ID: 975728462

View in Genome Browser
Species Human (GRCh38)
Location 4:77315397-77315419
Sequence GTGTAAACACAGTTGGGCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 122}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975728457_975728462 24 Left 975728457 4:77315350-77315372 CCCTAAAACTTAAAGTATAATAA 0: 13628
1: 11495
2: 6190
3: 3554
4: 2856
Right 975728462 4:77315397-77315419 GTGTAAACACAGTTGGGCTTGGG 0: 1
1: 0
2: 1
3: 13
4: 122
975728458_975728462 23 Left 975728458 4:77315351-77315373 CCTAAAACTTAAAGTATAATAAA 0: 4143
1: 17745
2: 12044
3: 7139
4: 5709
Right 975728462 4:77315397-77315419 GTGTAAACACAGTTGGGCTTGGG 0: 1
1: 0
2: 1
3: 13
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975728462 Original CRISPR GTGTAAACACAGTTGGGCTT GGG Intronic
900421089 1:2556264-2556286 GGGGAAACACAGATGGACTTTGG + Intronic
901200739 1:7465744-7465766 GAGGAAACACAGTTGGTGTTTGG + Intronic
904101910 1:28037575-28037597 GTGAAAACACATTTGAGCTTTGG - Intronic
911935293 1:103961293-103961315 GGGGAATCACAGTTGGGCTGTGG - Intergenic
912139618 1:106707192-106707214 GTGAAAAGAAAATTGGGCTTAGG - Intergenic
913329668 1:117656588-117656610 GTGTAAACACAGTAGCACTTGGG - Intergenic
915953856 1:160207384-160207406 GTGGAAACAGAGATGGGCTGGGG + Intronic
916004851 1:160650409-160650431 TTGTAAACACAGTTTGGCTGTGG + Intergenic
919861312 1:201740801-201740823 GTGTAACCACAGCTGGCCCTGGG + Intronic
920248406 1:204605687-204605709 GTGGAAACACAGTGTTGCTTTGG + Intergenic
924495103 1:244580626-244580648 GGGAAAACACAGGAGGGCTTTGG - Intronic
1068520387 10:58071022-58071044 GTTTATTCACAGTGGGGCTTTGG - Intergenic
1069913946 10:71775703-71775725 GTTTGAACAGAGTTGGGCCTTGG - Intronic
1073460555 10:103663430-103663452 ATGGAAAGACAGATGGGCTTGGG - Intronic
1074875850 10:117612839-117612861 GTGATTACACAGATGGGCTTCGG + Intergenic
1075482278 10:122792137-122792159 GTGTAGACACAGTTGTGGTTTGG - Intergenic
1076267669 10:129121497-129121519 CTGGAACCACAGTGGGGCTTGGG + Intergenic
1078542694 11:12224418-12224440 GCCTAAACACAGTAGGTCTTAGG + Intronic
1086284930 11:85236821-85236843 GATTAGACACATTTGGGCTTAGG - Intronic
1090001538 11:122964639-122964661 GTGGAAACACAGTTAGCGTTAGG - Intergenic
1092013880 12:5140236-5140258 GTGTAAACACTTTTGGGGGTGGG + Intergenic
1093845031 12:23960191-23960213 GTGTAAACATATGTGGGCTCTGG - Intergenic
1095089109 12:38087640-38087662 GTGTATACACTCATGGGCTTGGG - Intergenic
1095970083 12:47895688-47895710 GTGTAATCACTGTTGGTGTTGGG - Intronic
1096122507 12:49097409-49097431 GTGTAAACAGATTTGGGATCAGG + Exonic
1097815901 12:64073013-64073035 AGGAAAACACAGTTGGGTTTTGG - Intronic
1099513334 12:83565275-83565297 GTGAAAATACAGATGGGATTTGG + Intergenic
1100125043 12:91414502-91414524 GGGTAAACCCAGCTGTGCTTTGG - Intergenic
1102476037 12:113189151-113189173 GTGTAGAGACATTTGGGGTTAGG + Intronic
1104544940 12:129702049-129702071 GTGTTATCACAGCTGGGCTGAGG - Intronic
1105487129 13:20845764-20845786 TTTTAAACACAGCTAGGCTTTGG + Intronic
1107185385 13:37512889-37512911 GTGAAGAAACAGTTGTGCTTTGG - Intergenic
1107826775 13:44335685-44335707 GTGTGTACACAGATGGGCTCTGG + Intergenic
1109808152 13:67471013-67471035 GGGCAAAAACAGTTGGGCTGTGG + Intergenic
1110973498 13:81798728-81798750 AGGTAATCACAGTGGGGCTTAGG - Intergenic
1114223787 14:20720502-20720524 CGGTACACACAGTTGGGCATTGG - Intergenic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1121967480 14:98324016-98324038 CTGTAACCACAGTTGGCCTCTGG - Intergenic
