ID: 975726191

View in Genome Browser
Species Human (GRCh38)
Location 4:77294066-77294088
Sequence TTATGCCACCTTGATCATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 912
Summary {0: 1, 1: 0, 2: 0, 3: 37, 4: 874}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975726191_975726195 20 Left 975726191 4:77294066-77294088 CCTCAATGATCAAGGTGGCATAA 0: 1
1: 0
2: 0
3: 37
4: 874
Right 975726195 4:77294109-77294131 TATTCTGGGCTTGAATCTTATGG No data
975726191_975726193 5 Left 975726191 4:77294066-77294088 CCTCAATGATCAAGGTGGCATAA 0: 1
1: 0
2: 0
3: 37
4: 874
Right 975726193 4:77294094-77294116 GATGGCTAATGACTCTATTCTGG 0: 1
1: 0
2: 0
3: 3
4: 68
975726191_975726196 21 Left 975726191 4:77294066-77294088 CCTCAATGATCAAGGTGGCATAA 0: 1
1: 0
2: 0
3: 37
4: 874
Right 975726196 4:77294110-77294132 ATTCTGGGCTTGAATCTTATGGG 0: 1
1: 0
2: 1
3: 24
4: 255
975726191_975726194 6 Left 975726191 4:77294066-77294088 CCTCAATGATCAAGGTGGCATAA 0: 1
1: 0
2: 0
3: 37
4: 874
Right 975726194 4:77294095-77294117 ATGGCTAATGACTCTATTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975726191 Original CRISPR TTATGCCACCTTGATCATTG AGG (reversed) Intronic
900037028 1:422230-422252 TTCTCCCACCTTGATTTTTGTGG - Intergenic
900058658 1:657971-657993 TTCTCCCACCTTGATTTTTGTGG - Intergenic
901598553 1:10404353-10404375 TTCTGCCACCCTGATCTCTGTGG + Intronic
902133918 1:14288023-14288045 TGAAGCCAACTTGATCATGGTGG + Intergenic
902141234 1:14357767-14357789 TAAAGCCACCTTGATCATGGTGG + Intergenic
902966263 1:20006023-20006045 TGAAGCCAACTTGATCATGGTGG - Intergenic
905437930 1:37971653-37971675 TGAAGCCAACTTGATCATGGTGG - Intronic
905963190 1:42063021-42063043 TGAAGCCAACTTGATCATGGTGG - Intergenic
906565270 1:46795943-46795965 TGAAGCCAACTTGATCATGGTGG + Intronic
906883485 1:49618767-49618789 TGAAGCCAACTTGATCATGGTGG - Intronic
908178068 1:61575721-61575743 TGATGCCAACTTGATCGTGGTGG + Intergenic
908601074 1:65740555-65740577 TGAAGCCAACTTGATCATGGTGG + Intergenic
908813211 1:68005423-68005445 TGAAGCCAACTTGATCATGGTGG + Intergenic
908879300 1:68712448-68712470 TGAAGCCAACTTGATCATGGTGG - Intergenic
908910591 1:69068354-69068376 TAAAGCCACATTGATCATGGTGG + Intergenic
908937328 1:69391788-69391810 TGAAGCCAACTTGATCATGGTGG + Intergenic
908956190 1:69631479-69631501 TGATGTCATCTTGATGATTGTGG + Intronic
909181313 1:72427353-72427375 TGAAGCCAACTTGATCATGGTGG + Intergenic
909672750 1:78207226-78207248 TGAAGCCAACTTGATCATGGTGG - Intergenic
909897407 1:81089700-81089722 TTATTCCTGCTTGATCCTTGAGG + Intergenic
910308106 1:85789895-85789917 TGAAGCCAACTTGATCATGGTGG + Intronic
910822073 1:91361849-91361871 TGAAGCCAACTTGATCATGGTGG - Intronic
910912882 1:92256551-92256573 TGAAGCCAACTTGATCATGGTGG - Intronic
910954409 1:92686194-92686216 TGAAGCCAACTTGATCATGGTGG - Intronic
911021270 1:93390358-93390380 TGAAGCCAACTTGATCATGGTGG + Intergenic
911202935 1:95064625-95064647 TGAAGCCAACTTGATCATGGTGG + Intronic
911212855 1:95160846-95160868 TGAAGCCAACTTGATCATGGTGG + Intronic
911240198 1:95456936-95456958 TGAAGCCAACTTGATCATGGTGG - Intergenic
911265593 1:95739451-95739473 TAAAGCCCACTTGATCATTGTGG + Intergenic
911560689 1:99402167-99402189 TGAAGCCCACTTGATCATTGTGG + Intergenic
911690157 1:100823857-100823879 TGATGCCAACTTGATCGTGGTGG - Intergenic
911827556 1:102506519-102506541 TGAAGCCAACTTGATCATGGTGG + Intergenic
912264825 1:108146759-108146781 TGAAGCCAACTTGATCATGGTGG + Intronic
912270685 1:108205761-108205783 TGAAGCCAACTTGATCATGGTGG + Intergenic
912592307 1:110835892-110835914 TGAAGCCAACTTGATCATGGTGG - Intergenic
912640322 1:111339001-111339023 TGATGCCCACTTGATCATGGTGG - Intergenic
913425605 1:118725549-118725571 TGAAGCCAACTTGATCATGGTGG + Intergenic
913987603 1:143579605-143579627 TGAAGCCAACTTGATCATGGTGG + Intergenic
914208013 1:145551693-145551715 TGAAGCCAACTTGATCATGGTGG + Intergenic
914369843 1:147014283-147014305 TGAAGCCAACTTGATCATGGTGG - Intergenic
915651876 1:157319080-157319102 TGAAGCCAACTTGATCATGGTGG - Intergenic
915805238 1:158841701-158841723 TTAGGCCACTTTGGTCATAGTGG + Intronic
916379926 1:164198271-164198293 TGAAGCCAACTTGATCATGGTGG - Intergenic
916534626 1:165691867-165691889 TGAAGCCAACTTGATCATGGTGG - Intronic
916545739 1:165802371-165802393 TGAAGCCAACTTGATCATGGTGG - Intronic
917172474 1:172192339-172192361 TGAAGCCAGCTTGATCATGGTGG + Intronic
917290263 1:173464957-173464979 TGAAGCCAACTTGATCATGGTGG - Intergenic
917463992 1:175258441-175258463 TGAAGCCAACTTGATCATGGTGG + Intergenic
917581878 1:176387114-176387136 TGATGCCAACTTGATCATGGTGG + Intergenic
918079971 1:181199393-181199415 TGAAGCCAACTTGATCATGGTGG - Intergenic
918088691 1:181268211-181268233 TGAAGCCAACTTGATCATGGTGG + Intergenic
918324812 1:183399709-183399731 TGAAGCCAACTTGATCATGGTGG - Intronic
918713345 1:187758868-187758890 TGAAGCCCACTTGATCATTGTGG + Intergenic
918717319 1:187806283-187806305 TGAAGCCCACTTGATCATTGTGG + Intergenic
918919588 1:190691248-190691270 TGAAGCCAACTTGATCATGGTGG - Intergenic
919065202 1:192685297-192685319 TGAAGCCAACTTGATCATGGTGG + Intergenic
919489859 1:198193606-198193628 TGAAGCCAACTTGATCATGGTGG - Intronic
919602249 1:199636641-199636663 TGAAGCCAACTTGATCATGGTGG - Intergenic
919603504 1:199651112-199651134 TGAAGCCAACTTGATCATTGTGG - Intergenic
920625372 1:207592241-207592263 TGAAGCCAGCTTGATCGTTGTGG - Intronic
920992822 1:210956247-210956269 TGAAGCCAACTTGATCATGGTGG + Intronic
920996717 1:210999811-210999833 TGAAGCCAACTTGATCATAGTGG - Intronic
921004500 1:211079614-211079636 TTAAGCCAACTTGATCATGCTGG - Intronic
921784771 1:219216978-219217000 TTATTCCATCTTGATCATATTGG + Intergenic
922092296 1:222408147-222408169 TGAAGCCAACTTGATCATGGTGG - Intergenic
924584097 1:245346483-245346505 CCATGCCACCTTGTTCCTTGTGG + Intronic
1064370143 10:14744690-14744712 TGAAGCCAACTTGATCATGGTGG + Intronic
1064431381 10:15273681-15273703 TGAAGCCAACTTGATCATGGTGG - Intronic
1065154865 10:22859064-22859086 TGAAGCCAACTTGATCATGGTGG - Intergenic
1065427781 10:25623323-25623345 TGAAGCCAACTTGATCATGGTGG - Intergenic
1066051477 10:31640153-31640175 TGAAGCCAACTTGATCATGGTGG + Intergenic
1066146350 10:32562448-32562470 TGAAGCCAACTTGATCATGGTGG - Intronic
1066163332 10:32758396-32758418 TGAAGCCAACTTGATCATGGTGG - Intronic
1066608036 10:37203282-37203304 TGAAGCCAACTTGATCATGGTGG - Intronic
1066665522 10:37779311-37779333 TGATGCCCACTTGATCATGGTGG - Intronic
1066806685 10:39263062-39263084 TGAAGCCAACTTGATCATGGTGG - Intergenic
1066965445 10:42260117-42260139 GGATGCCAACTTGATCATGGTGG + Intergenic
1067331762 10:45328981-45329003 TGAAGCCAACTTGATCATGGTGG + Intergenic
1068409674 10:56638757-56638779 TGACGCCAACTTGATCATGGTGG + Intergenic
1068413518 10:56687598-56687620 TGAAGCCCACTTGATCATTGTGG - Intergenic
1068445909 10:57122887-57122909 TTTTGCCTCCTTGATCTTTCTGG + Intergenic
1068490683 10:57719884-57719906 TGAAGCCAACTTGATCATGGTGG - Intergenic
1068493219 10:57750585-57750607 TGAAGCCAACTTGATCATGGTGG + Intergenic
1068516667 10:58033687-58033709 TGAAGCCAACTTGATCATGGTGG + Intergenic
1068535157 10:58233469-58233491 TGAAGCCAACTTGATCATGGTGG - Intronic
1068575916 10:58684219-58684241 TGAAGCCAACTTGATCATGGTGG + Intronic
1068580996 10:58739426-58739448 TGAAGCCAACTTGATCATGGTGG + Intronic
1069193994 10:65526011-65526033 TGAAGCCAACTTGATCATGGTGG - Intergenic
1071004557 10:80867538-80867560 TCAAGCCAACTTGATCATGGTGG + Intergenic
1071035124 10:81235649-81235671 TGAAGCCAACTTGATCATGGTGG + Intergenic
1071210807 10:83339717-83339739 TGAAGCCAACTTGATCATGGTGG + Intergenic
1071244092 10:83743561-83743583 TGAAGCCAACTTGATCATGGTGG + Intergenic
1071927255 10:90424436-90424458 TGAAGCCAACTTGATCATGGTGG + Intergenic
1072091574 10:92133812-92133834 TGAAGCCAACTTGATCATGGTGG - Intronic
1072515898 10:96182670-96182692 TGAAGCCAACTTGATCATGGTGG + Intronic
1072778914 10:98229925-98229947 TGAAGCCAACTTGATCATGGTGG + Intronic
1072928874 10:99642910-99642932 TGAAGCCAACTTGATCATGGTGG + Intergenic
1073951995 10:108820375-108820397 TTATGCTGCCATCATCATTGTGG - Intergenic
1074668151 10:115755513-115755535 TGAAGCCAACTTGATCATGGTGG + Intronic
1075858376 10:125651293-125651315 TGAAGCCAACTTGATCATGGTGG - Intronic
