ID: 975728900

View in Genome Browser
Species Human (GRCh38)
Location 4:77318985-77319007
Sequence AATCCTAACTTAAAATCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 386
Summary {0: 1, 1: 0, 2: 5, 3: 72, 4: 308}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975728898_975728900 -2 Left 975728898 4:77318964-77318986 CCACCTGTGAGTTGTAGCGCTAA 0: 1
1: 0
2: 0
3: 6
4: 33
Right 975728900 4:77318985-77319007 AATCCTAACTTAAAATCTTGTGG 0: 1
1: 0
2: 5
3: 72
4: 308
975728899_975728900 -5 Left 975728899 4:77318967-77318989 CCTGTGAGTTGTAGCGCTAATCC 0: 1
1: 0
2: 0
3: 0
4: 13
Right 975728900 4:77318985-77319007 AATCCTAACTTAAAATCTTGTGG 0: 1
1: 0
2: 5
3: 72
4: 308
975728897_975728900 -1 Left 975728897 4:77318963-77318985 CCCACCTGTGAGTTGTAGCGCTA 0: 1
1: 0
2: 0
3: 1
4: 25
Right 975728900 4:77318985-77319007 AATCCTAACTTAAAATCTTGTGG 0: 1
1: 0
2: 5
3: 72
4: 308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975728900 Original CRISPR AATCCTAACTTAAAATCTTG TGG Intronic
900202571 1:1417336-1417358 AATGGTAACTTTTAATCTTGTGG - Intergenic
902031958 1:13429603-13429625 TATCCTAACTTCTAATCTTATGG + Intergenic
904303432 1:29571110-29571132 AATCAGAATCTAAAATCTTGAGG - Intergenic
904570133 1:31457896-31457918 TATCCTAACTTCTAATCTTGTGG - Intergenic
904713086 1:32446299-32446321 TATCCTAACTTCTAATATTGTGG - Intergenic
905511389 1:38523532-38523554 AATCCTAACTTAGAATATTTAGG - Intergenic
908144852 1:61229756-61229778 AAACCTTACTAAAAATCATGTGG + Intronic
908300918 1:62760509-62760531 TATCCTAACTTCTAATCTTGTGG + Intergenic
908666474 1:66496833-66496855 ACTTCTAACTTAAAATCTCATGG + Intergenic
909140905 1:71863929-71863951 AATACCAACTTAAAATGTTGTGG - Intronic
909406415 1:75295434-75295456 TATCCTAAATTAAAATCTCAGGG - Intronic
910295508 1:85640924-85640946 CAACCTAACTTTAAATCTCGAGG + Intergenic
910467170 1:87512566-87512588 AATCAAACCTCAAAATCTTGTGG - Intergenic
910808219 1:91209914-91209936 TATCCTAACTTCTAATCTTGTGG - Intergenic
916084169 1:161256589-161256611 TATCCTAACTTCTAATCTTGTGG + Intergenic
916520523 1:165559621-165559643 AATCCTAACTTAATATCCATAGG + Intronic
917227827 1:172802867-172802889 TATCCTAACTTCTAATCTTATGG + Intergenic
917232183 1:172849987-172850009 TACCCTAACTTCTAATCTTGTGG - Intergenic
917311905 1:173687545-173687567 TATCCTAACTTCTAATCTTGTGG - Intergenic
918326937 1:183418792-183418814 ATTTCTCACTTAAAATTTTGAGG - Intergenic
918710620 1:187724193-187724215 AATCCTAAAATAAAATTTTAAGG - Intergenic
918898983 1:190387928-190387950 AATCCAAAATTAAACTATTGTGG + Intronic
919172954 1:193979263-193979285 CTTCATAACTTAATATCTTGAGG + Intergenic
919559206 1:199096688-199096710 TATCCTAACTTCCAATCTTGTGG + Intergenic