1202890065 14_KI270722v1_random:148408-148430 AAGAAAACACAGTTGGGCCTGGG + Intergenic
1123582505 15:21729657-21729679 GTGCAAACACATTAGGGATTTGG + Intergenic
1123619155 15:22172253-22172275 GTGCAAACACATTAGGGATTTGG + Intergenic
1128554685 15:68623451-68623473 GTGTAAACACAGCTGTGGGTGGG - Intronic
1128638689 15:69319595-69319617 TTGGAAACACAGCTGGGCTTGGG + Intronic
1130767941 15:86891804-86891826 GTTAAAATACAGCTGGGCTTTGG - Intronic
1134103442 16:11469139-11469161 GTGCAGACACAGGTGGGCCTAGG + Intronic
1142413937 16:89931167-89931189 GTGTAGACAAAGATGCGCTTTGG - Intronic
1142616448 17:1139053-1139075 TTGTAAACACAGTTATGCTTAGG + Intronic
1143599273 17:7933234-7933256 GGGTAAATACAGCTGGGCTCGGG - Exonic
1143892289 17:10111757-10111779 TTGGAAACACAATTGGGGTTAGG - Intronic
1148474607 17:47919697-47919719 GTGAAAACACAGTGGGGTCTTGG - Intronic
1156883788 18:42111078-42111100 GTTTACACACAGTTTGGCTTGGG + Intergenic
1157635610 18:49150529-49150551 GTGTCAGCACAGTTGGGTTCTGG - Intronic
1158241504 18:55383805-55383827 GTGTAATGACAGTAGTGCTTTGG - Intronic
1158388140 18:57018231-57018253 CTCTACACAGAGTTGGGCTTTGG + Intronic
1163803467 19:19382279-19382301 GTGCAAACACAGTTGGGGCTGGG + Intergenic
1164672125 19:30078151-30078173 GTGTTACCACAGGTGGGCATTGG - Intergenic
1165252353 19:34550389-34550411 GTGTCAGCAGAGTTGGGTTTTGG + Intergenic
1165257278 19:34586103-34586125 TTATAAACACAGTTGAGTTTTGG + Intergenic
1165472568 19:36011652-36011674 TGGTAGACACAGGTGGGCTTTGG - Intronic
1166447552 19:42871481-42871503 CTGTGAACACAGTGGGGATTTGG - Intronic
1166908276 19:46131470-46131492 TTGTAAACATTGTTTGGCTTTGG + Intergenic
926620269 2:15041025-15041047 ATGTGATCACAGTTGAGCTTTGG - Intergenic
927510293 2:23640115-23640137 ATGTCCTCACAGTTGGGCTTAGG + Intronic
929170101 2:38923264-38923286 GAGTAAACAGACTGGGGCTTAGG - Intronic
931252010 2:60540321-60540343 GTAAAAACAGACTTGGGCTTGGG + Intronic
932280959 2:70491473-70491495 ATGGAAGCACAGGTGGGCTTTGG - Intronic
933823572 2:86137984-86138006 GTTCTAACACAGTTGGGGTTGGG + Exonic
936767040 2:115864783-115864805 GTGCAAAACCAGTTGGGGTTGGG + Intergenic
938990552 2:136623974-136623996 TTGTAACCAGATTTGGGCTTTGG - Intergenic
941774223 2:169374466-169374488 CTGTAAACACTGGTGGGCTGAGG - Intergenic
941844971 2:170123336-170123358 GTGTGAACACAGGTGTGTTTGGG + Intergenic
943416704 2:187615841-187615863 GTGTAAACACACGTGTGCTTGGG + Intergenic
946334373 2:219027681-219027703 GTGTAAAGGCAGTTGGGGTGAGG + Exonic
946436482 2:219659676-219659698 GAGTAAACACAGAGGGGCTGAGG - Intergenic
948201337 2:236131465-236131487 GTGTATCCACAGATGGGTTTAGG + Exonic
948471380 2:238182801-238182823 GTCTAAACACATGTGGGCTAAGG + Intronic
948663269 2:239519749-239519771 GTGAAAACACACCTGGGCTGGGG + Intergenic
1170662255 20:18353439-18353461 CTGTAAAGTCAGCTGGGCTTGGG + Intergenic
1170940578 20:20845076-20845098 GTGTAAACACAGAAGGGATCTGG + Intergenic
1172909733 20:38399087-38399109 GTGTAGACAGAGCTGGGCGTGGG + Intergenic
1183739359 22:39661560-39661582 GGGTAAAAAGAGCTGGGCTTTGG + Intronic
950251409 3:11468703-11468725 GTGGGACCACAGGTGGGCTTGGG + Intronic
952794747 3:37228954-37228976 CTGAAAAGACAGTTTGGCTTGGG + Intergenic
953504740 3:43473932-43473954 GTGACAACACAGCTGGGCTGAGG + Intronic
955932257 3:64068784-64068806 GGGAAAACTCACTTGGGCTTTGG + Intergenic
959399470 3:105882403-105882425 CTGGAAACTCAGTTGGGCCTGGG - Intergenic
961954708 3:130789533-130789555 GTGAAAACAAAACTGGGCTTGGG + Intergenic
963088742 3:141462647-141462669 TTGTTGACACAGCTGGGCTTTGG - Intergenic