1076192052 10:128489917-128489939 TCATGCCACCATGTTCACTGAGG - Intergenic
1076963754 11:60152-60174 TTCTCCCACCTTGATTTTTGTGG - Intergenic
1077655274 11:4013068-4013090 TGAAGCCAACTTGATCATGGTGG + Intronic
1078796477 11:14597089-14597111 TGAAGCCAACTTGATCATGGTGG + Intronic
1078972806 11:16434140-16434162 TTATGCTACCTTTATGATTGTGG - Intronic
1079462176 11:20691628-20691650 TGAAGCCAACTTGATCATGGTGG + Intronic
1079587714 11:22146695-22146717 TGAAGCCAACTTGATCATGGTGG + Intergenic
1079683274 11:23324759-23324781 TGAAGCCAACTTGATCATTGTGG - Intergenic
1079720247 11:23802321-23802343 AAATGCCTCCTTGATGATTGGGG + Intergenic
1080031787 11:27669056-27669078 TGAAGCCAACTTGATCATGGTGG - Intronic
1080079652 11:28201235-28201257 TGAAGCCAACTTGATCATGGTGG + Intronic
1080710398 11:34741576-34741598 TGAAGCCAACTTGATCATGGTGG - Intergenic
1080933575 11:36838633-36838655 TTGTGCTACCCTGATCAATGTGG - Intergenic
1080977468 11:37360106-37360128 TAAAGCCAACTTGATCATGGTGG - Intergenic
1081079865 11:38728463-38728485 TGAAGCCAACTTGATCATGGGGG + Intergenic
1081269493 11:41065917-41065939 TTATCCAACTTTGATCTTTGAGG - Intronic
1081317397 11:41647412-41647434 TGAAGCCAACTTGATCATTGTGG + Intergenic
1081405384 11:42691795-42691817 TGAAGCCAACTTGATCATGGTGG - Intergenic
1082196259 11:49310089-49310111 TTAAGCCAACTTGATCTTGGTGG + Intergenic
1082269327 11:50152637-50152659 TGAAGCCAACTTGATCATGGTGG - Intergenic
1082945435 11:58753628-58753650 TGAAGCCAACTTGATCATGGTGG - Intergenic
1083086665 11:60154875-60154897 TGAAGCCCCCTTGATCATGGTGG - Intergenic
1083345638 11:61989090-61989112 TGAAGCCAACTTGATCATGGTGG - Intergenic
1083368694 11:62160574-62160596 TGAAGCCAACTTGATCATGGTGG - Intergenic
1083515885 11:63258160-63258182 TGAAGCCAACTTGATCATGGTGG + Intronic
1083532203 11:63434084-63434106 TGAAGCCAACTTGATCATGGTGG - Intergenic
1085857021 11:80186580-80186602 TTATTCAACCTTCATCATCGTGG + Intergenic
1086044696 11:82519113-82519135 TGAAGCCCACTTGATCATTGTGG + Intergenic
1086132472 11:83415331-83415353 TGAAGCCAACTTGATCATGGTGG + Intergenic
1086391250 11:86366160-86366182 TGAAGCCAACTTGATCATGGTGG - Intergenic
1087231316 11:95668827-95668849 CTTTGCCACCCTGATCATTTTGG + Intergenic
1087251696 11:95907660-95907682 GAAAGCCTCCTTGATCATTGTGG - Intronic
1087311459 11:96548810-96548832 TGAAGCCAACTTGATCATGGTGG - Intergenic
1087328489 11:96752235-96752257 ATATGCCTGCTTGATCATGGTGG + Intergenic
1087742038 11:101898988-101899010 TGAAGCCAACTTGATCATGGTGG + Intronic
1088012492 11:105019953-105019975 TGAAGCCCCCTTGATCATGGTGG - Intronic
1088390940 11:109314393-109314415 TGAAGCCAACTTGATCATGGTGG - Intergenic
1088703013 11:112431201-112431223 TAAAGCCAACTTGATCATGGTGG + Intergenic
1089765669 11:120762782-120762804 TGAAGCCAACTTGATCATGGTGG + Intronic
1090308125 11:125708757-125708779 TGATGCCAACTTGATCATGGTGG - Intergenic
1090322620 11:125861114-125861136 TGAAGCCAACTTGATCATGGTGG - Intergenic
1091588460 12:1829141-1829163 TTATGCCACCTTGATCTCCAGGG + Intronic
1092561090 12:9614100-9614122 TGAGGCCAACTTGATCATGGTGG - Intergenic
1092562343 12:9629613-9629635 TGAAGCCAACTTGATCATGGTGG + Intergenic
1093571559 12:20671496-20671518 TGAAGCCCACTTGATCATTGTGG - Intronic
1093627284 12:21364194-21364216 TGAAGCCAACTTGATCATGGTGG - Intronic
1094262916 12:28521917-28521939 TGAAGCCAACTTGATCATGGTGG + Intronic
1094446995 12:30542133-30542155 TGATACCTCCTTGATCATGGTGG + Intergenic
1094482008 12:30891388-30891410 TGAAGCCAACTTGATCATGGTGG + Intergenic
1094710775 12:32959965-32959987 TGAAGCCAACTTGATCATGGTGG - Intergenic
1094811675 12:34144237-34144259 TGAAGCCATCTTGATCATGGTGG - Intergenic
1095356752 12:41283656-41283678 TGAAGCCACCTTGATCACGGTGG - Intronic
1095488881 12:42712076-42712098 TGAAGCCAACTTGATCATGGTGG - Intergenic
1095831967 12:46597633-46597655 TGATGCCAACTTGATCATGGCGG + Intergenic
1095911458 12:47430561-47430583 TGAAGCCCCCTTGATCATGGTGG - Intergenic
1095913605 12:47454146-47454168 TGAAGCCAACTTGATCATGGTGG + Intergenic
1095914734 12:47466127-47466149 TGAAGCCAACTTGATCATGGTGG + Intergenic
1096051310 12:48611321-48611343 TGAAGCCAACTTGATCATGGTGG + Intergenic
1096893121 12:54792233-54792255 TGAAGCCCACTTGATCATTGTGG - Intergenic
1097148856 12:56962043-56962065 TGAAGCCAGCTTGATCATGGTGG - Intergenic
1097418844 12:59348722-59348744 TGAAGCCAACTTGATCATGGTGG + Intergenic
1097583307 12:61484736-61484758 TGAAGCCTACTTGATCATTGTGG - Intergenic
1097917129 12:65032793-65032815 TGAAGCCAACTTGATCATGGTGG + Intergenic
1098053586 12:66479716-66479738 TGAAGCCTACTTGATCATTGTGG - Intronic
1098054414 12:66489272-66489294 TGAAGCCAACTTGATCATGGTGG - Intronic
1098201480 12:68060835-68060857 TGAAGCCAACTTGATCATAGTGG + Intergenic
1098667668 12:73184027-73184049 TGAAGCCAACTTGATCATGGTGG + Intergenic
1098776877 12:74631582-74631604 TGAAGCCAACTTGATCATTGTGG - Intergenic
1099253380 12:80286217-80286239 TGAAGCCACCTTGATCGTGGTGG + Intronic
1099266191 12:80450722-80450744 TGAAGCCCACTTGATCATTGTGG + Intronic
1099319815 12:81131971-81131993 TGAAGCCAACTTGATCATGGTGG + Intronic
1099511704 12:83546711-83546733 ATAAGCCAACTTGATCATGGTGG + Intergenic
1099549046 12:84020294-84020316 TGAAGCCAACTTGATCATGGTGG - Intergenic
1099550704 12:84040112-84040134 TGAAGCCAACTTGATCATGGTGG + Intergenic
1099881799 12:88476035-88476057 TGAAGCCAACTTGATCATGGTGG - Intergenic
1100136626 12:91560601-91560623 TGAAGCCAACTTGATCATGGTGG - Intergenic
1100381690 12:94068053-94068075 TGAAGCCAACTTGATCATGGTGG - Intergenic
1100506291 12:95224116-95224138 TAATTCCACCCTGATCATTATGG + Intronic
1100653290 12:96614160-96614182 TGAAGCCCCCTTGATCATGGTGG - Intronic
1100997344 12:100316665-100316687 TCATGACACCTTGACCATTTGGG - Intronic
1101088801 12:101263445-101263467 TGAAGCCAACTTGATCATGGTGG + Intergenic
1101487600 12:105181304-105181326 TGAAGCCAACTTGATCATGGTGG + Intronic
1101596202 12:106167236-106167258 TGAAGCCAACTTGATCATGGTGG - Intergenic
1102323844 12:111961471-111961493 TGAAGCCAACTTGATCATGGTGG - Intronic
1102832756 12:116020974-116020996 TTATCCCATTTGGATCATTGAGG - Intronic
1102876159 12:116450692-116450714 TCATGCCACCATGAACATTCCGG + Intergenic
1103203285 12:119107154-119107176 TGAAGCCAACTTGATCATGGTGG + Intronic
1104219519 12:126768256-126768278 TTATGGCTCCTTGATAATTAGGG - Intergenic
1105226840 13:18443337-18443359 TGAAGCCCACTTGATCATTGTGG - Intergenic
1105552265 13:21408952-21408974 TGAAGCCAACTTGATCATAGTGG + Intronic
1106136785 13:26979513-26979535 TTATGACAGCCTGATCAGTGTGG - Intergenic
1106335776 13:28781984-28782006 TTTTGCAACCATGTTCATTGAGG + Intergenic
1106387882 13:29305934-29305956 TGAAGCCAACTTGATCATGGTGG - Intronic
1106425847 13:29628559-29628581 AGAAGCCACCTTGATCATGGTGG - Intergenic
1106737646 13:32604419-32604441 TGAAGCCAACTTGATCATGGTGG + Intronic
1106817203 13:33421742-33421764 TGAAGCCACCTTGATCGTGGTGG - Intergenic
1106824290 13:33502729-33502751 TGAAGCCAACTTGATCATAGTGG + Intergenic
1106914373 13:34496746-34496768 TGAAGCCAAGTTGATCATTGTGG - Intergenic
1107380369 13:39850613-39850635 TGAAGCCAACTTGATCATGGTGG + Intergenic
1107642955 13:42462990-42463012 TGAAGCCAACTTGATCATGGTGG - Intergenic
1108143445 13:47450964-47450986 TGAAGCCAGCTTGATCATAGGGG + Intergenic
1108308216 13:49159962-49159984 TGAAGCCAACTTGATCATGGTGG + Intronic
1108499771 13:51059511-51059533 TTATTCCCCCTTTATCAATGAGG + Intergenic
1108545039 13:51484588-51484610 TGAAGCCAACTTGATCATCGTGG + Intergenic
1108815305 13:54283670-54283692 TGAAGCCAACTTGATCATGGTGG + Intergenic
1108865837 13:54921519-54921541 TGAAGCCAACTTGATCATGGTGG - Intergenic
1108984797 13:56573123-56573145 ATGTGCCACCTGGAACATTGGGG - Intergenic
1109317053 13:60762285-60762307 TGAGGCCTACTTGATCATTGTGG + Intergenic
1109669773 13:65588970-65588992 TGAAGCCAACTTGATCATGGTGG - Intergenic
1110135832 13:72066037-72066059 TGAAGCCAACTTGATCATGGTGG - Intergenic
1110154684 13:72301708-72301730 TAATCCCACCTTGATCATCCAGG - Intergenic
1110159426 13:72358096-72358118 TGAAGCCAGCTTGATCATGGTGG + Intergenic
1110199362 13:72830618-72830640 TGAAGCCAACTTGATCATGGTGG + Intronic
1110349467 13:74490431-74490453 TGAAGCCAACTTGATCATTGTGG + Intergenic
1110699457 13:78529839-78529861 TGAAGCCACCTTGATCATGGTGG - Intergenic
