975723664 1 Left 975723663 4:77271766-77271788 CCATGATGGGTGGGTTTGGGGCA 0: 1
1: 0
2: 3
3: 12
4: 211
Right 975723664 4:77271790-77271812 CGTGAATCTCCCTAGTGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975723663 Original CRISPR TGCCCCAAACCCACCCATCA TGG (reversed) Intronic
900105235 1:978245-978267 TGCCCCAGATACATCCATCATGG + Intronic
900837627 1:5017940-5017962 TGCTGAAAACCCTCCCATCATGG - Intergenic
901242218 1:7702152-7702174 TGACCCCAACCCACTCAGCAGGG + Intronic
902172121 1:14620524-14620546 TGCCCCAAATCTATCCAACAGGG - Intronic
903186423 1:21631907-21631929 TGCCCCATGACCTCCCATCACGG + Intronic
903367734 1:22815391-22815413 TTGCCCAAGGCCACCCATCAAGG + Intronic
904314785 1:29653188-29653210 TGCCCCAACCCCACCACTCCAGG + Intergenic
906028291 1:42694909-42694931 TGCCCCAACCCCAACCCTTAAGG - Intronic
907427810 1:54391917-54391939 TGCCCCACAGCCAGCCAGCAGGG + Intronic
910251971 1:85207489-85207511 TACCCCAAAACCACTGATCATGG + Intergenic
910956405 1:92710869-92710891 TTCCCCAGTCCCACCCATTAGGG - Intronic
911263711 1:95718333-95718355 TGGCCCAAAGCCACCCAGCTGGG + Intergenic
913192436 1:116425012-116425034 TGCCACCAATCCACCCTTCACGG + Intergenic
915287364 1:154861569-154861591 TGCCCGAGCCCCTCCCATCATGG + Intronic
915363944 1:155303221-155303243 TGCCCCAAACCATCCCAAGATGG - Intergenic
916920445 1:169460687-169460709 TGCCACTTACCCACCCATCGTGG + Intergenic
920091301 1:203455150-203455172 TGCCCCAAACCCACCAAGGGCGG + Intergenic
920325326 1:205158729-205158751 TGCCCAAATTCTACCCATCATGG + Intronic
920338855 1:205262786-205262808 GTCCCCAACTCCACCCATCAGGG - Intronic
921094624 1:211875695-211875717 TCCCCCACTCCCACCCACCAGGG + Intergenic
922792345 1:228317326-228317348 TGCCCAGAGCCCACCCAGCATGG - Intronic
923046813 1:230361833-230361855 GGCCCCAAACCCAGGCCTCAGGG + Intronic
1063372232 10:5529410-5529432 TGCCCCAAACCCAGATGTCAAGG + Intergenic
1065656411 10:27956121-27956143 TACCCCTCACCAACCCATCATGG + Intronic
1068569058 10:58608227-58608249 TGCCCCAAAACCACCTATTTCGG + Intronic
1068962570 10:62880462-62880484 TGTCCCAGACCCTCCCATCTTGG + Intronic
1070595335 10:77829119-77829141 TGCCCCAGTCCCACCAATCGGGG + Intronic
1070813668 10:79310731-79310753 TCCCCCAAAACCGCCCATCAGGG - Intronic
1071771358 10:88732279-88732301 TGCCCCAAACACACCTATGGTGG - Exonic
1073082418 10:100868442-100868464 GGCCCCATACCCACCCACCCAGG - Intergenic
1073423842 10:103444356-103444378 GGCCCCAAACCCACCCCTTTTGG + Intronic
1073996948 10:109326222-109326244 TGCCCTAGTCCCACCCATTAAGG + Intergenic
1075009382 10:118854519-118854541 GACCCCAACCCCACCCACCAAGG - Intergenic
1077661760 11:4074707-4074729 TGCCCTTTACCCACCCGTCAAGG - Intronic
