ID: 975723968

View in Genome Browser
Species Human (GRCh38)
Location 4:77274380-77274402
Sequence CATTGTGAGCCATGGGTATA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 114}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975723961_975723968 15 Left 975723961 4:77274342-77274364 CCTAAGTTTTAGACACTTGGTAA 0: 1
1: 0
2: 0
3: 15
4: 181
Right 975723968 4:77274380-77274402 CATTGTGAGCCATGGGTATACGG 0: 1
1: 0
2: 1
3: 9
4: 114
975723958_975723968 25 Left 975723958 4:77274332-77274354 CCTATGGCCACCTAAGTTTTAGA 0: 1
1: 0
2: 2
3: 21
4: 210
Right 975723968 4:77274380-77274402 CATTGTGAGCCATGGGTATACGG 0: 1
1: 0
2: 1
3: 9
4: 114
975723959_975723968 18 Left 975723959 4:77274339-77274361 CCACCTAAGTTTTAGACACTTGG 0: 1
1: 0
2: 0
3: 8
4: 126
Right 975723968 4:77274380-77274402 CATTGTGAGCCATGGGTATACGG 0: 1
1: 0
2: 1
3: 9
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975723968 Original CRISPR CATTGTGAGCCATGGGTATA CGG Intronic
905776506 1:40671051-40671073 CATTGAGAGCTATGGGGATTTGG + Intergenic
908532828 1:65049812-65049834 CATTGCAAGCCCTGGGCATAGGG + Intergenic
908685289 1:66711649-66711671 CATTGTCATCCCTGGGCATAAGG + Intronic
908934975 1:69363715-69363737 AATTGTGAGCCAGGAGAATAGGG - Intergenic
909010112 1:70324928-70324950 CATTGTGAGCCAAAAGTAAATGG + Exonic
909231677 1:73099762-73099784 CATGGGGAGCCATGGGAGTAGGG + Intergenic
909979998 1:82087593-82087615 CAATGTCAGCCATGAGTATATGG + Intergenic
921981873 1:221267681-221267703 CATTGAGAGGCAATGGTATATGG + Intergenic
1063380453 10:5582284-5582306 CATGGTGAGCCATGGGCAACAGG + Intergenic
1063726943 10:8647718-8647740 CAGTGTGAGCGATGGGTTTGGGG + Intergenic
1065038441 10:21664723-21664745 TATTGTGAGCGGTGGGTATTAGG + Intronic
1065272173 10:24045760-24045782 CATCATGAAACATGGGTATATGG - Intronic
1067099622 10:43325144-43325166 CAGTGTGAGCCATGGGTGGTGGG + Intergenic
1067697600 10:48547268-48547290 CATTGTGTCCCATGGGAATCAGG - Intronic
1070149164 10:73795120-73795142 AATTGTGTGCTATGGGTATTGGG + Intronic
1071253061 10:83840616-83840638 CAATGCTAGCCATGGCTATAGGG + Intergenic
1072156878 10:92731557-92731579 CATTGTGTGCCATTGCCATATGG - Intergenic
1073351849 10:102825536-102825558 CATTGTGTGGGCTGGGTATAGGG - Intergenic
1076263306 10:129089488-129089510 CTTTGTGAGCCATGGGTCTAAGG - Intergenic
1079769086 11:24435965-24435987 CATGGTGAGCTCTAGGTATACGG - Intergenic
1083451959 11:62752242-62752264 CATTGTGAGCCTTGCGGATGTGG + Exonic
1086419779 11:86627345-86627367 CTTTCTGTACCATGGGTATAAGG + Intronic
1089031086 11:115330085-115330107 CATTTAGAGCCATGGGTTTCTGG + Intronic
1091325515 11:134684004-134684026 CTGTGTGGGCCATGGGTCTAAGG - Intergenic
1092040505 12:5379969-5379991 CATGGTGACTCATGGATATAGGG + Intergenic
1093542066 12:20299044-20299066 CATGGTGAGCCTTGGGGATTGGG + Intergenic
1097140556 12:56899497-56899519 CAGTTTGATACATGGGTATATGG + Intergenic
1101584386 12:106072032-106072054 CACTGTAAGATATGGGTATATGG - Intronic
1102157657 12:110743470-110743492 CATTGTGAGTGGTGGGTATATGG + Intergenic
1102730781 12:115107051-115107073 CATTTTGTGACATGTGTATACGG - Intergenic
1104728850 12:131094211-131094233 CACAGTGAGCCATGAGTATGAGG + Intronic
1106757318 13:32836080-32836102 CATAGTGAGCACTGGGTCTAGGG - Intergenic