1110768118 13:79303707-79303729 TGAAGCCAACTTGATCATGGTGG - Intergenic
1110890622 13:80693396-80693418 TGACGCCAACTTGATCATGGTGG - Intergenic
1111622032 13:90736622-90736644 TGAAGCCAACTTGATCATCGTGG - Intergenic
1112166198 13:96922514-96922536 TAAAGCCAACTTGATCATGGTGG - Intergenic
1112363165 13:98735135-98735157 TGAAGCCAACTTGATCATGGTGG - Intronic
1112913468 13:104518747-104518769 TAAAGCCAACTTGATCATGGTGG + Intergenic
1113020960 13:105886753-105886775 TAAAGCCCCCTTGATCATGGTGG + Intergenic
1114004277 14:18295173-18295195 TGAAGCCAACTTGATCATGGTGG + Intergenic
1114425435 14:22617975-22617997 TGAAGCCCCCTTGATCATGGTGG + Intergenic
1114608420 14:24017530-24017552 TGAAGCCACCTTGATCGTGGTGG - Intergenic
1114688784 14:24560901-24560923 TGAAGCCAACTTGATCATGGTGG - Intergenic
1114966546 14:27968376-27968398 TTATGCTGTCTTGATCATGGTGG + Intergenic
1115477457 14:33829551-33829573 TGAAGCCAGCTTGATCATGGTGG - Intergenic
1115717408 14:36121528-36121550 TGAAGCCAACTTGATCATGGTGG + Intergenic
1115720752 14:36158597-36158619 TGAAGCCAGCTTGATCATGGTGG + Intergenic
1115723511 14:36188330-36188352 TGAAGCCAACTTGATCATGGTGG - Intergenic
1115728985 14:36247583-36247605 TGAAGCCAACTTGATCATGGTGG - Intergenic
1115743818 14:36415490-36415512 TGAAGCCAACTTGATCATGGTGG - Intergenic
1116074085 14:40087920-40087942 TGAAGCCAACTTGATCATGGTGG + Intergenic
1116078338 14:40141909-40141931 TGAAGCCCCCTTGATCATGGTGG + Intergenic
1116088720 14:40276237-40276259 GTATGACAACTTGATCATAGTGG + Intergenic
1116362933 14:44024873-44024895 TGAAGCCCCCTTGATCATGGTGG - Intergenic
1116782050 14:49246849-49246871 TAAAGCCAACTTGATCACTGTGG - Intergenic
1116795646 14:49387279-49387301 TGCAGCCACCTTGATCATGGTGG - Intergenic
1117446765 14:55810889-55810911 TGAAGCCAACTTGATCATGGTGG + Intergenic
1117489513 14:56232406-56232428 TGAAGCCAACTTGATCATGGTGG - Intronic
1117511701 14:56458202-56458224 TGAAGCCAACTTGATCATGGTGG - Intergenic
1117857285 14:60048930-60048952 TGAAGCCAACTTGATCATGGTGG - Intronic
1117932048 14:60853890-60853912 TGAAGCCAACTTGATCATGGTGG + Intronic
1118117077 14:62791081-62791103 TGATGACACCATGATCAATGGGG - Intronic
1118143296 14:63108697-63108719 TGAAGCCAACTTGATCATGGTGG + Intergenic
1118931271 14:70243465-70243487 TGAAGCCAACTTGATCATGGTGG + Intergenic
1120595203 14:86425692-86425714 TCATGGCACCTTGATTAATGGGG + Intergenic
1123163104 14:106299184-106299206 TGAAGCCAACTTGATCATGGTGG - Intergenic
1202887682 14_KI270722v1_random:123147-123169 TGAAGCCATCTTGATCATGGTGG + Intergenic
1123576274 15:21672837-21672859 TGAAGCCAACTTGATCATGGTGG + Intergenic
1123609338 15:22073270-22073292 TGAAGCCCCCTTGATCATGGTGG + Intergenic
1123612897 15:22115305-22115327 TGAAGCCAACTTGATCATGGTGG + Intergenic
1125523389 15:40360446-40360468 TTCTGCCACATTGATAATGGTGG + Intronic
1126071588 15:44869923-44869945 TGAAGCCAACTTGATCATGGTGG - Intergenic
1126278113 15:46908853-46908875 TGAAGCCAACTTGATCATGGTGG + Intergenic
1130432691 15:83864410-83864432 TGAAGCCAACTTGATCATGGTGG - Intronic
1130452954 15:84075877-84075899 TGAAGCCAACTTGATCATGGTGG - Intergenic
1131478094 15:92758409-92758431 TGAAGCCAACTTGATCATGGTGG - Intronic
1202981577 15_KI270727v1_random:365055-365077 TGAAGCCCCCTTGATCATGGTGG + Intergenic
1202985142 15_KI270727v1_random:407082-407104 TGAAGCCAACTTGATCATGGTGG + Intergenic
1133837937 16:9383126-9383148 TTATTCCACCATGAGCATTAAGG - Intergenic
1134767275 16:16771343-16771365 TGAAGCCAGCTTGATCATGGTGG + Intergenic
1134987869 16:18670910-18670932 TGAAGCCAACTTGATCATGGTGG - Intergenic
1135375457 16:21943333-21943355 TGAAGCCAACTTGATCATGGTGG + Intergenic
1135512402 16:23097621-23097643 TGAAGCCAACTTGATCATAGTGG - Intronic
1136731136 16:32414129-32414151 AGATGCCAACTTGATCATGGTGG + Intergenic
1136772201 16:32850573-32850595 TGAAGCCAACTTGATCATGGTGG + Intergenic
1136898410 16:34010948-34010970 TGAAGCCAACTTGATCATGGTGG - Intergenic
1137051575 16:35718124-35718146 TGAAGCCCACTTGATCATTGTGG + Intergenic
1137233244 16:46588968-46588990 TGAAGCCAACTTGATCATGGTGG - Intronic
1137316194 16:47326120-47326142 TGATGCCCACTTGATCATGGTGG - Intronic
1138357545 16:56395326-56395348 TGAAGCCAGCTTGATCATGGCGG - Intronic
1140321372 16:73954902-73954924 TTATGCCAACTTGAAGAGTGTGG - Intergenic
1140669051 16:77256664-77256686 TGAAGCCAACTTGATCATGGTGG + Intronic
1140695484 16:77528761-77528783 TGAAGCCAACTTGATCATGGTGG - Intergenic
1202995257 16_KI270728v1_random:103141-103163 AGATGCCAACTTGATCATGGTGG - Intergenic
1203021944 16_KI270728v1_random:415483-415505 AGATGCCAACTTGATCATGGTGG - Intergenic
1203074623 16_KI270728v1_random:1112662-1112684 TGACGCCAACTTGATCATGGTGG + Intergenic
1146237432 17:31180391-31180413 TGAAGCCAACTTGATCATGGTGG - Intronic
1146551720 17:33786120-33786142 TTATGCCAACATGATCAAGGGGG - Intronic
1147542545 17:41372793-41372815 TGAGGCCACCTTCCTCATTGTGG + Intronic
1148952922 17:51330251-51330273 TGAAGCCAACTTGATCATGGTGG - Intergenic
1149225188 17:54462242-54462264 TGAGGCCAACTTGATCATGGTGG + Intergenic
1149241827 17:54659873-54659895 TGAAGCCAACTTGATCATGGTGG + Intergenic
1151108419 17:71646575-71646597 TGAAGCCAACTTGATCATGGTGG - Intergenic
1153090673 18:1338996-1339018 TGAAGCCAACTTGATCATGGCGG - Intergenic
1153114929 18:1643527-1643549 TGAAGCCAACTTGATCATGGTGG + Intergenic
1153827223 18:8886410-8886432 TGAAGCCAACTTGATCATGGTGG + Intergenic
1153941168 18:9978936-9978958 TGAAGCCAACTTGATCATTGTGG + Intergenic
1154288242 18:13080982-13081004 TGAAGCCAACTTGATCATGGTGG + Intronic
1154320965 18:13351910-13351932 TGAAGCCAACTTGATCATGGTGG - Intronic
1154459214 18:14562904-14562926 TGAAGCCAACTTGATCATGGTGG + Intergenic
1154526542 18:15296137-15296159 TGAAGCCCACTTGATCATTGTGG + Intergenic
1155476545 18:26240929-26240951 TGAAGCCAACTTGATCATGGTGG + Intronic
1155562303 18:27091790-27091812 TGAAGCCAACTTGATCATAGTGG + Intronic
1155568179 18:27160454-27160476 TTAAGCCCACTTGATCATGGTGG + Intronic
1155893088 18:31290263-31290285 TGAAGCCAACTTGATCATGGTGG + Intergenic
1156116298 18:33790670-33790692 TGAAGCCCCCTTGATCATGGTGG - Intergenic
1156434779 18:37115311-37115333 TGAAGCCAACTTGATCATGGTGG - Intronic
1156538481 18:37886924-37886946 TTATGCCACCTGGATGGTTTGGG + Intergenic
1156695194 18:39757459-39757481 TGAAGCAAACTTGATCATTGTGG - Intergenic
1156799255 18:41088925-41088947 TGAAGCCAACTTGATCATGGTGG - Intergenic
1156979001 18:43262905-43262927 TGAAGCCAACTTGATCATGGTGG + Intergenic
1157018293 18:43745983-43746005 TGAAGCCAACTTGGTCATTGTGG + Intergenic
1157019981 18:43769459-43769481 TGAAGCCAACTTGATCATAGTGG - Intergenic
1157066204 18:44353733-44353755 TGAAGCCAACTTGATCATCGTGG + Intergenic
1157066956 18:44363341-44363363 TGAAGCCAACTTGATCATCGTGG + Intergenic
1158792572 18:60799513-60799535 TGAAGCCAACTTGATCATGGTGG + Intergenic
1159140820 18:64391768-64391790 TTATTCCACCTTGACCATAATGG - Intergenic
1159311767 18:66718742-66718764 TGATGCCCACTTGATCATGGTGG - Intergenic
1159411561 18:68083044-68083066 TTCTGCAGCCTTGATCACTGAGG - Intergenic
1159569277 18:70093646-70093668 TGAAGCCAACTTGATCATGGTGG + Intronic
1160640557 19:129783-129805 TTCTCCCACCTTGATTTTTGTGG - Intergenic
1163858231 19:19723426-19723448 TGAAGCCAACTTGATCATGGTGG + Intronic
1163914550 19:20229126-20229148 TAAAGCCAACTTGATCATGGTGG - Intergenic
1163976250 19:20855841-20855863 TGAAGCCAACTTGATCATGGTGG - Intronic
1164264956 19:23606636-23606658 TGAAGCCAACTTGATCATGGTGG + Intronic
1164417825 19:28061009-28061031 TAGTGCCATCTTCATCATTGAGG + Intergenic
1164688982 19:30193615-30193637 TGAAGCCAACTTGATCATGGTGG - Intergenic
1165265405 19:34658936-34658958 TGAAGCCAACTTGATCATGGTGG - Intronic
1165270940 19:34707092-34707114 TGAAGCCAACTTGATCATGGTGG - Intergenic
1165274429 19:34735519-34735541 TAAAGCCACCTGGATTATTGCGG + Intronic
1166616367 19:44251548-44251570 TGAAGCCAACTTGATCATGGTGG - Intronic
1167311837 19:48741450-48741472 TTTTTCCTCCTTGATCATTTTGG + Exonic
1202663087 1_KI270708v1_random:89991-90013 TGAAGCCATCTTGATCATGGTGG + Intergenic
924968087 2:97037-97059 TGAAGCCAACTTGATCATGGTGG - Intergenic
925737464 2:6976286-6976308 TTTTGCCAACTTGATAGTTGGGG + Intronic
926567397 2:14491096-14491118 TGAAGCCCACTTGATCATTGTGG + Intergenic
927117594 2:19920377-19920399 TGAAGCCAACTTGATCATGGTGG - Intronic