1077793773 11:5469405-5469427 AGTCCCAAAGCCCCCCATCAGGG + Intronic
1080166513 11:29243450-29243472 GGCACCAATCCCACCCATGAGGG - Intergenic
1080351814 11:31393503-31393525 GGCCCCAATCCTACCCATGAGGG - Intronic
1080616236 11:33947305-33947327 TCCCCCAAACCCACCCCCCTGGG + Intergenic
1080763744 11:35277066-35277088 TGCACCAACCCCACTCATGAGGG + Intronic
1081809430 11:45906785-45906807 TGCCCCAAGTCCAGCCTTCAGGG - Intronic
1082088866 11:48072371-48072393 GGCACCAACCCCACCCATGAGGG + Intronic
1082728555 11:56767310-56767332 TGCCCAAAACCCTCCCAAGATGG + Intergenic
1083263952 11:61537633-61537655 TGCCCCAGACCCTCCCACCATGG + Intronic
1087002732 11:93436952-93436974 TGCCCCAATTCCACCCTTCATGG - Intronic
1088695964 11:112366157-112366179 TTCCCCAACCCCTTCCATCAAGG - Intergenic
1088821552 11:113461426-113461448 TGCCTCCACCCCACACATCAGGG + Intronic
1089762689 11:120739971-120739993 TGCCCCAACCTCATCCACCAGGG + Intronic
1090550767 11:127817428-127817450 AGCACCAATCCCACCCATGAGGG - Intergenic
1091385301 12:90967-90989 TGCCCCATCCCCACCCATCTTGG - Intronic
1093722762 12:22463442-22463464 GGCACCAATCCCACCCATAAGGG - Intronic
1093755253 12:22845257-22845279 TGCCCCCAACCCATCTATTATGG - Intergenic
1095748479 12:45685834-45685856 AGCCTCAAAGCCACCCACCAAGG + Intergenic
1096073748 12:48789446-48789468 GCCCGCAAACCCACCCCTCACGG + Intergenic
1096079570 12:48824740-48824762 TCCCCCCAACCCACCCATTTTGG + Intronic
1097749000 12:63331189-63331211 GGCCCAAAACCCACTCATCTGGG - Intergenic
1099023693 12:77438680-77438702 CACCCCAAACACACTCATCATGG - Intergenic
1099513937 12:83571993-83572015 GGCACCAATCCCACCCATGAAGG + Intergenic
1099933644 12:89100955-89100977 TGCAACAAACCAACCCATGAAGG - Intergenic
1101422348 12:104559978-104560000 TGCTCAAAAGCCACCCTTCAGGG - Intronic
1101504869 12:105337020-105337042 TGCCCCAAACAAAACCAGCACGG + Intronic
1104895787 12:132163038-132163060 TTCCCCAAACCCTCCCATTTGGG + Intergenic
1111696750 13:91633860-91633882 TTTTCCAAAACCACCCATCAGGG - Intronic
1112005706 13:95251951-95251973 TCCCACAAACCCACCCAGGATGG + Intronic
1113066551 13:106378702-106378724 AGCACCAATCCCACCCATGAGGG - Intergenic
1114533020 14:23407191-23407213 TGCCCCAAAGTCAGCCATCTGGG + Exonic
1114569027 14:23652944-23652966 GGCCCTAATCCCACCCATCAGGG + Intergenic
1114836253 14:26205600-26205622 TGCACAAAAACCACCCATCCTGG - Intergenic
1114947891 14:27709782-27709804 TGCAGCAAATCCATCCATCAGGG + Intergenic
1117547558 14:56805547-56805569 TGCTCCAAACCCACCCACCAAGG - Exonic
1118886436 14:69870661-69870683 TACACCAATCCCACCCATGAAGG - Intronic
1119057523 14:71438329-71438351 TGTCCCCAACACACTCATCAAGG - Intronic
1120111866 14:80566681-80566703 TGCTCCAATGCCACCCATCCTGG - Intronic
