ID: 975728897

View in Genome Browser
Species Human (GRCh38)
Location 4:77318963-77318985
Sequence TAGCGCTACAACTCACAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 27
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 25}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975728897_975728904 30 Left 975728897 4:77318963-77318985 CCCACCTGTGAGTTGTAGCGCTA 0: 1
1: 0
2: 0
3: 1
4: 25
Right 975728904 4:77319016-77319038 TAATTCCTCTCCTACTGGTAAGG 0: 1
1: 1
2: 0
3: 10
4: 101
975728897_975728900 -1 Left 975728897 4:77318963-77318985 CCCACCTGTGAGTTGTAGCGCTA 0: 1
1: 0
2: 0
3: 1
4: 25
Right 975728900 4:77318985-77319007 AATCCTAACTTAAAATCTTGTGG 0: 1
1: 0
2: 5
3: 72
4: 308
975728897_975728903 25 Left 975728897 4:77318963-77318985 CCCACCTGTGAGTTGTAGCGCTA 0: 1
1: 0
2: 0
3: 1
4: 25
Right 975728903 4:77319011-77319033 AGAAGTAATTCCTCTCCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975728897 Original CRISPR TAGCGCTACAACTCACAGGT GGG (reversed) Intronic
1072521001 10:96230041-96230063 CAGATCTAAAACTCACAGGTTGG + Intronic
1100987522 12:100217565-100217587 CAGCACTACAGCTCACAGATTGG + Intronic
1110142280 13:72145229-72145251 TAGCTCTACAACTGACAGTGAGG + Intergenic
1114639118 14:24207233-24207255 AAGGGCTACAACCCACAGGCTGG - Exonic
1138870234 16:60874442-60874464 TATCTCTAGCACTCACAGGTGGG + Intergenic
1147872059 17:43594433-43594455 GAGCTCTACAACTAGCAGGTTGG - Intergenic
1149048082 17:52270785-52270807 TATCACTGCAACCCACAGGTAGG - Intergenic
1155142315 18:23054494-23054516 TAGCGACACAACTCAGATGTTGG + Intergenic
934210053 2:89967736-89967758 TATAGCTTCAACGCACAGGTAGG + Intergenic
945369945 2:209004259-209004281 TAGGGCTTCAACTCAAAGCTTGG - Intergenic
946535140 2:220619584-220619606 TAGAGCTGCAACTCTCAAGTTGG + Intergenic
1172437941 20:34943187-34943209 TAGCTCTACCACTCACTAGTAGG + Intronic
1181717879 22:24747503-24747525 TAGAGCAACAACTCACAGAATGG + Intronic
1182882401 22:33744859-33744881 TGGCTCTGCCACTCACAGGTTGG + Intronic
956927201 3:74002330-74002352 TAGAGACACAACTCACAGGCTGG + Intergenic
966329483 3:178794755-178794777 GAGGGCTGGAACTCACAGGTGGG + Intronic
971424931 4:26506752-26506774 TAGAGCTAGAACCGACAGGTAGG - Intergenic
975728897 4:77318963-77318985 TAGCGCTACAACTCACAGGTGGG - Intronic
975735027 4:77372685-77372707 CAGAGCTACAACTCACAAGTGGG - Intronic
985296779 4:188444661-188444683 AAGCTCTACAAAGCACAGGTTGG + Intergenic
988136717 5:27181621-27181643 TTGAGTTACAACTTACAGGTGGG - Intergenic
1003952428 6:11128459-11128481 AAGCAGTACAGCTCACAGGTCGG - Intronic
1007427582 6:41757383-41757405 TACTGCTACAGCTCACAGGAGGG + Intergenic
1018214930 6:161517790-161517812 TAGCTCTACTTATCACAGGTAGG - Intronic
1022138656 7:27473135-27473157 TATTGATACAACTCAAAGGTGGG - Intergenic
1049748295 8:144272225-144272247 CAGAGCTACAACTTCCAGGTGGG + Intronic
1187631451 X:21177345-21177367 TATCACTACAAAACACAGGTTGG + Intergenic