927406430 2:22774742-22774764 TTATGCCATCATAATAATTGTGG + Intergenic
927588830 2:24335241-24335263 TTTTCCCACCTTGAAAATTGAGG - Intronic
928629259 2:33173802-33173824 TGAAGCCCCCTTGATCATGGTGG - Intronic
928754594 2:34509037-34509059 TGAAGCCAACTTGATCATGGTGG - Intergenic
929613601 2:43290708-43290730 TTATGCCACCACCATCAGTGTGG + Intronic
930863211 2:56096340-56096362 TGAAGCCAACTTGATCATGGTGG - Intergenic
930961994 2:57273195-57273217 TGAAGCCAACTTGATCATGGTGG + Intergenic
931306933 2:61038402-61038424 TGAAGCCAACTTGATCATGGTGG - Intronic
931886362 2:66622362-66622384 TGATGCCAACTTGATCATAGTGG + Intergenic
932052162 2:68408978-68409000 TAAAGCCAACTTGATCATGGTGG - Intergenic
932080861 2:68713829-68713851 TGAAGCCAACTTGATCATGGTGG + Intronic
933388205 2:81637976-81637998 TGAAGCCAGCTTGATCATGGTGG - Intergenic
934012487 2:87838364-87838386 TGATGCCTACTTGATCATGGTGG - Intergenic
934152883 2:89165626-89165648 TGAAGCCACCTTGATCATGGTGG + Intergenic
934314575 2:91905128-91905150 GGATGCCAACTTGATCATGGTGG - Intergenic
935438219 2:103060007-103060029 TGAAGCCAACTTGATCATGGTGG - Intergenic
936447933 2:112611046-112611068 TGAAGCCAACTTGATCATGGTGG + Intergenic
936673870 2:114691409-114691431 TGAAGCCAACTTGATCATGGTGG + Intronic
936702391 2:115028339-115028361 TTATGACCCATTGATCATTTAGG + Intronic
936775005 2:115962373-115962395 TGAAGCCAACTTGATCATGGTGG + Intergenic
936798311 2:116234580-116234602 TGAAGCCAACTTGATCATGGTGG - Intergenic
937063655 2:119000201-119000223 TGAAGCCCCCTTGATCATGGTGG - Intergenic
937075223 2:119099496-119099518 TGAAGCCAACTTGATCATGGTGG - Intergenic
937456749 2:122048545-122048567 TGAAGCCAACTTGATCATGGTGG + Intergenic
937467117 2:122143280-122143302 TGAAGCCAACTTGATCATGGTGG + Intergenic
937605862 2:123800896-123800918 TGAAGCCAACTTGATCATGGTGG + Intergenic
937633226 2:124126706-124126728 TGAGGCCAACTTGATCATGGTGG - Intronic
939193060 2:138939246-138939268 TGAAGCCAACTTGATCATCGTGG + Intergenic
939270384 2:139931505-139931527 TGAAGCCAACTTGATCATGGTGG - Intergenic
939912728 2:148003409-148003431 TGAAGCCAACTTGATCATGGTGG - Intronic
939937412 2:148309989-148310011 TAAAGCCAACTTGATCATGGTGG + Intronic
940809501 2:158226602-158226624 TGATGCCCACTTGATCATGGTGG - Intronic
940820963 2:158354875-158354897 TGATGCCCACTTGATCATGGTGG - Intronic
940996153 2:160152245-160152267 TGAAGCCAACTTGATCATGGTGG - Intronic
941100518 2:161289975-161289997 TGAAGCCAACTTGATCATGGTGG - Intergenic
941259777 2:163283308-163283330 TGATGCCCACTTGATCATGGTGG - Intergenic
941571297 2:167173958-167173980 TGAAGCCAACTTGATCATGGTGG + Intronic
941975447 2:171399508-171399530 TTTTGCCACTATGCTCATTGTGG - Intronic
942065458 2:172267049-172267071 TGAAGCCAACTTGATCATGGTGG + Intergenic
942362824 2:175190525-175190547 TGAAGCCAACTTGATCATGGTGG - Intergenic
942471253 2:176262893-176262915 TTATGCCACTTTTACCATTTGGG - Intergenic
943183919 2:184580548-184580570 TTGTGCCATCTTGAGTATTGAGG + Intergenic
943628627 2:190225917-190225939 TGAAGCCAACTTGATCATGGTGG - Intronic
943837186 2:192528291-192528313 TGAAGCCAACTTGATCATGGTGG - Intergenic
944002189 2:194852886-194852908 TGAAGCCAACTTGATCATGGTGG + Intergenic
944035830 2:195293574-195293596 TGATGCCGACTTGATCATGGTGG - Intergenic
944292392 2:198022031-198022053 TGAAGCCAACTTGATCATGGTGG - Intronic
944378320 2:199075391-199075413 TGAAGCCAGCTTGATCATGGTGG - Intergenic
944520669 2:200563402-200563424 TGAAGCCAACTTGATCATGGTGG + Intronic
944988411 2:205205790-205205812 TGAAGCCAACTTGATCATGGTGG + Intronic
945116432 2:206412403-206412425 TGAAGCCAACTTGATCATGGTGG + Intergenic
945343859 2:208689230-208689252 TGAAGCCAACTTGATCATGGTGG + Intronic
945391009 2:209265168-209265190 TGAAGCCAACTTGATCATGGTGG - Intergenic
945427035 2:209719086-209719108 TTATGCCATCTTGAGAAATGAGG + Intronic
945479848 2:210332752-210332774 TGAAGCCAACTTGATCATGGTGG + Intergenic
945508923 2:210676394-210676416 TTATGCCACATAGATCTTTAAGG - Intronic
946719397 2:222588157-222588179 TGAAGCCAACTTGATCATGGTGG - Intronic
946837970 2:223791330-223791352 TGAAGCCAACTTGATCATGGTGG - Intronic
947193989 2:227542503-227542525 TGAAGCCAGCTTGATCATGGTGG + Intronic
947301576 2:228693610-228693632 TGAAGCCAACTTGATCATGGTGG + Intergenic
948272258 2:236683610-236683632 TTAAACCACCTGGGTCATTGTGG + Intergenic
1168882602 20:1220520-1220542 TGAAGCCAACTTGATCATGGTGG - Intergenic
1169418718 20:5441416-5441438 TGATGCCAACTTGATCGTGGTGG - Intergenic
1169658604 20:7953880-7953902 TTAAGCCAACTTGTTCATGGTGG + Intergenic
1169995003 20:11546495-11546517 TCATGCCACCGTGATCAATAGGG - Intergenic
1170483295 20:16790171-16790193 TGAAGCCAACTTGATCATGGTGG + Intergenic
1171007621 20:21482335-21482357 TGAAGCCAACTTGATCATGGTGG + Intergenic
1171168010 20:22989935-22989957 TGAAGCCCACTTGATCATTGTGG + Intergenic
1171733494 20:28740126-28740148 TGAAGCCCCCTTGATCATGGTGG - Intergenic
1171763069 20:29230075-29230097 TGAAGCCCACTTGATCATTGTGG + Intergenic
1171763626 20:29236123-29236145 TTAAGCCCACTTGATCATGGTGG - Intergenic
1171774902 20:29356207-29356229 TGAAGCCATCTTGATCATGGTGG - Intergenic
1171816910 20:29793836-29793858 TGAAGCCATCTTGATCATAGTGG - Intergenic
1172407151 20:34698341-34698363 GTATCCCTCCTTGACCATTGTGG - Intronic
1173412118 20:42821208-42821230 TGAAGCCAACTTGATCATGGTGG - Intronic
1173771457 20:45662764-45662786 TGAAGCCAACTTGATCATGGTGG + Intronic
1173777117 20:45718460-45718482 TGAAGCCAACTTGATCATGGTGG - Intergenic
1174925498 20:54754925-54754947 TGAAGCCAACTTGATCATGGTGG - Intergenic
1174973905 20:55309019-55309041 TGAAGCCAACTTGATCATGGTGG - Intergenic
1174996653 20:55577270-55577292 TTATACCACCTTCAGCATTAGGG + Intergenic
1176770891 21:13072357-13072379 TGAAGCCCACTTGATCATTGTGG - Intergenic
1176814926 21:13590441-13590463 TGAAGCCAACTTGATCATGGTGG - Intergenic
1177373459 21:20237263-20237285 TAAAGCCAACTTGATCATGGTGG + Intergenic
1177691589 21:24517032-24517054 TGAAGCCAACTTGATCATGGTGG - Intergenic
1177971162 21:27791359-27791381 TAAAGCCAACTTGATCATAGTGG - Intergenic
1178739513 21:35185110-35185132 TGAAGCCAACTTGATCATGGTGG + Intronic
1179156983 21:38859328-38859350 GTATGCCACCTTGACCTTTTTGG + Intergenic
1180254449 21:46614858-46614880 TAAAGCCTCCTTGATCATGGTGG + Intergenic
1180329827 22:11466874-11466896 TGAAGCCATCTTGATCATGGTGG + Intergenic
1180428794 22:15225972-15225994 TGAAGCCAACTTGATCATGGTGG + Intergenic
1180541344 22:16451012-16451034 GGATGCCAACTTGATCATGGTGG - Intergenic
1182345596 22:29661962-29661984 TTATTCCACCTTAATTATTTTGG - Intronic
949532435 3:4969548-4969570 TGAAGCCAACTTGATCATGGTGG - Intergenic
949831447 3:8219306-8219328 GTATGCCACGTTGCTCTTTGTGG + Intergenic
949846450 3:8375673-8375695 TGAAGCCAACTTGATCATGGTGG - Intergenic
951450306 3:22830127-22830149 TGAAGCCAACTTGATCATTGTGG - Intergenic
951471265 3:23058960-23058982 TGAAGCCATCTTGATCATGGTGG + Intergenic
951572647 3:24081291-24081313 TGAAGCCCACTTGATCATTGTGG + Intergenic
951795034 3:26529158-26529180 TGAAGCCAACTTGATCATGGTGG + Intergenic
951921237 3:27856582-27856604 TGAAGCCAACTTGATCATGGTGG - Intergenic
951972036 3:28456815-28456837 TGAAGCCAACTTGATCATGGTGG + Intronic
952094772 3:29936884-29936906 TTTTGCCTCCTTGAACATTTGGG - Intronic
952811345 3:37406570-37406592 TTTTGCATCCTTGTTCATTGGGG + Intronic
953261421 3:41342820-41342842 TAAAGCCAACTTGATCATGGTGG - Intronic
953269590 3:41427567-41427589 TGAAGCCAACTTGATCATAGTGG - Intronic
954507837 3:51094012-51094034 TGAAGCCAACTTGATCATGGTGG + Intronic
955536705 3:59931025-59931047 TTATGCCCACTTGATAAATGAGG - Intronic
955627004 3:60929012-60929034 TGAAGCCAACTTGATCATGGTGG - Intronic
955635356 3:61022641-61022663 TTAAGCCAACTTGATCGTGGTGG - Intronic
955667501 3:61366079-61366101 TGAAGCCAACTTGATCATGGTGG - Intergenic
955975883 3:64479594-64479616 TGAAGCCAACTTGATCATGGTGG - Intergenic
955982725 3:64543414-64543436 TGAAGCCAACTTGATCATGGTGG - Intronic
956394802 3:68813963-68813985 TGAAGCCAACTTGATCATGGTGG - Intronic
957232821 3:77542420-77542442 TTATGCCACATTGATCTTGCTGG - Intronic
957406870 3:79783159-79783181 TGAAGCCCACTTGATCATTGTGG - Intergenic
958046894 3:88295959-88295981 TGAAGCCAACTTGATCATGGTGG + Intergenic
958077076 3:88694372-88694394 TGAAGCCAACTTGATCATGGTGG - Intergenic