1121718310 14:96091716-96091738 TGCCCCAGCCCCACCCACCCTGG + Exonic
1123192298 14:106583020-106583042 TGGGCCAAACCCACCCATCAGGG - Intergenic
1126156716 15:45572944-45572966 TGACCCACACTGACCCATCAGGG + Intergenic
1129514899 15:76151446-76151468 AGCCCCCAACCCACCCTCCAGGG + Intronic
1130089998 15:80812886-80812908 TGACCCAAACCCTTCCAACAGGG - Intronic
1130963525 15:88680860-88680882 CCCTCCAAAACCACCCATCATGG - Intergenic
1131188558 15:90294871-90294893 TGCCCCACCCCCACCCTTCTTGG - Intronic
1132555184 16:569143-569165 TCCCCCAGACCCTCCCAGCACGG - Exonic
1137430379 16:48413630-48413652 TGCCCCCACACCTCCCATCAAGG + Intronic
1138576099 16:57908259-57908281 TGCCCCAACCTCAGCCATCATGG - Intronic
1140823533 16:78684654-78684676 TCCCCCAACCCCATCCATGAGGG - Intronic
1148462213 17:47845346-47845368 TGCCCCCAACCCTCTCAGCAAGG + Exonic
1150443545 17:65210834-65210856 TCTCCCAAGCCCACTCATCAGGG + Intronic
1152499430 17:80698062-80698084 TGCCCCGCACCCACCCGTCTGGG - Intronic
1152587296 17:81194719-81194741 TGCCCCAACCACCCCCGTCACGG - Intronic
1152619379 17:81354354-81354376 TGCCCCACATCCACCCATCCTGG - Intergenic
1153389171 18:4534764-4534786 GGCCTGAAACCCACCCTTCATGG + Intergenic
1154080228 18:11248829-11248851 TGCCCCCAGCCCGCCAATCAAGG - Intergenic
1156024057 18:32631433-32631455 GGCCCCAGACCCATCCATCTGGG + Intergenic
1157087190 18:44593033-44593055 TCCCCTAAACCAACACATCAGGG - Intergenic
1157485287 18:48082731-48082753 GGGCCCATACCCACCCAGCAAGG - Intronic
1157716959 18:49894406-49894428 TGCCCCAAACCTGAGCATCAGGG - Intronic
1159002843 18:62988546-62988568 TGTCCCAAACACCCCCATGAGGG + Intergenic
1160939656 19:1614341-1614363 TCCCCCAAAGCCCCCCGTCAGGG - Intronic
1162901371 19:13796885-13796907 TGGCCCAAACCCATCCGTCCAGG - Intronic
1165063368 19:33215755-33215777 TGCCCCACACTCACCCAGCCAGG + Exonic
1165391914 19:35543743-35543765 TGCCCCCTACTCAGCCATCAAGG + Exonic
1166580606 19:43895273-43895295 TGCCCCAAACCATCCCAGGATGG - Intronic
1167413745 19:49360109-49360131 TCCCCCAAACCCCACCCTCAAGG + Intronic
927972022 2:27311868-27311890 CACCCCTACCCCACCCATCAAGG - Intronic
930886855 2:56335920-56335942 AGCACCAATCCCACCCATGAGGG + Intronic
1169035982 20:2452390-2452412 AGCTCCAAATCCACCCTTCAGGG - Intergenic
1169257426 20:4109917-4109939 TGCCCCTCACCCACCCACCCAGG - Intergenic
1169954059 20:11081903-11081925 TGACCCAAGCCCACCCCTCCAGG - Intergenic
1171288937 20:23968954-23968976 AGCCCCAAACCCTCCCATGATGG + Intergenic
1174720002 20:52801443-52801465 TGCCACAAACCAAACCCTCAGGG - Intergenic
1182321175 22:29479461-29479483 CCCCCCAACCCCACCCATCCGGG + Intergenic
1183695545 22:39419893-39419915 TGCCCCAAACCAACCTCTCTGGG - Intronic
1183697506 22:39431483-39431505 TGCCCCAGACCGGCCCACCAGGG + Exonic