1112213218 13:97402107-97402129 CGTTGTGAGCAAAGGGGATATGG - Intergenic
1116126025 14:40785695-40785717 CATTTTGGGCCATGGGTTTCAGG + Intergenic
1119688556 14:76652757-76652779 CATTGTGAACTATGGGTTTTGGG - Intergenic
1122850864 14:104529898-104529920 AAATCTGAGCAATGGGTATATGG + Intronic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1123480111 15:20623243-20623265 CATTGTCAGCCTTGGGCATGAGG + Intergenic
1123637896 15:22377121-22377143 CATTGTCAGCCTTGGGCATGAGG - Intergenic
1123827690 15:24100495-24100517 TATTATGAGCCATAAGTATAAGG - Intergenic
1123840972 15:24246811-24246833 AATTGAGAGTCATGGGAATATGG + Intergenic
1123842148 15:24259907-24259929 TATTATGAGCCATAAGTATAAGG - Intergenic
1123857171 15:24425965-24425987 TATTATGAGCCATAAGTATAAGG - Intergenic
1123861802 15:24476492-24476514 TATTATGAGCCATAAGTATAAGG - Intergenic
1125912717 15:43455912-43455934 CTTTGTGAGGCATGGGCAGAGGG + Exonic
1127866187 15:63035177-63035199 AACTGTGAGCCAAGGGTAGATGG + Intergenic
1131842597 15:96453393-96453415 CATTGTAAGATATAGGTATAGGG - Intergenic
1132302738 15:100786645-100786667 CATTCTGAGGAATGGGTTTAGGG - Intergenic
1136015866 16:27400637-27400659 CATTGTGTGCCAGGGTTTTAAGG - Intergenic
1136651253 16:31673502-31673524 CATGGTGAGCCTTGGGTGAAGGG + Intergenic
1142338651 16:89506979-89507001 CAGTGTCAGCCCTGGGTGTAGGG + Intronic
1143696506 17:8624195-8624217 CTTTGTGAGCCAATGGTAAATGG - Intronic
1148520246 17:48267110-48267132 CATTCAGAGCCCTGAGTATAGGG - Intronic
1152351864 17:79788583-79788605 TGTTGTGAGCCACTGGTATATGG - Intergenic
1153832141 18:8933251-8933273 CATTGTGAGGCAGGAGAATAGGG + Intergenic
1160150052 18:76391809-76391831 CATTGTGTGCTTTGGGGATAAGG + Intronic
1164040677 19:21490081-21490103 AATTGTGAGCTATGTTTATATGG - Intronic
1165382570 19:35491610-35491632 CTGTGTGAGCCATGGTTCTAGGG - Intronic
1165978093 19:39694560-39694582 CATTGACAGCCATGTGTGTAGGG + Intergenic
1167699022 19:51031555-51031577 CATTGTGGGTCATGGGTCTGGGG - Intronic
926584337 2:14669546-14669568 CAATGTAGGCCAAGGGTATATGG + Intergenic
926593999 2:14770220-14770242 CAATGAGAGGCATGGCTATAAGG + Intergenic
926897942 2:17715275-17715297 CATTGTATCCTATGGGTATAGGG - Intronic
927631791 2:24780883-24780905 GATAGTGAGCCATGGCAATATGG + Intergenic
928928153 2:36598721-36598743 CATTGTAAGCCCTGTGTATGGGG - Intronic
929024603 2:37587649-37587671 TATTGAGGGCCTTGGGTATATGG + Intergenic
931228086 2:60351351-60351373 CATTGTGTGCTATGGGGATGAGG + Intergenic
934989755 2:98912950-98912972 GATTGTGTGCTATGAGTATATGG - Intronic
936858363 2:116987100-116987122 CATTTTGGGCCATGGGTTTCAGG - Intergenic
938866705 2:135429456-135429478 AATTGTGTGCCATGGGGGTATGG - Intronic
941864131 2:170316110-170316132 CACTGTGAGATATGGGAATATGG - Intronic
1169037159 20:2462903-2462925 CATTGGGAGCCCTGGGTGTTAGG - Intronic
1170472697 20:16684158-16684180 CAATGTGAGCCATGGATTTTGGG + Intergenic
1173544805 20:43887310-43887332 CATTCTGATCCATGGTAATAAGG - Intergenic
1174691573 20:52511632-52511654 CAAGGTGAGCCATGGAGATATGG - Intergenic
1175622681 20:60463408-60463430 CTTTGTGTGCCATGTGTTTAAGG - Intergenic
1181713992 22:24711045-24711067 CATTTTGAGTTATGGTTATATGG - Intergenic
1184128693 22:42504531-42504553 CATTCTCAGGCATGGGTAGATGG + Intergenic