920766814 1:208841540-208841562 AATCCAAACTTACATTCCTGGGG - Intergenic
921039835 1:211419578-211419600 AATACAAAGTTAAAATATTGAGG + Intergenic
921731559 1:218585239-218585261 AATAATAGCTTAAAATGTTGGGG - Intergenic
923027836 1:230220006-230220028 ATTCCTCACTTAAATTCTTAGGG + Intronic
923709083 1:236370810-236370832 AACCATAATTTATAATCTTGTGG + Intronic
923902692 1:238345376-238345398 CAACCTAACTTTACATCTTGAGG - Intergenic
924483714 1:244460237-244460259 AAACCTGATTTCAAATCTTGTGG - Intronic
924735514 1:246752168-246752190 GATCCTAACTTCTAATCTTGTGG - Intronic
1063079997 10:2758395-2758417 AATCATAATTTATAAACTTGAGG - Intergenic
1063332267 10:5172454-5172476 TATCCTTACTTTTAATCTTGTGG - Intergenic
1063777485 10:9280678-9280700 AATCCTTACTTAAAACTTTGGGG + Intergenic
1065007571 10:21393975-21393997 AACCATAATTTATAATCTTGTGG - Intergenic
1065082925 10:22145108-22145130 TATCCTAACTTCTACTCTTGTGG + Intergenic
1065396495 10:25244388-25244410 ACTCCTACCTTAAAATCTGATGG - Intronic
1065496474 10:26334203-26334225 TATCCTAACTTATAATCTTGTGG + Intergenic
1068383217 10:56287800-56287822 ACTCCTAGCATAAAATCTTATGG + Intergenic
1068383222 10:56287860-56287882 AATCCTAGCATACAATCTTCTGG + Intergenic
1071221065 10:83464769-83464791 TATCCTAACTTCTAATCTTGTGG + Intergenic
1071283258 10:84122283-84122305 TATCCTAACTTCTAATCTTTTGG - Intergenic
1071689352 10:87799378-87799400 TATCATAACTTCTAATCTTGTGG + Intronic
1072054670 10:91742723-91742745 AATTGGGACTTAAAATCTTGAGG - Intergenic
1072391907 10:94996015-94996037 TATCCTAATTTCCAATCTTGTGG - Intergenic
1072698624 10:97623197-97623219 GATCCTTACTTCAAAGCTTGTGG + Intronic
1074021783 10:109592139-109592161 ATTCTTAATTTAAAATTTTGTGG + Intergenic
1074729172 10:116350115-116350137 AATCCAGATTTAAAACCTTGTGG + Intronic
1075517955 10:123124437-123124459 AATCCTAATTTCAATTCTTTTGG + Intergenic
1077931910 11:6742174-6742196 AACCATAATTTATAATCTTGTGG - Intergenic
1078566874 11:12422806-12422828 TATCATAATTTAAAATTTTGGGG + Intronic
1079794409 11:24781757-24781779 AATGCTAAATTTAAATCATGTGG - Intronic
1079811160 11:25001068-25001090 TATCCTAACTTCTAATCTTATGG - Intronic
1081033691 11:38115872-38115894 TATTCTAACTTCTAATCTTGAGG + Intergenic
1082887754 11:58105949-58105971 GATCCTAATTTAAACTCTTTTGG + Intronic
1084823599 11:71712405-71712427 AGTCCTAACATTAAATCCTGGGG - Intergenic
1086790308 11:91029154-91029176 CATCCTAATGTAAAATCTTAAGG - Intergenic
1086987351 11:93264734-93264756 TATCTTAACTTCTAATCTTGGGG + Intergenic
1087220633 11:95542925-95542947 AATTCTAACTTATGTTCTTGTGG + Intergenic
1087381799 11:97414150-97414172 ACTCCTTGCTTAAAATTTTGTGG - Intergenic
1087640175 11:100748065-100748087 TATCCTAACTTCTAATCCTGTGG - Intronic