1184019758 22:41813154-41813176 TCCACCAAACCCACCAAGCAAGG - Intronic
1184560726 22:45261488-45261510 TCCCCAGAACCCAGCCATCAAGG - Intergenic
950304893 3:11910044-11910066 TGCCCCATCAACACCCATCAGGG + Intergenic
950523059 3:13507806-13507828 TGCCCGGAACCCACCCCTCCAGG + Intergenic
953273388 3:41469097-41469119 TGCCCCAAAGCCTCACATCCAGG + Intronic
953413055 3:42701047-42701069 TGCCCCCACCCCACCCATCAAGG + Intronic
953910349 3:46889658-46889680 CTCCCCCAACCCAGCCATCATGG - Intronic
954371236 3:50170526-50170548 TTCCCCCAACCCATCCTTCATGG - Intronic
954806306 3:53222873-53222895 TGCCCTACACACACCCATCTTGG + Intergenic
955195547 3:56801989-56802011 CGCCCCCTCCCCACCCATCAAGG - Intronic
956489146 3:69753042-69753064 TGCAGCAGACCCTCCCATCATGG + Intronic
957878123 3:86175320-86175342 TGCCCCAAACCATCCCAAGATGG - Intergenic
962193462 3:133335980-133336002 TAGCCGACACCCACCCATCAAGG + Intronic
963064931 3:141256021-141256043 TGGCCCCATCCCATCCATCAGGG - Intronic
963280266 3:143377751-143377773 AGCTCCAAACCAAACCATCAAGG + Intronic
963850735 3:150208012-150208034 TTCCCCAAACTCACTCACCAGGG - Intergenic
968442190 4:629592-629614 TGCCCCAAAACACCTCATCACGG + Intronic
969293260 4:6253880-6253902 GGCCCCCAAGCCACCCAGCAGGG + Intergenic
973665565 4:53155311-53155333 TGCACCAGTCCCACCCATGAGGG - Intronic
975723663 4:77271766-77271788 TGCCCCAAACCCACCCATCATGG - Intronic
977392498 4:96429419-96429441 TTCCCAAAACCCACCTGTCAGGG + Intergenic
979413500 4:120407050-120407072 TGCCTGAGACTCACCCATCAGGG - Intergenic
984634264 4:182093739-182093761 TGCTCAAAAACCACCCACCAGGG + Intergenic
985685789 5:1280865-1280887 TCCCCCAAAACCACCCATGGGGG + Intronic
986912222 5:12572399-12572421 TGGCACAAATCCACCCATGACGG + Intergenic
987237539 5:15958060-15958082 TGCCTTAATCCCACCCATGAGGG + Intergenic
987266560 5:16262284-16262306 AGCCTCAGAACCACCCATCAGGG + Intergenic
987537337 5:19206324-19206346 TGCCTCAAACCCAGGCATCCAGG + Intergenic
987979217 5:25058970-25058992 TGTCCCAAACTTACCCCTCAGGG - Intergenic
988557786 5:32253062-32253084 TGCCCCCACCCCACCCACGAGGG + Intronic
988844645 5:35115721-35115743 TGCCCCATACCCACCCAGGGTGG - Intronic
995063656 5:107837837-107837859 GGCCCCAAAGCCAGGCATCAAGG - Intergenic
995556588 5:113336150-113336172 GGCACCAATCCCACCCATGAGGG + Intronic
996462097 5:123757423-123757445 CTCCCCAAACCCACCCTTCCAGG + Intergenic
996815957 5:127572671-127572693 CGCCCCCACCCCACCCACCATGG - Intergenic
998281187 5:140808931-140808953 TGGCCCACACCCACCGACCATGG - Exonic
999820119 5:155219064-155219086 TGGCCCAAACCCCTACATCATGG + Intergenic
999961564 5:156761381-156761403 TGCTACAAACCAACCAATCACGG - Intronic
1000199603 5:158995127-158995149 TTCCCCAAATTCTCCCATCAAGG - Intronic