958523579 3:95223529-95223551 TGAAGCCAACTTGATCATGGTGG + Intergenic
958621757 3:96571629-96571651 TTAAGCCAACTTGATCATGGTGG + Intergenic
959487946 3:106950380-106950402 TGAAGCCCACTTGATCATTGTGG - Intergenic
959747879 3:109798555-109798577 TGAAGCCAACTTGATCATGGTGG - Intergenic
959898338 3:111630805-111630827 TGAAGCCAACTTGATCATGGTGG - Intronic
960278533 3:115754689-115754711 TGAAGCCAACTTGATCATGGTGG - Intergenic
960566138 3:119133868-119133890 TGAAGCCAACTTGATCATGGTGG - Intronic
960769005 3:121170988-121171010 TGAAGCCAACTTGATCATGGTGG - Intronic
961052809 3:123761477-123761499 TTATGCCACCTGTATCCATGTGG + Intronic
962524805 3:136228076-136228098 TGAAGCCAACTTGATCATGGTGG - Intergenic
962548931 3:136468783-136468805 TGAAGCCAACTTGATCATGGTGG - Intronic
962696594 3:137954072-137954094 TGAAGCCAGCTTGATCATGGTGG + Intergenic
962833828 3:139168813-139168835 TGAAGCCAACTTGATCATGGTGG + Intronic
963576271 3:147064592-147064614 TGAAGCCAACTTGATCATGGTGG - Intergenic
963976659 3:151487628-151487650 TGAAGCCAACTTGATCATGGTGG - Intergenic
964783087 3:160362667-160362689 TGAAGCCAACTTGATCATGGTGG - Intronic
964860139 3:161192655-161192677 TGAAGCCCCCTTGATCATGGTGG + Intronic
965221687 3:165934223-165934245 TGAAGCCAACTTGATCATAGTGG - Intergenic
965621584 3:170647484-170647506 TGAAGCCAACTTGATCATGGTGG + Intronic
965706836 3:171517383-171517405 TTAAGCCAACTTGATCGTGGTGG + Intergenic
966651998 3:182311928-182311950 TGAAGCCAACTTGATCATGGTGG + Intergenic
967419231 3:189255367-189255389 TGAAGCCAGCTTGATCATGGTGG + Intronic
968217909 3:196909558-196909580 TGAAGCCAACTTGATCATGGTGG - Intronic
970070784 4:12157487-12157509 TGAAGCCAACTTGATCATGGTGG + Intergenic
970412437 4:15821989-15822011 TGAAGCCAACTTGATCATGGTGG - Intronic
971575889 4:28274093-28274115 TGAAGCCAACTTGATCATGGTGG + Intergenic
972101025 4:35417191-35417213 TTAAGCCAACTTGGTCATGGTGG - Intergenic
972212696 4:36858026-36858048 TAAAGCCAACTTGATCATGGTGG - Intergenic
972855104 4:43096662-43096684 TGAAGCCCCCTTGATCATGGTGG - Intergenic
972914508 4:43859165-43859187 TGAAGCCAACTTGATCATGGTGG + Intergenic
972929149 4:44049919-44049941 TGAAGCCCACTTGATCATTGTGG - Intergenic
973654659 4:53034110-53034132 TGATGCCAACTTGATCATGGTGG - Intronic
973714875 4:53666153-53666175 TGAAGCCAACTTGATCATGGTGG + Intronic
973776534 4:54247366-54247388 TGAAGCCAACTTGATCATGGTGG - Intronic
973914820 4:55622814-55622836 TGAAGCCCACTTGATCATTGTGG - Intronic
974230765 4:59110930-59110952 TGAAGCCAACTTGATCATGGTGG + Intergenic
974254451 4:59431020-59431042 TGAAGCCAACTTGATCATTATGG - Intergenic
974263616 4:59556811-59556833 TGAAGCCAACTTGATCGTTGTGG + Intergenic
974836277 4:67254940-67254962 TGAAGCCAACTTGATCATGGTGG + Intergenic
974869779 4:67626771-67626793 TTATGCCCACTGTATCATTGTGG - Intronic
974869928 4:67628802-67628824 TTATGCCCACTATATCATTGTGG - Intronic
974979582 4:68938353-68938375 TGAAGCCAACTTGATCATGGTGG - Intronic
975022538 4:69506871-69506893 TAATGCCTACTTGATCATGGTGG - Intronic
975178268 4:71312569-71312591 TGAAGCCAACTTGATCATGGTGG - Intronic
975291516 4:72683077-72683099 TGAAGCCAACTTGATCATGGTGG - Intergenic
975301902 4:72799963-72799985 TGAAGCCAACTTGATCAATGTGG - Intergenic
975453755 4:74564821-74564843 TGAAGCCAACTTGATCATGGTGG - Intergenic
975726191 4:77294066-77294088 TTATGCCACCTTGATCATTGAGG - Intronic
975729521 4:77323971-77323993 TGAAGCCAACTTGATCATGGTGG + Intronic
975738601 4:77406280-77406302 TTATGCTATCTTGCTCACTGAGG - Intronic
976093128 4:81477734-81477756 TTAAGCCAACTTGATCGTGGTGG - Intronic
976519004 4:86004960-86004982 TTATGACACCTTGAAAATTCAGG + Intergenic
976976949 4:91177163-91177185 TGAAGCCAACTTGATCATGGTGG + Intronic
977282587 4:95060469-95060491 TTATCCCTTCTTCATCATTGGGG - Intronic
977421947 4:96811977-96811999 TGAAGCCAACTTGATCATGGTGG - Intergenic
977462335 4:97340666-97340688 TGAAGCCAACTTGATCATGGTGG - Intronic
977500598 4:97832166-97832188 TGAAGCCAACTTGATCATGGTGG - Intronic
977533021 4:98222307-98222329 TTGAGCCACCTTGATAAATGGGG + Intergenic
977737496 4:100434672-100434694 TGAAGCCAACTTGATCATGGTGG - Intronic
977819547 4:101456192-101456214 TTAAGCCAACTTGATCGTGGTGG + Intronic
978004506 4:103599799-103599821 TGAAGCCCCCTTGATCATGGTGG + Intronic
978025273 4:103865789-103865811 TGAAGCCTCCTTGATCATGGTGG + Intergenic
978039305 4:104039742-104039764 TGAAGCCCCCTTGATCATGGTGG - Intergenic
978108625 4:104934256-104934278 TGAAGCCAACTTGATCATGGTGG - Intergenic
978130477 4:105190093-105190115 TTAAGCCTCATTGATTATTGCGG + Intronic
978175913 4:105732037-105732059 TTAAGCCTACTTGATCATGGTGG + Intronic
978313608 4:107413045-107413067 TGAAGCCAACTTGATCATGGTGG - Intergenic
978363918 4:107960460-107960482 TGAAGCCAACTTGATCATGGTGG - Intergenic
978418740 4:108506877-108506899 TGAGGCCAACTTGATCATGGTGG - Intergenic
978419565 4:108516035-108516057 TGAAGCCAACTTGATCATGGTGG - Intergenic
978729074 4:112003731-112003753 TTGTGCCACCTTGTTCCTTGAGG - Intergenic
978940603 4:114431851-114431873 TGAAGCCAACTTGATCATGGTGG + Intergenic
979096521 4:116557862-116557884 TGAAGCCAGCTTGATCATGGTGG + Intergenic
979115618 4:116818847-116818869 TGAAGCCAACTTGATCATGGTGG - Intergenic
979179853 4:117711476-117711498 TGAAGCCAGCTTGATCATGGTGG - Intergenic
979337953 4:119485338-119485360 TGAAGCCAACTTGATCATGGTGG - Intergenic
979457955 4:120947869-120947891 TGAAGCCAACTTGATCATGGTGG - Intergenic
979491588 4:121334537-121334559 TTATGATGCCTTGATCAATGTGG - Intronic
979554625 4:122031000-122031022 TGAAGCCAACTTGATCATGGTGG + Intergenic
979589488 4:122462193-122462215 TGAAGCCAGCTTGATCATGGTGG + Intergenic
979599444 4:122571525-122571547 TGAAGCCAACTTGATCATGGTGG + Intergenic
979725764 4:123959009-123959031 TGAAGCCAACTTGATCATGGTGG - Intergenic
979750356 4:124271711-124271733 TGAAGCCAACTTGATCATGGTGG + Intergenic
979785927 4:124714486-124714508 TTATGCCACGTTTAACATTTAGG - Intergenic
979934399 4:126673383-126673405 TGAAGCCAACTTGATCATGGTGG - Intergenic
979944681 4:126814175-126814197 TGAAGCCAACTTGATCATTGTGG - Intergenic
979976394 4:127201629-127201651 TGAAGCCTACTTGATCATTGTGG - Intergenic
980099972 4:128532227-128532249 TGAAGCCAACTTGATCATGGTGG + Intergenic
980334681 4:131456195-131456217 TGAAGCCAACTTGATCATGGTGG + Intergenic
980503652 4:133687522-133687544 TGAAGCCAACTTGATCATGGTGG + Intergenic
980859285 4:138480540-138480562 TGAAGCCAACTTGATCATGGTGG + Intergenic
981795918 4:148595312-148595334 TGAAGCCAGCTTGATCATGGTGG + Intergenic
981814650 4:148816687-148816709 TGAAGCCAACTTGATCATGGTGG - Intergenic
981903783 4:149896167-149896189 TGAAGCCAACTTGATCATGGTGG - Intergenic
982324236 4:154112574-154112596 TAAAGCCAACTTGATCATGGTGG - Intergenic
982653618 4:158118807-158118829 TTAAGCCCACTTGATCATGGTGG + Intergenic
982674934 4:158364892-158364914 TGAAGCCAACTTGATCATGGTGG + Intronic
982734230 4:158988535-158988557 TGAAGCCAACTTGATCATGGTGG - Intronic
982826122 4:160005781-160005803 TAAAGCCAACTTGATCATGGTGG - Intergenic
982852608 4:160338826-160338848 TGAAGCCAACTTGATCATGGTGG + Intergenic
982875071 4:160638061-160638083 TGAAGCCAACTTGATCATGGTGG + Intergenic
983030823 4:162799678-162799700 TGAAGCCAACTTGATCATAGTGG + Intergenic
983134591 4:164064994-164065016 TAAAGCCAGCTTGATCATAGTGG + Intronic
983179794 4:164634242-164634264 TGAAGCCAACTTGATCATGGTGG - Intergenic
983181359 4:164652849-164652871 TGAAGCCAACTTGATCATGGTGG - Intergenic
983362732 4:166747281-166747303 TGAAGCCAACTTGATCATGGTGG - Intronic
983457591 4:167984377-167984399 TGAAGCCAACTTGATCATGGTGG + Intergenic
983594643 4:169452460-169452482 TGAAGCCAACTTGATCATGGTGG - Intronic
983602264 4:169544311-169544333 TGAAGCCAACTTGATCATGGTGG + Intronic
983788394 4:171762721-171762743 TGAAGCCAACTTGATCATGGTGG - Intergenic
983880644 4:172928361-172928383 TTTTCCCACCTTCATAATTGGGG + Intronic
983881286 4:172936078-172936100 TGAAGCCAACTTGATCATGGTGG - Intronic
983972034 4:173887433-173887455 TGAAGCCAACTTGATCATGGTGG + Intergenic
984008715 4:174344951-174344973 TGAAGCCAACTTGATCATGGTGG + Intergenic
984092405 4:175390329-175390351 TGAAGCCAACTTGATCATGGTGG - Intergenic
984113277 4:175646086-175646108 TGATGCCACCTGGATAATTCAGG + Intronic
984184822 4:176531129-176531151 TGATGCAACCTAGCTCATTGGGG + Intergenic