963377721 3:144491505-144491527 GTGTGAGCATAGTTGGGCTCTGG - Intergenic
966667317 3:182486642-182486664 ATGTAAACATTGCTGGGCTTTGG + Intergenic
967496746 3:190150319-190150341 GTGTAAACACAGTCTGAATTTGG + Intergenic
969153102 4:5187046-5187068 GGGAAAACACAGCTGGGCTTGGG + Intronic
972047867 4:34691877-34691899 GGAAGAACACAGTTGGGCTTAGG + Intergenic
972200214 4:36705148-36705170 GTCTAAATCCAGTTGGCCTTGGG - Intergenic
972408184 4:38766200-38766222 GTCAAAACACAGATGGGCATAGG + Intergenic
975051416 4:69869582-69869604 ATGTAAAAAAAGTTGAGCTTTGG - Intergenic
975728462 4:77315397-77315419 GTGTAAACACAGTTGGGCTTGGG + Intronic
975998605 4:80344528-80344550 GTGTAAATACATCTGGTCTTGGG - Intronic
978522839 4:109634535-109634557 GTGGTAACACTGCTGGGCTTAGG - Intronic
981288554 4:143047370-143047392 GTGAAAAAACAGTTGGCCTAGGG + Intergenic
981383736 4:144102842-144102864 GTGTAAACAAAATTATGCTTTGG + Intergenic
981809625 4:148759066-148759088 AGGTAAACACAGCTGGGCCTGGG - Intergenic
983893030 4:173050642-173050664 GTGTAAATACAGTTGAGCTATGG + Intergenic
984370958 4:178863792-178863814 GTTTTAACACAGGTGGGCTCTGG - Intergenic
985534211 5:454237-454259 GTTTGAACACTGTTGTGCTTGGG + Intronic
988097643 5:26638165-26638187 TTTTAAACACAGTTGAGCTTTGG - Intergenic
990879673 5:60525154-60525176 GTGTCAACTTGGTTGGGCTTAGG + Intergenic
993257739 5:85615777-85615799 GTGTACTCACAGTTCTGCTTTGG + Intergenic
1004409318 6:15366039-15366061 GTGTAAACAAAAATGGGGTTGGG - Intronic
1005684713 6:28242738-28242760 GTGTATACACACTTAGGCTTAGG - Intergenic
1006076130 6:31533872-31533894 GTGTTAGGAAAGTTGGGCTTTGG - Intronic
1008662864 6:53686942-53686964 GTGTGTACACAGTTTGGGTTTGG + Intergenic
1009845930 6:69134440-69134462 GTGAAAACATATTTGGGATTGGG + Intronic
1012887568 6:104862595-104862617 GGTTATACACAGTTGGACTTGGG - Intergenic
1016039880 6:139421879-139421901 GGGTTAACAAAGTTAGGCTTTGG - Intergenic
1017477827 6:154816202-154816224 GTGGAGACACAGCTGGACTTAGG + Intronic
1018408652 6:163517222-163517244 TTGTAAACCCAGTTGGTGTTTGG + Intronic
1018585357 6:165351164-165351186 CTTTATACACAATTGGGCTTTGG + Intronic
1019067574 6:169315204-169315226 GTGTGAACAGAGGTGGGCGTTGG - Intergenic
1019067617 6:169315562-169315584 GTGTGAACAGAGGTGGGCGTTGG - Intergenic
1024901813 7:54326791-54326813 TTTAAAACACAGCTGGGCTTTGG - Intergenic
1027488512 7:78791866-78791888 GTGCAAACACAGTAGGGGGTAGG + Intronic
1030067748 7:105673439-105673461 GTGTAAGCACACTTGGGCTTAGG + Intronic
1030740134 7:113099669-113099691 GTTTAAACACAGATGGACTATGG + Intergenic
1031380045 7:121074406-121074428 GTGAAAGCGCAGTTGGGTTTAGG - Intronic
1033016254 7:137674564-137674586 TTGTAAATACTGGTGGGCTTAGG - Intronic
1035607744 8:940104-940126 GTGGAAAGACAGTGGGGCGTGGG + Intergenic
1036077018 8:5513450-5513472 GTGGGAACACAGGTGGGATTGGG + Intergenic
1042074037 8:64968418-64968440 GTGGAAACAACTTTGGGCTTTGG - Intergenic
1045179496 8:99764885-99764907 GTGCACACACACTTGTGCTTTGG + Intronic
1047447180 8:124929995-124930017 CTGGAAAGACAGTTGGGCTCTGG - Intergenic
1058117036 9:101096122-101096144 GTGTAAACAGTGGTGTGCTTGGG + Intronic
1058438309 9:104984602-104984624 GTGTAAAAACAGTGGGCCTGAGG - Intergenic
1198641825 X:138764464-138764486 GTGTAAACATAGATGGCATTGGG - Intronic
1201725931 Y:17152240-17152262 GGGTAAGCACTTTTGGGCTTTGG + Intergenic
1201767480 Y:17585844-17585866 ATGTGAACACAGATGGGCTGGGG - Intergenic
1201834073 Y:18320141-18320163 ATGTGAACACAGATGGGCTGGGG + Intergenic