1184137488 22:42557846-42557868 CATTCTCAGGCATGGGTAGATGG + Intronic
949860048 3:8496940-8496962 CATTGTGAGCCATGATTATTGGG + Intergenic
950437894 3:12991725-12991747 CAGTTTCAGCCATTGGTATAAGG - Intronic
952845971 3:37688609-37688631 CATGGTGAGCCAGGGGTCTGGGG - Intronic
953777077 3:45828794-45828816 CATTGTCAGCCCTGGGTACGTGG + Intronic
955019626 3:55106795-55106817 TTTGGTGAGCCAAGGGTATATGG - Intergenic
964952135 3:162308458-162308480 CAGTGTGAGGCCTGGGTTTATGG + Intergenic
971873735 4:32276666-32276688 CATTTAGGGCCATGGGTCTAGGG + Intergenic
975723968 4:77274380-77274402 CATTGTGAGCCATGGGTATACGG + Intronic
975732500 4:77351467-77351489 CAATGAGAGCCATGGGTAGAGGG + Intronic
977077264 4:92471194-92471216 CATTCTGAGGTATTGGTATAAGG + Intronic
979070524 4:116198732-116198754 CATTATCATCAATGGGTATATGG - Intergenic
979130574 4:117039516-117039538 CATTGTGAGGAGTGGTTATAAGG - Intergenic
981351310 4:143733098-143733120 AATTGTGAGTCATGGGGATTTGG + Intergenic
982912128 4:161156124-161156146 TATTGTGAGGAATTGGTATAAGG + Intergenic
983741148 4:171136033-171136055 CATAGTGTGCAATGGGTCTACGG + Intergenic
986030305 5:3887225-3887247 CAATGTTGGCCATGGGCATATGG - Intergenic
986093057 5:4529797-4529819 CATTGTGAGTCTGTGGTATAAGG + Intergenic
986162837 5:5246882-5246904 CATTGTCACACATGGGCATATGG - Intronic
987290948 5:16507698-16507720 CCCTTTCAGCCATGGGTATATGG - Intronic
991622599 5:68560391-68560413 CCTTATGAGGCATGGGTATATGG - Intergenic
992645998 5:78811481-78811503 GATTATGAGACAAGGGTATAAGG + Intronic
996808384 5:127483826-127483848 CATTGTGAATCATAGGTACAAGG + Intergenic
998410855 5:141910212-141910234 CAATGGAAGCCATGGGGATAAGG - Intergenic
1000623268 5:163508941-163508963 CATAGTAACCCAGGGGTATAAGG + Intronic
1004970743 6:20907623-20907645 CACTGTGAGCCATGGGACTAAGG + Intronic
1006247132 6:32747145-32747167 CATTCTGAGCCAAGGGCAGAGGG - Exonic
1006833527 6:36983460-36983482 ATTTGGGAGCCATGGGGATATGG - Intronic
1008706524 6:54167117-54167139 TATTGTGAGTCAGGGGTATAGGG - Intronic
1009447865 6:63764583-63764605 CATTGTGAGCTCTGTCTATAAGG - Intronic
1010235286 6:73570040-73570062 GTCTGTGAGCCATGGGTATTAGG + Intergenic
1010584531 6:77642063-77642085 CACTATGGGCCATGGGTATCAGG + Intergenic
1014039569 6:116810382-116810404 CATTGTGAACCATGTTTAGATGG + Intronic
1021796234 7:24257261-24257283 CAATTAGAGCCATGGGTATTTGG + Intergenic
1024181592 7:46900781-46900803 CATTGTGAGTCATGGGATAAAGG - Intergenic
1033035826 7:137875383-137875405 TAGTGTAAGCCATGGGTACATGG + Exonic
1034738664 7:153453365-153453387 CATTGGAAGCCATGTGTACATGG + Intergenic
1040645818 8:49395410-49395432 GATTTTGAACCATGGGTATTAGG - Intergenic
1043225885 8:77729483-77729505 CAATGTGACTCATGGGTTTAGGG + Intergenic
1043877453 8:85501709-85501731 CATTTTGAGCCAGGGGTGCAAGG + Intergenic
1044021741 8:87113202-87113224 CAGTGTGAGCCATGGGCAGTAGG + Intronic
1047111806 8:121798617-121798639 AATTGTAAGTCATGTGTATATGG - Intergenic
1049403475 8:142441269-142441291 CTTAGTGAGCCATAGGAATAGGG - Intergenic
1051805326 9:20986443-20986465 GATTGTGAGCCATGCCAATACGG + Exonic
1186215033 X:7290572-7290594 CATTCAGAGCCATGTGTATATGG + Intronic
1190681895 X:52833332-52833354 AATGTTGAGCCATGGGTTTAAGG - Intergenic
1200791020 Y:7299037-7299059 CCTTGGGGTCCATGGGTATATGG - Intergenic