984628183 4:182032394-182032416 TGAAGCCAACTTGATCATGGTGG + Intergenic
986172090 5:5323343-5323365 TGAAGCCAACTTGATCATGGTGG + Intergenic
986656043 5:10013376-10013398 TGAAGCCAACTTGATCATGGTGG + Intergenic
986876614 5:12118591-12118613 TTATGCTACATTAATCATTTTGG - Intergenic
987013746 5:13795847-13795869 TGAAGCCAACTTGATCATGGTGG - Intronic
987157142 5:15100438-15100460 TGAAGCCAACTTGATCATGGTGG - Intergenic
987279396 5:16397311-16397333 TGAAGCCAACTTGATCATGGTGG + Intergenic
987399479 5:17460346-17460368 TTAAGCTAACTTGATCATGGTGG + Intergenic
987454027 5:18120794-18120816 TGAAGCCAACTTGATCATGGTGG - Intergenic
987454230 5:18123148-18123170 TGAAGCCAACTTGATCATGGTGG - Intergenic
987687939 5:21229072-21229094 TGAAGCCAACTTGATCACTGTGG - Intergenic
987896918 5:23958602-23958624 TGAAGCCAACTTGATCATGGTGG - Intronic
987909808 5:24126649-24126671 TGAAGCCAACTTGATCATGGTGG + Intronic
988672066 5:33392503-33392525 TGAAGCCAACTTGATCATGGTGG - Intergenic
989528427 5:42479229-42479251 TGAAGCCAGCTTGATCATGGTGG + Intronic
989583619 5:43056924-43056946 TGAAGCCAACTTGATCATGGTGG - Intergenic
989627186 5:43441207-43441229 TGAAGCCAACTTGATCATGGAGG + Intergenic
989697141 5:44214745-44214767 TAAAGCCAACTTGATCATGGTGG + Intergenic
990016370 5:51067153-51067175 TGAAGCCAACTTGATCATGGTGG - Intergenic
990482495 5:56225130-56225152 TGAAGCCAACTTGATCATGGTGG - Intronic
990541617 5:56778654-56778676 TGAAGCCATCTTGATCATAGTGG + Intergenic
990858743 5:60302017-60302039 TGAAGCCAACTTGATCATGGTGG + Intronic
991102562 5:62809143-62809165 TGAAGCCAACTTGATCATGGTGG + Intergenic
991151822 5:63379613-63379635 TGAAGCCAACTTGATCATGGTGG - Intergenic
991532323 5:67629290-67629312 TGAAGCCAACTTGATCATGGTGG + Intergenic
993220676 5:85092820-85092842 TGAAGCCAACTTGATCATGGTGG - Intergenic
993290352 5:86060392-86060414 TGAAGCCAACTTGATCATGGTGG - Intergenic
993343556 5:86754640-86754662 TGAAGCCCACTTGATCATTGTGG + Intergenic
993459884 5:88170359-88170381 TGAAGCCAACTTGATCATGGTGG + Intergenic
993527953 5:88989763-88989785 TGATGCCAACTTGATCGTGGTGG + Intergenic
993577983 5:89625317-89625339 TGAAGCCCACTTGATCATTGTGG - Intergenic
993578590 5:89632269-89632291 TGAAGCCCACTTGATCATTGTGG + Intergenic
994257798 5:97620583-97620605 ATAAGCCTACTTGATCATTGTGG + Intergenic
994264854 5:97702623-97702645 TGAAGCCAACTTGATCATGGTGG + Intergenic
994611289 5:102044265-102044287 TGAAGCCAGCTTGATCATGGTGG - Intergenic
994721175 5:103382190-103382212 TGAAGCCAACTTGATCATGGTGG + Intergenic
994917700 5:106001388-106001410 TGAAGCCAACTTGATCATTGTGG + Intergenic
995113878 5:108457482-108457504 TTAAGCCAACTTGATCATGGTGG + Intergenic
995660783 5:114480663-114480685 TGAAGCCAACTTGATCATGGTGG - Intronic
995695143 5:114870545-114870567 TGAAGCCAACTTGATCATAGTGG - Intergenic
995750190 5:115445846-115445868 TGAAGCCAACTTGATCATGGTGG - Intergenic
996130299 5:119773332-119773354 TTAAGCCAACTTGATCATGGTGG - Intergenic
996166791 5:120233764-120233786 TAATGCCTACTTGATCATGGTGG + Intergenic
996181812 5:120428743-120428765 TGAAGCCAACTTGATCATGGTGG + Intergenic
996648343 5:125843219-125843241 TAAAGTCACCTTGATCATGGTGG - Intergenic
997252652 5:132401888-132401910 TGAAGCCAACTTGATCATGGTGG - Intergenic
997809090 5:136949531-136949553 TGAAGCCAACTTGATCATGGTGG + Intergenic
998328820 5:141305419-141305441 TTATGCCATCTTGATTCTGGTGG - Intergenic
998732649 5:145097924-145097946 TAAAGCCAACTTGATCATGGTGG - Intergenic
998759552 5:145417544-145417566 TGAAGCCAACTTGATCATGGTGG - Intergenic
998774432 5:145583088-145583110 TGAAGCCAACTTGATCATGGTGG - Intronic
999027884 5:148256200-148256222 TTAAGCCTACTTGATCATGGTGG + Intergenic
999288139 5:150406505-150406527 TTATGCCAGTTTGACCAATGAGG - Intronic
999431538 5:151529149-151529171 ATCTGCCACCTTGCTCTTTGTGG - Intronic
999607193 5:153328974-153328996 TGAAGCCCCCTTGATCATGGTGG - Intergenic
1000377439 5:160596189-160596211 TGAGGCCAACTTGATCATGGTGG - Intronic
1000471953 5:161654302-161654324 TGAAGCCAACTTGATCATGGTGG - Intronic
1000746700 5:165042800-165042822 TAAAGCCAACTTGATCATGGTGG + Intergenic
1000748907 5:165070670-165070692 TGATGCCAACTTGATCATGGTGG + Intergenic
1002736793 5:181396636-181396658 TTCTCCCACCTTGATTTTTGTGG + Intergenic
1002747906 6:78186-78208 TTCTCCCACCTTGATTTTTGTGG - Intergenic
1005238390 6:23793595-23793617 TGAAGCTAACTTGATCATTGTGG - Intergenic
1005373834 6:25161968-25161990 TGAAGCCCCCTTGATCATGGTGG - Intergenic
1005558479 6:27012211-27012233 TGAAGCCAACTTGATCATGGTGG - Intergenic
1005702850 6:28420186-28420208 TTATTCCACATTCATCACTGTGG + Intergenic
1007146963 6:39645500-39645522 TGAAGCCAACTTGATCATGGTGG + Intronic
1008175821 6:48267107-48267129 TGAAGCCAACTTGATCATGGTGG + Intergenic
1008238361 6:49077040-49077062 TGAAGCCCCCTTGATCATGGTGG + Intergenic
1008728885 6:54455871-54455893 TGAAGCCAACTTGATCATGGTGG + Intergenic
1008780073 6:55092822-55092844 TAAAGCCAACTTGATCATGGTGG - Intergenic
1008829376 6:55739314-55739336 TGAAGCCCACTTGATCATTGTGG - Intergenic
1009054659 6:58320205-58320227 TAAAGCCGACTTGATCATTGTGG - Intergenic
1009193206 6:60654303-60654325 TGAAGCCAACTTGATCATGGTGG + Intergenic
1009213126 6:60887246-60887268 TGAAGCCAACTTGATCATGGTGG - Intergenic
1009233575 6:61095468-61095490 TGAAGCCCCCTTGATCATGGTGG - Intergenic
1009236480 6:61130366-61130388 TAAAGCCGACTTGATCATTGTGG + Intergenic
1009330745 6:62416946-62416968 TGAAGCCCCCTTGATCATGGTGG - Intergenic
1009447165 6:63756470-63756492 TGAAGCCAACTTGATCATGGTGG + Intronic
1009449242 6:63782094-63782116 TGAAGCCAACTTGATCATGGTGG + Intronic
1009597230 6:65751378-65751400 TGAAGCCAACTTGATCATGGTGG - Intergenic
1009756719 6:67949465-67949487 TGAAGCCAACTTGATCATGGTGG + Intergenic
1010138457 6:72583522-72583544 TGAAGCCAACTTGATCATTGAGG + Intergenic
1010372009 6:75121382-75121404 TGATGCCTCCTGGAGCATTGGGG - Exonic
1010526123 6:76902554-76902576 TGAAGCCCCCTTGATCATGGTGG + Intergenic
1011005116 6:82635840-82635862 TGAAGCCCACTTGATCATTGTGG - Intergenic
1011137055 6:84111948-84111970 TGAAGCCAACTTGATCATTGTGG + Intergenic
1011147747 6:84237302-84237324 TGACGCCAACTTGATCATGGTGG - Intergenic
1011229808 6:85147933-85147955 TGAAGCCAACTTGATCATGGTGG + Intergenic
1011297958 6:85843891-85843913 TGAAGCCAACTTGATCATGGTGG + Intergenic
1011313750 6:86008667-86008689 TGAAGCCAACTTGATCATGGTGG - Intergenic
1011318368 6:86062135-86062157 TGAAGCCAGCTTGATCATGGTGG + Intergenic
1011377308 6:86703435-86703457 TGAAGCCAACTTGATCATGGTGG + Intergenic
1011487666 6:87859836-87859858 TTATTCCTCCTTGATTATTTGGG - Intergenic
1012121849 6:95378629-95378651 TGAAGCCAACTTGATCTTTGTGG - Intergenic
1012279625 6:97313429-97313451 TTTTGCCAACCTGATCATTGGGG + Intergenic
1012573430 6:100760472-100760494 TGAAGCCAACTTGATCGTTGTGG + Intronic
1012608930 6:101191925-101191947 TGAAGCCCACTTGATCATTGTGG - Intergenic
1013319882 6:108977342-108977364 TGAAGCCAACTTGATCATGGTGG + Intergenic
1013379540 6:109554045-109554067 TGAAGCCAACTTGATCATGGTGG + Intronic
1013423483 6:109988381-109988403 TGAAGCCAACTTGATCATGGTGG + Intergenic
1013727461 6:113116868-113116890 TAAAGCCTCCTTGATCATGGTGG - Intergenic
1013882782 6:114925543-114925565 TGAAGCCAACTTGATCATGGTGG + Intergenic
1013957523 6:115857768-115857790 TGAAGCCAACTTGATCATGGTGG - Intergenic
1014123166 6:117749383-117749405 TGAAGCCAACTTGATCATGGTGG - Intergenic
1014184996 6:118424827-118424849 TGAAGCCCACTTGATCATTGTGG - Intergenic
1014274734 6:119374798-119374820 TGAGGCCAACTTGATCATGGTGG + Intergenic
1014301965 6:119693083-119693105 TGAAGCCAACTTGATCATGGTGG + Intergenic
1014422690 6:121264712-121264734 TGAAGCCAGCTTGATCATGGTGG - Intronic
1016338181 6:143031570-143031592 TGAAGCCAACTTGATCATGGTGG + Intergenic
1017279971 6:152612794-152612816 TGAAGCCAGCTTGATCATGGTGG - Intronic
1017876224 6:158526517-158526539 TGAAGCCAACTTGATCATGGCGG - Intergenic
1018113730 6:160562412-160562434 TGAAGCCAACTTGATCATGGTGG + Intronic
1018114281 6:160568285-160568307 TAAAGCCAACTTGATCATGGTGG - Intronic
1018144312 6:160868996-160869018 TGAAGCCAACTTGATCATGGTGG + Intergenic
1018507502 6:164487295-164487317 TGAAGCCAACTTGATCATGGTGG + Intergenic
1018782739 6:167083281-167083303 TGAAGCCCACTTGATCATTGTGG + Intergenic