1087797873 11:102473351-102473373 AACCATAATTTATAATCTTGTGG + Intronic
1088064122 11:105695140-105695162 AATTTGAACTTAAAATCTTTGGG + Intronic
1088515022 11:110623124-110623146 AATCAGTTCTTAAAATCTTGTGG + Intronic
1093356605 12:18174827-18174849 TACCCTAACTTCTAATCTTGTGG + Intronic
1094319491 12:29169937-29169959 TATCCTAACTTCTAATCTTACGG - Intronic
1095127171 12:38493411-38493433 AATCCTAACTCCAAATCATAAGG - Intergenic
1095268778 12:40191664-40191686 TATCATAACTTCTAATCTTGTGG - Intergenic
1095522889 12:43088004-43088026 AATCCTATTTTAAATTCTTTTGG + Intergenic
1095822947 12:46499547-46499569 AATCCTAATTTCAATTCTTTTGG + Intergenic
1096222058 12:49836498-49836520 GTTCCTAAATTAAGATCTTGTGG + Exonic
1096545616 12:52337740-52337762 AATCCTGACATAAAGTGTTGGGG + Intergenic
1097817990 12:64096970-64096992 AATCTTAAAATAAAATATTGTGG - Intronic
1098711614 12:73769840-73769862 AATCATAATTTCTAATCTTGCGG - Intergenic
1100050621 12:90444563-90444585 TATCCTAACTTCTAATCTTATGG - Intergenic
1100345794 12:93729415-93729437 AATCTTTATTTATAATCTTGTGG + Intronic
1100440492 12:94612607-94612629 AAACCAAACTTTAAAACTTGAGG - Intronic
1103132330 12:118480120-118480142 AATCATAATTTCTAATCTTGTGG - Intergenic
1103808199 12:123591254-123591276 ATTCCCAACTTACAAACTTGAGG - Intronic
1106164542 13:27231338-27231360 AATCATAATTTCTAATCTTGTGG + Intergenic
1106997682 13:35506648-35506670 AATTCTAACTCAAAAATTTGTGG - Intronic
1107192070 13:37601159-37601181 AATCCTAACTTTAAATACTGAGG - Intergenic
1107303551 13:38993450-38993472 AATGCTACCTTAAAAACTCGAGG + Intergenic
1108798441 13:54063041-54063063 AATTCTTACATAAAATGTTGAGG - Intergenic
1108818324 13:54316899-54316921 TATCCTAACTTTTAATCTTATGG + Intergenic
1109909638 13:68892476-68892498 TATCCTAACTTCTAATCTCGTGG - Intergenic
1111638724 13:90939932-90939954 AATCCTAATTAAAAATCTAGTGG - Intergenic
1114236235 14:20826444-20826466 TATCCTAACTTCTAACCTTGTGG - Intergenic
1114772880 14:25449171-25449193 AAACCCATTTTAAAATCTTGTGG + Intergenic
1114974752 14:28081433-28081455 ATTCATTACTTAAAATATTGTGG - Intergenic
1115211131 14:30968203-30968225 TATCCTAACTTCTAATCTTATGG + Intronic
1115702290 14:35965757-35965779 AATGCAAAATAAAAATCTTGGGG + Intergenic
1115857394 14:37645428-37645450 AATCCTTGCTTACAATCTAGAGG + Intronic
1116119162 14:40699875-40699897 AACCCTAATTTCTAATCTTGTGG - Intergenic
1116359924 14:43981155-43981177 AATCTTAAATTAAAATTTTAAGG - Intergenic
1116594433 14:46820946-46820968 AACCCTGACTCAAAATTTTGGGG + Intergenic
1116594715 14:46826246-46826268 ACTTCTAGCTTATAATCTTGAGG - Intergenic
1116725735 14:48559558-48559580 CATCCTAACTTCTAATCTTGTGG + Intergenic