1001560845 5:172668032-172668054 TGCTCCAAAGCCACTCATCAGGG + Intronic
1003058632 6:2844485-2844507 GGCCCAAATCCCACCCATGACGG + Intergenic
1006318999 6:33308461-33308483 AGCCCCTAACCCACCCTTCCAGG + Intronic
1007771244 6:44194225-44194247 TTCCCCAAACCCACCATTCCAGG + Intergenic
1011323468 6:86122763-86122785 TACCCCAAACTCACACATAAAGG - Intergenic
1016311619 6:142739450-142739472 TGCCCCAAGACCACACAGCAAGG + Intergenic
1016845161 6:148562125-148562147 TGACTCAAGCCCACCCAACAGGG + Intergenic
1018428169 6:163701640-163701662 TGCCCCAAACCCTCACTGCAGGG + Intergenic
1019304102 7:324372-324394 AGCCCCAAACCCACCTCTGATGG + Intergenic
1019445066 7:1066820-1066842 TGCCCCAAACCCTCACCTCTGGG - Intronic
1019445079 7:1066871-1066893 TGCCCCAAACCCTCACCTCTGGG - Intronic
1019445091 7:1066921-1066943 TGCCCCAAACCCTCACCTCTGGG - Intronic
1019445103 7:1066971-1066993 TGCCCCAAACCCTCACCTCTGGG - Intronic
1019445125 7:1067071-1067093 TGCCCCAAACCCTCACCTCTGGG - Intronic
1019445138 7:1067122-1067144 TGCCCCAAACCCACACCTCTGGG - Intronic
1019445150 7:1067172-1067194 TGCCCCAAACCCTCACCTCTGGG - Intronic
1019445160 7:1067221-1067243 TGCCCCAAACCCTCACTTCTGGG - Intronic
1019445172 7:1067271-1067293 TGCCCCAAACCCGCACCTCTGGG - Intronic
1019445183 7:1067318-1067340 TGCCCCAAACCCTCACCTCTGGG - Intronic
1019445193 7:1067367-1067389 TGCCCCAAACCCTCACCTCTGGG - Intronic
1019445204 7:1067416-1067438 TGCCCCAAACCCTCACCTCTGGG - Intronic
1019445226 7:1067513-1067535 TGCCCCAAACCCTCACCTCTGGG - Intronic
1019445236 7:1067562-1067584 TGCCCCAAACCCTCACCTCTGGG - Intronic
1019445247 7:1067611-1067633 TGCCCCAAACCCTCACCTCTGGG - Intronic
1019445269 7:1067708-1067730 TGCCCCAAACCCTCACCTCTGGG - Intronic
1019445279 7:1067757-1067779 TGCCCCAAACCCTCACCTCTGGG - Intronic
1019445290 7:1067806-1067828 TGCCCCAAACCCTCACCTCTGGG - Intronic
1019445301 7:1067855-1067877 TGCCCCAAACCCTCACCTCTGGG - Intronic
1019445312 7:1067904-1067926 TGCCCCAAACCCTCACCTCTGGG - Intronic
1020911975 7:14142223-14142245 TCCCACTAACCCACCCAGCAGGG - Intergenic
1022528900 7:31054784-31054806 TGCCTGAGACCCACCCACCATGG + Intronic
1023385425 7:39652210-39652232 GGCACCAATCCCACCCATGAGGG + Intronic
1025191468 7:56898869-56898891 TGCCCCCAACCCAGCCAGGAGGG + Intergenic
1025263787 7:57439633-57439655 TGCCCCACCCCCACCCCACAGGG - Intergenic
1025680480 7:63678065-63678087 TGCCCCCAACCCAGCCAGGAGGG - Intergenic
1028484595 7:91344020-91344042 CCCCCCAAAACCACCCACCAAGG + Intergenic
1029258144 7:99283366-99283388 TGGACCAGAGCCACCCATCAGGG - Intergenic
1029851486 7:103465974-103465996 TGCCCCAATCCCAAGCAGCATGG + Intergenic
1030106346 7:105990555-105990577 GGCCCCAAACCCACCCCAGAGGG - Intronic