1018816163 6:167333286-167333308 TGAAGCCCACTTGATCATTGTGG + Intronic
1019071538 6:169350220-169350242 TGAAGCCAACTTGATCATGGTGG + Intergenic
1019072505 6:169360111-169360133 TTAAGCCGACTTGATCATGGTGG - Intergenic
1019241892 6:170672165-170672187 TTCTCCCACCTTGATTTTTGTGG + Intergenic
1020049078 7:5070145-5070167 TCATTCCACCTTACTCATTGAGG + Intronic
1020484607 7:8705836-8705858 TTGTGCCACCATAATCTTTGAGG - Intronic
1020630141 7:10629461-10629483 TGAAGCCAACTTGATCATTTTGG - Intergenic
1020659178 7:10962425-10962447 TGAAGCCAACTTGATCATGGTGG + Intergenic
1020927885 7:14355621-14355643 TGAAGCCAACTTGATCATGGTGG + Intronic
1020945752 7:14603083-14603105 TTATGTGACCTTATTCATTGTGG + Intronic
1021064918 7:16161528-16161550 TGAAGCCAACTTGATCATGGTGG + Intronic
1021224219 7:18009277-18009299 TGAAGCCAACTTGATCATGGTGG + Intergenic
1021322668 7:19230666-19230688 TGAAGCCAACTTGATCATGGTGG - Intergenic
1021431943 7:20570120-20570142 TGATGCCAACATGATCATGGTGG - Intergenic
1021966552 7:25925652-25925674 TGAAGCCAACTTGATCATGGTGG - Intergenic
1022635003 7:32123502-32123524 TGAAGCCAACTTGATCATGGAGG - Intronic
1023195881 7:37638640-37638662 TAAAGCCAACTTGATCATGGTGG + Intergenic
1023465048 7:40445068-40445090 TGAAGCCAACTTGATCATGGTGG + Intronic
1024703143 7:51926596-51926618 TGAAGCCAACTTGATCATGGTGG + Intergenic
1024738439 7:52330534-52330556 TGAAGCCAACTTGATCATGGTGG - Intergenic
1024907596 7:54405587-54405609 TGAAGCCAACTTGATCATGGTGG + Intergenic
1027786214 7:82581992-82582014 TGAAGCCAACTTGATCATGGTGG + Intergenic
1028050384 7:86177727-86177749 TGATGCCAACTTGATCATGGTGG - Intergenic
1028395698 7:90366108-90366130 TGAAGCCAACTTGATCATGGTGG + Intronic
1028436505 7:90810267-90810289 TGATGCCCACTTGATCATGGTGG - Intronic
1028476104 7:91255070-91255092 TGAAGCCAACTTGATCATGGTGG + Intergenic
1029041802 7:97583817-97583839 TGAAGCCAACTTGATCATGGTGG - Intergenic
1029869427 7:103674683-103674705 TGAAGCCAACTTGATCATGGTGG - Intronic
1029888425 7:103899589-103899611 TGAAGCCAACTTGATCATGGTGG - Intronic
1029920732 7:104260109-104260131 GTATGTAACCTTGATTATTGTGG - Intergenic
1030154410 7:106438808-106438830 TGAAGCCCCCTTGATCATGGTGG + Intergenic
1030159856 7:106496121-106496143 TGAAGCCAACTTGATCATGGTGG - Intergenic
1030534389 7:110747545-110747567 TGAAGCCACCTTGATCGTGGTGG - Intronic
1031267663 7:119601730-119601752 TGAAGCCAACTTGATCATGGTGG + Intergenic
1031433956 7:121709804-121709826 TGAAGCCAACTTGATCATGGAGG + Intergenic
1031803692 7:126280163-126280185 TGAAGCCAGCTTGATCATGGTGG + Intergenic
1031829008 7:126603032-126603054 TGAAGCCAACTTGATCATGGTGG - Intronic
1031830227 7:126617173-126617195 TGAAGCCAACTTGATCATGGTGG - Intronic
1032057669 7:128696850-128696872 TTATGCCACTCTGACCATTCTGG + Intergenic
1032764677 7:134979789-134979811 TGAAGCCAGCTTGATCATGGTGG - Intergenic
1033776385 7:144616281-144616303 TGAAGCCAACTTGATCATGGTGG - Intronic
1033863713 7:145662339-145662361 TGAAGCCAACTTGATCATTGTGG - Intergenic
1034918302 7:155058950-155058972 GCATGCCACCTTGATGATTCTGG - Intergenic
1035492031 7:159288250-159288272 TGAAGCCAACTTGATCATGGTGG - Intergenic
1035506226 8:135931-135953 TTCTCCCACCTTGATTTTTGTGG - Intergenic
1035885599 8:3288147-3288169 TGAAGCCCACTTGATCATTGTGG + Intronic
1037065985 8:14578070-14578092 ATACTCCACCTTGAACATTGAGG + Intronic
1037213296 8:16418559-16418581 TGAAGCCAACTTGATCATGGTGG - Intronic
1037214301 8:16429833-16429855 TGAAGCCAACTTGATCATGGTGG + Intronic
1037664889 8:20960012-20960034 TAAAGCCAACTTGATCATCGTGG - Intergenic
1037685430 8:21135306-21135328 TGAAGCCAACTTGATCATGGTGG + Intergenic
1038916891 8:32034294-32034316 TTAAGCCAACTTTATCATGGTGG + Intronic
1039036375 8:33364067-33364089 TGAAGCCAACTTGATCATGGTGG - Intergenic
1039154411 8:34539193-34539215 TGAAGCCAACTTGATCATGGTGG - Intergenic
1039245306 8:35602142-35602164 TTAAGCCCACTTGATCATGGTGG + Intronic
1039642932 8:39243431-39243453 TGATACCAACTTGATCATGGTGG - Intronic
1039849784 8:41354287-41354309 TGAAGCCAACTTGATCATGGTGG + Intergenic
1040123386 8:43707429-43707451 TTAAGCCGACTTGATCATGGTGG + Intergenic
1040411125 8:47155517-47155539 TGAAGCCAACTTGATCATGGTGG - Intergenic
1040842264 8:51796971-51796993 TGATGCCAACTTGATCATGGTGG - Intronic
1041387866 8:57323290-57323312 TGAAGCCCCCTTGATCATGGTGG + Intergenic
1041423897 8:57698905-57698927 TGAAGCCAACTTGATCATGGTGG - Intergenic
1041575063 8:59384625-59384647 TGAAGCCAACTTGATCATGGTGG - Intergenic
1042051797 8:64718042-64718064 TTATACAACCATGATCATTAAGG - Intronic
1042585974 8:70338734-70338756 TGAAGCCACCTTGATCCTGGTGG - Intronic
1042851488 8:73220881-73220903 TGAAGCCAACTTGATCATAGTGG + Intergenic
1042853179 8:73237196-73237218 TGAAGCCAACTTGATCATGGTGG + Intergenic
1043304653 8:78779581-78779603 TGAAGCCAACTTGATCATGGTGG + Intronic
1043381933 8:79711843-79711865 TGAAGCCAACTTGATCATGGTGG - Intergenic
1043848102 8:85184170-85184192 TGAAGCCAACTTGATCATGGTGG - Intronic
1044000969 8:86880822-86880844 TGAAGCCTCCTTGATCATGGTGG - Intronic
1044221548 8:89675914-89675936 TGAAGCCAACTTGATCATGGTGG - Intergenic
1044222189 8:89682158-89682180 TGAAGCCACCTTGATCATGGTGG - Intergenic
1044284011 8:90390547-90390569 TGAAGCCAACTTGATCATGGTGG - Intergenic
1044448865 8:92310702-92310724 TAAAGCCAACTTGATCATGGTGG + Intergenic
1044548602 8:93487023-93487045 TGAAGCCAACTTGATCATGGTGG - Intergenic
1044798355 8:95927443-95927465 CTATGCTACCTTGATCATGAAGG - Intergenic
1044960435 8:97525367-97525389 TGAAGCCAACTTGATCATGGTGG + Intergenic
1044961350 8:97533970-97533992 TGAAGCCAACTTGATCATGGTGG - Intergenic
1045173152 8:99693342-99693364 TGATGCCCACTTGATCATGGTGG - Intronic
1045389102 8:101697592-101697614 TGAAGCCAACTTGATCATGGTGG - Intronic
1045433530 8:102136539-102136561 TGAAGCCCACTTGATCATTGTGG - Intergenic
1045448606 8:102295038-102295060 TTGTGCCACTTTGCTGATTGAGG + Exonic
1045572636 8:103385283-103385305 TGAAGCCAACTTGATCATGGTGG - Intergenic
1045823572 8:106370741-106370763 TGAACCCAACTTGATCATTGTGG + Intronic
1045973736 8:108107945-108107967 TGAAGCCAACTTGATCATGGTGG - Intergenic
1046043429 8:108934222-108934244 TGAAGCCCACTTGATCATTGTGG - Intergenic
1046285274 8:112085609-112085631 TGAAGCCAACTTGATCATGGTGG - Intergenic
1046475358 8:114735372-114735394 TAAAGCCAACTTGATCATGGTGG - Intergenic
1046863783 8:119123703-119123725 TCATGCCACATTCATCATTGTGG + Intergenic
1046901122 8:119524805-119524827 TGAAGCCAACTTGATCATGGTGG - Intergenic
1047604457 8:126461056-126461078 TGAAGCCAGCTTGATCATGGTGG - Intergenic
1047899071 8:129399913-129399935 TGAAGCCAACTTGATCATGGTGG - Intergenic
1048373052 8:133796597-133796619 TGAAGCCAACTTGATCATGGTGG - Intergenic
1050007474 9:1147994-1148016 TGAAGCCAACTTGATCATGGTGG - Intergenic
1050398454 9:5225511-5225533 TGAAGCCAACTTGATCATGGTGG - Intergenic
1050590734 9:7157698-7157720 TGAAGCCAACTTGATCATGGTGG + Intergenic
1051603670 9:18898615-18898637 TGAAGCCAACTTGATCATGGTGG - Intronic
1051703679 9:19853652-19853674 TGAAGCCAACTTGATCATGGTGG + Intergenic
1052134430 9:24892521-24892543 TGAAGCCAACTTGATCATGGTGG - Intergenic
1052154657 9:25169885-25169907 TGAAGCCAACTTGATCATGGTGG - Intergenic
1052478648 9:28993663-28993685 TGATGCCCACTTGATCATGGTGG - Intergenic
1052479770 9:29008829-29008851 TGAAGCCAACTTGATCATGGTGG - Intergenic
1052547003 9:29892400-29892422 TGATGCCAACTTGATCGTTGTGG - Intergenic
1052628665 9:31008553-31008575 TGAAGCCAACTTGATCATGGTGG - Intergenic
1052800380 9:32961603-32961625 TGAAGCCAACTTGATCATGGTGG - Intergenic
1052884906 9:33635715-33635737 TTATACCACTTTTATTATTGTGG - Intergenic
1054794358 9:69285860-69285882 TAAAGCCAACTTGATCATGGTGG + Intergenic
1054886935 9:70208975-70208997 TGAAGCCAACTTGATCATGGTGG + Intronic
1055234421 9:74103152-74103174 TGAAGCCAACTTGATCATGGTGG - Intergenic
1055276219 9:74619885-74619907 TGAAGCCAACTTGATCATGGTGG + Intronic
1055333151 9:75204975-75204997 TGAAGCCCCCTTGATCATGGTGG + Intergenic
1056222031 9:84459349-84459371 TGAAGCCAGCTTGATCATGGTGG + Intergenic
1056945808 9:90995538-90995560 TGAAGCCAACTTGATCATGGTGG + Intergenic
1057639204 9:96800821-96800843 TGAAGCCCCCTTGATCATGGTGG - Intergenic
1058889050 9:109345250-109345272 TTGTGCCATCTTCATCCTTGAGG + Intergenic
