ID: 975726194

View in Genome Browser
Species Human (GRCh38)
Location 4:77294095-77294117
Sequence ATGGCTAATGACTCTATTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975726191_975726194 6 Left 975726191 4:77294066-77294088 CCTCAATGATCAAGGTGGCATAA 0: 1
1: 0
2: 0
3: 37
4: 874
Right 975726194 4:77294095-77294117 ATGGCTAATGACTCTATTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975726194 Original CRISPR ATGGCTAATGACTCTATTCT GGG Intronic
No off target data available for this crispr