1033050643 7:138001500-138001522 TGCCCCAAACCCTGCCTTCCCGG + Intronic
1033659023 7:143391146-143391168 TGCCTCCATCCCACCCATGAGGG - Exonic
1033763557 7:144463193-144463215 TGCCCCAAAACCATCCCACAGGG + Intronic
1034201321 7:149284847-149284869 GGCCCCAAACTCTCCCAGCAGGG + Exonic
1034815878 7:154171502-154171524 AGCCCCCTACCCACCCAGCAGGG - Intronic
1035353477 7:158263495-158263517 TGCCCCAAACCCAGGCAGCATGG - Intronic
1038223829 8:25636260-25636282 GCCCCCAAACCCAAGCATCATGG + Intergenic
1039017183 8:33163543-33163565 TGCTCCAAGCCCACCTAACAAGG + Intergenic
1039907234 8:41795745-41795767 TGCCCCCCACCCACCCTTCCTGG - Intronic
1045440090 8:102200595-102200617 TGACCCCAACCCAGGCATCATGG - Intergenic
1049228784 8:141471243-141471265 TGCCACACACTCACCCAGCACGG + Intergenic
1049328986 8:142039687-142039709 TCCCCCAACCCCAGCCATCCGGG + Intergenic
1049453543 8:142675451-142675473 TTCCCCAAGCCCACCCAGCTGGG - Intronic
1049751198 8:144285025-144285047 TGCCCCAAACCAACCCAGACCGG - Intronic
1051727145 9:20099870-20099892 TGCCCAAATCCCACCACTCATGG + Intergenic
1053493060 9:38525917-38525939 GGCCCAAAACCCATCCATGAGGG - Intergenic
1055771355 9:79720144-79720166 GGCTCCAACCCCACGCATCAAGG + Exonic
1057673298 9:97114830-97114852 GGCCCTAAACCCATCCATGAGGG - Intergenic
1057930910 9:99192071-99192093 GGCACCAATCCCACCCATTAGGG - Intergenic
1058129467 9:101233581-101233603 TGCACCAATCCCACCCATGAAGG - Intronic
1058136238 9:101310483-101310505 TGCCCTCAACCCACCCCCCAGGG + Intronic
1060236674 9:121868536-121868558 TGCTCAAAATCCAGCCATCATGG - Intronic
1060277214 9:122191399-122191421 TGCCCCAATTCCTTCCATCAGGG - Intronic
1061381806 9:130263253-130263275 AGCCACAAATCTACCCATCAAGG - Intergenic
1187415066 X:19086385-19086407 TGCCCCAAACCATGACATCAGGG + Intronic
1189428346 X:40923473-40923495 TGCCCCAAACACCCCCAACCAGG - Intergenic
1190034891 X:47012903-47012925 TACCCCAAACCCACCTACCTTGG + Intronic
1190582665 X:51903688-51903710 TGCCCCAACCCCACCGAGCCTGG - Intergenic
1190588121 X:51967659-51967681 GGCCCTAAACTCACCCTTCAGGG + Intergenic
1190929153 X:54933723-54933745 TGCCCCAACCCCACCAAGCCTGG - Intronic
1190969303 X:55333419-55333441 TGCCCAAAAGCCATCCCTCAAGG + Intergenic
1192899570 X:75481814-75481836 TGCATCAAAGCCACCCATAAAGG + Intronic
1193653890 X:84173912-84173934 TCTCCCAAACCAACCCATAAAGG + Intronic
1194005482 X:88486507-88486529 TGCCCCAAACTCCCCCACGATGG + Intergenic
1195609478 X:106849371-106849393 TTCCCCAAATTCTCCCATCAAGG + Intronic
1197054230 X:122097732-122097754 TGCACCATCCCCTCCCATCACGG + Intergenic
1199692004 X:150315673-150315695 TGCCCCACACCCACCACTTAGGG + Intergenic
1200801626 Y:7392497-7392519 TGGCCCAACCCCAGCCAACAGGG + Intergenic