1058925794 9:109662511-109662533 TGAAGCCAACTTGATCATGGTGG + Intronic
1060415686 9:123428198-123428220 TGAAGCCAACTTGATCATGGTGG - Intronic
1203532432 Un_GL000213v1:158994-159016 TGAAGCCAACTTGATCATGGTGG + Intergenic
1203602083 Un_KI270748v1:21399-21421 TTCTCCCACCTTGATTTTTGTGG + Intergenic
1185549126 X:969524-969546 TGCTGCCTCCTTGCTCATTGGGG - Intergenic
1186678424 X:11845676-11845698 TGAAGCCCACTTGATCATTGTGG - Intergenic
1187634774 X:21215196-21215218 TAAAGCCAACTTGATCATGGTGG - Intergenic
1187644581 X:21333186-21333208 TGAAGCCAACTTGATCATGGTGG - Intergenic
1187646453 X:21352475-21352497 TGAAGCCAACTTGATCATGGTGG - Intergenic
1188664509 X:32802816-32802838 TGAAGCCAACTTGATCATGGTGG + Intronic
1188718346 X:33490417-33490439 ATATGCCTAATTGATCATTGTGG + Intergenic
1189734229 X:44053170-44053192 TGAAGCCACCTTGATCGTGGTGG + Intergenic
1189939112 X:46102949-46102971 TGAAGCCAACTTGATCATGGTGG + Intergenic
1189978075 X:46482395-46482417 TGAAGCCAACTTGATCATGGTGG + Intronic
1190467270 X:50737975-50737997 TGATGCCCACTTGATCATGGTGG - Intronic
1190518186 X:51246920-51246942 TGAAGCCCACTTGATCATTGTGG - Intergenic
1190592869 X:52022781-52022803 TGAAGCCCACTTGATCATTGTGG + Intergenic
1190621903 X:52295565-52295587 TGAAGCCCACTTGATCATTGTGG - Intergenic
1190840979 X:54143960-54143982 TGAAGCCAGCTTGATCATGGTGG - Intronic
1190972142 X:55360296-55360318 TGAAGCCAACTTGATCATGGTGG - Intergenic
1190979848 X:55447055-55447077 TGAAGCCAACTTGATCATGGTGG - Intergenic
1191032469 X:55989547-55989569 TGAAGCCCCCTTGATCATGGTGG + Intergenic
1191092976 X:56643519-56643541 TTAAGCCTACTTGATCATGGTGG + Intergenic
1191093619 X:56651403-56651425 TAAAGCCAACTTGATCATGGCGG + Intergenic
1191098809 X:56703044-56703066 TGAAGCCAACTTGATCATGGAGG - Intergenic
1191156073 X:57274552-57274574 TGAAGCCAACTTGATCATAGTGG - Intergenic
1191203757 X:57812617-57812639 TGAAGCCAACTTGATCATGGTGG + Intergenic
1191209172 X:57866940-57866962 TGAAGCCCACTTGATCATTGTGG - Intergenic
1191595536 X:62939574-62939596 TGAAGCCAACTTGATCATGGTGG + Intergenic
1191610487 X:63106718-63106740 TGAAGCCACCTTGATCGTTGTGG - Intergenic
1191747537 X:64506352-64506374 TGAAGCCAACTTGATCATGGTGG - Intergenic
1191774565 X:64799692-64799714 TGAAGCCAACTTGATCATGGTGG + Intergenic
1191832015 X:65425805-65425827 TGAAGCCAACTTGATCATGGTGG + Intronic
1191882094 X:65853029-65853051 TGAAGCCAACTTGATCATGGTGG + Intergenic
1192055988 X:67773875-67773897 TGATGCCTACTTGATCATGGTGG - Intergenic
1192524896 X:71833744-71833766 TGAAGCCAACTTGATCATGGTGG - Intergenic
1192655069 X:72984524-72984546 TGAAGCCAACTTGATCATGGTGG - Intergenic
1192692448 X:73378462-73378484 TGAAGCCAACTTGATCATTGTGG - Intergenic
1192883236 X:75310183-75310205 TGATGCCCACTTGATCATGGTGG + Intergenic
1192887491 X:75350785-75350807 TTATGCCAACTTGATCGTGGTGG + Intergenic
1192925974 X:75755532-75755554 TGAAGCCAACTTGATCATGGTGG - Intergenic
1192943778 X:75942214-75942236 TGAAGCCAACTTGATCATGGTGG + Intergenic
1192997174 X:76524161-76524183 TGAAGCCAACTTGATCATGGTGG + Intergenic
1193010852 X:76673424-76673446 TGAAGCCAACTTGATCATGGTGG - Intergenic
1193094477 X:77531427-77531449 TGACGCCATCTTGATCATGGTGG - Intronic
1193171711 X:78344932-78344954 TAAAGCCAGCTTGATCATGGTGG - Intergenic
1193343428 X:80379292-80379314 TTAAGCCAACTTGATCTTGGTGG + Intronic
1193409670 X:81147293-81147315 TGAAGCCAACTTGATCATGGTGG - Intronic
1193510366 X:82391892-82391914 TGAAGCCAACTTGATCATGGTGG - Intergenic
1193516689 X:82474436-82474458 TGAAGCCAACTTGATCATGGTGG + Intergenic
1193588976 X:83364041-83364063 TGAAGCCAACTTGATCATGGTGG + Intergenic
1193594613 X:83431211-83431233 TGAAGCCAACTTGATCATGGAGG + Intergenic
1193625666 X:83817568-83817590 TAAAGCCAATTTGATCATTGTGG + Intergenic
1193727837 X:85063709-85063731 TGAAGCCAACTTGATCATGGTGG + Intronic
1193835309 X:86336093-86336115 TGAAGCCAACTTGATCATGGTGG + Intronic
1193973497 X:88087817-88087839 TTTAGCCAACTTGATCATGGTGG + Intergenic
1194098936 X:89677920-89677942 TGAAGCCAACTTGATCATAGTGG - Intergenic
1194151391 X:90328683-90328705 TGAAGCCTCCTTGATCATGGTGG - Intergenic
1194228836 X:91296857-91296879 TGAAGCCAACTTGATCATGGTGG + Intergenic
1194263673 X:91730177-91730199 TGAAGCCACCTTGATCATGGTGG + Intergenic
1194489963 X:94533694-94533716 TGATGCTAACTTGATCATGGTGG - Intergenic
1194550904 X:95297870-95297892 TAAAGCCAACTTGATCATGGTGG - Intergenic
1194761425 X:97800261-97800283 TGAAGCCAACTTGATCATGGTGG + Intergenic
1194782790 X:98045695-98045717 TGAAGCCAACTTGATCATGGTGG + Intergenic
1194954080 X:100158943-100158965 TTATGCTGACTTGATCATGGTGG + Intergenic
1195098359 X:101528130-101528152 TGAAGCCAACTTGATCATGGTGG - Intronic
1195518795 X:105807822-105807844 TGAAGCCAACTTGATCATGGTGG + Intergenic
1196094865 X:111788210-111788232 TAAAGCCAACTTGATCATGGTGG - Intronic
1196132370 X:112171090-112171112 TGAAGCCATCTTGATCATGGTGG + Intergenic
1196139257 X:112243035-112243057 TGAAGCCACCTTGATCTTGGTGG + Intergenic
1196147059 X:112329806-112329828 TGAAGCCACCTTGATCTTGGTGG - Intergenic
1196524402 X:116715321-116715343 TAATGCCTACTTGATCATTGTGG - Intergenic
1197107576 X:122733858-122733880 TGAAGCCAACTTGATCATGGTGG - Intergenic
1197486060 X:127053165-127053187 TGAAGCCAACTTGATCATGGTGG + Intergenic
1197573713 X:128181476-128181498 TGAAGCCAACTTGATCATAGTGG - Intergenic
1197594108 X:128446134-128446156 TGAAGCCAACTTGATCATGGTGG + Intergenic
1197959958 X:131993290-131993312 TGAAGCCAACTTGATCATGGTGG - Intergenic
1197991643 X:132325146-132325168 TGAAGCCAACTTGATCATGGTGG - Intergenic
1198328878 X:135602817-135602839 TGAAGCCAACTTGATCATGGTGG + Intergenic
1198335477 X:135661858-135661880 TGAAGCCAACTTGATCATGGTGG + Intergenic
1198337615 X:135682438-135682460 TGAAGCCAACTTGATCATGGTGG - Intergenic
1198418214 X:136442616-136442638 TGAAGCCCACTTGATCATTGTGG + Intergenic
1198595815 X:138234516-138234538 TGAAGCCAACTTGATCATGGTGG - Intergenic
1198621590 X:138517890-138517912 TGAAGCCAACTTGATCATGGTGG - Intergenic
1198725492 X:139672659-139672681 TGAAGCCAACTTGATCATGGTGG + Intronic
1198919055 X:141705034-141705056 TGAAGCCAACTTGATCATGGTGG + Intergenic
1199131988 X:144200123-144200145 TGATGCCTACTTGATCATGGTGG + Intergenic
1199302572 X:146230287-146230309 TGAAGCCAACTTGATCATGGTGG + Intergenic
1199437644 X:147830594-147830616 TGAAGCCAACTTGATCATGGTGG - Intergenic
1199450262 X:147971219-147971241 TGAAGCCAACTTGATCATGGTGG - Intergenic
1199801570 X:151256511-151256533 TGAAGCCAACTTGATCATGGTGG - Intergenic
1199812768 X:151367035-151367057 TGAAGCCAACTTGATCATGGTGG + Intergenic
1199937147 X:152585683-152585705 TGAAGCCCCCTTGATCATGGTGG - Intergenic
1200099057 X:153680214-153680236 AGACGCCACCTTGAACATTGGGG - Intronic
1200269371 X:154667467-154667489 TGAAGCCAACTTGATCATGGTGG + Intergenic
1200371071 X:155725163-155725185 TAAAGCCAACTTGATCATGGTGG + Intergenic
1200739926 Y:6843205-6843227 TGAAGCCAACTTGATCATAGTGG + Intergenic
1200741626 Y:6860363-6860385 TTAAGCTGACTTGATCATTGTGG + Intergenic
1200772340 Y:7138391-7138413 TGAGGCCCACTTGATCATTGTGG - Intergenic
1200858851 Y:7968512-7968534 TTATGCCACATTGCTCCATGTGG + Intergenic
1201182489 Y:11362589-11362611 GGATGCCAACTTGATCATGGTGG - Intergenic
1201186165 Y:11405043-11405065 TTAAGCCTACTTGATCATGGTGG + Intergenic
1201627392 Y:16029704-16029726 TGAAGCCCACTTGATCATTGTGG - Intergenic
1201647373 Y:16250269-16250291 TGAAGCCAACTTGATCATGGTGG - Intergenic
1201655438 Y:16335032-16335054 TGAAGCCAACTTGATCATGGTGG + Intergenic
1201732199 Y:17216528-17216550 TGAAGCCTCCTTGATCATGGTGG - Intergenic
1201740173 Y:17315422-17315444 TGAAGCCTCCTTGATCATGGTGG - Intergenic
1201756829 Y:17495252-17495274 TGAAGCCATCTTGATCATGGTGG - Intergenic
1201844724 Y:18410732-18410754 TGAAGCCATCTTGATCATGGTGG + Intergenic
1201932221 Y:19363116-19363138 TGAAGCCAACTTGATCATGGTGG - Intergenic
1202034409 Y:20617196-20617218 TGAAGCCAACTTGATCATGGTGG + Intergenic
1202248950 Y:22849586-22849608 TGAAGCCCACTTGATCATTGTGG + Intergenic
1202374887 Y:24225665-24225687 TTAAGCCCACTTGATCATGGTGG - Intergenic
1202401938 Y:24483334-24483356 TGAAGCCCACTTGATCATTGTGG + Intergenic
1202468843 Y:25186749-25186771 TGAAGCCCACTTGATCATTGTGG - Intergenic
1202495893 Y:25444455-25444477 TTAAGCCCACTTGATCATGGTGG + Intergenic