1117357380 14:54937896-54937918 ATTACTAACTTAAAATCATAAGG + Intergenic
1117357973 14:54944524-54944546 ATTACTAACTTAAAATCATGAGG - Intronic
1117955336 14:61118962-61118984 TATCCTAACTTCTAATCTTACGG - Intergenic
1118947986 14:70406508-70406530 AATCATAATTTCTAATCTTGTGG - Intronic
1119220160 14:72900086-72900108 ACTCCTAGCTTAAAATCTTTTGG - Intergenic
1119375095 14:74184365-74184387 TATCCAAACTTAAAATGTGGGGG - Intronic
1124096490 15:26653218-26653240 AACCCTAATTTCCAATCTTGTGG - Intronic
1127127746 15:55829824-55829846 AATCTTGACTTAAAATTTTCCGG - Exonic
1127742329 15:61923674-61923696 AATCCTTACTTAAAATGTAAAGG + Intronic
1128010695 15:64293129-64293151 GATACTAACTGAAAATCATGGGG - Intronic
1128350971 15:66888239-66888261 AATCATAATTTCGAATCTTGTGG + Intergenic
1130999657 15:88929674-88929696 AACCATAATTTCAAATCTTGTGG - Intergenic
1133524345 16:6589644-6589666 AATCATAATTTCTAATCTTGTGG + Intronic
1133959480 16:10480493-10480515 AATTCAAACTAAAAATCATGTGG - Intronic
1135224592 16:20644845-20644867 TATCCTAACTTCTAGTCTTGTGG + Intronic
1135339142 16:21631281-21631303 TATCCTAACTTCTAATCTTGTGG - Intronic
1135906400 16:26515991-26516013 AACCCTAACCTAAAATTATGAGG - Intergenic
1138016530 16:53433835-53433857 AATCATAATTTCTAATCTTGTGG + Intergenic
1139315430 16:66063719-66063741 AATCCTCCCCTAAAATGTTGAGG - Intergenic
1140848119 16:78908936-78908958 AACCCTAATTTCTAATCTTGTGG + Intronic
1142320479 16:89379253-89379275 AATCCTATCTTGAAAACTTAGGG + Intronic
1143795686 17:9334310-9334332 AAGCATAACTTATAATCTTGTGG + Intronic
1144801632 17:17932671-17932693 AATCTTACTTTAAAATATTGGGG + Intronic
1146983510 17:37189417-37189439 CATTCTAACTTAAAATTTTGTGG - Intronic
1148034749 17:44651009-44651031 GATCTGAACTTAAAATTTTGTGG - Intergenic
1150716791 17:67579081-67579103 CATCCTACCTTAAAATCAGGGGG + Intronic
1150755946 17:67913741-67913763 AGTCCTAATTTAAAATTTTCTGG + Intronic
1151532621 17:74716528-74716550 AATCCTCACTATAAATCTAGAGG + Intronic
1153383338 18:4463379-4463401 AATGCTTAGTTCAAATCTTGTGG + Intergenic
1153826523 18:8880329-8880351 TATCCTAACTTCAAATCTTATGG - Intergenic
1155261358 18:24045420-24045442 AATTATAACTTAAAATATTATGG + Intronic
1155672031 18:28383343-28383365 AGACCTAACTTTAAATCTTTAGG + Intergenic
1156300195 18:35829574-35829596 AATCGTAATTTCTAATCTTGTGG + Intergenic
1156898064 18:42269510-42269532 AACCATGAATTAAAATCTTGGGG - Intergenic
1157912643 18:51632424-51632446 AACCATAACTTCTAATCTTGTGG + Intergenic
1158864179 18:61621313-61621335 TACCCTAACTTCTAATCTTGTGG + Intergenic
1158905946 18:62011884-62011906 AATCACAAATTAATATCTTGTGG + Intergenic
1161597709 19:5159634-5159656 TATCCTAACTTCTAATCTTGTGG - Intronic
1162108410 19:8385614-8385636 TATCCTAACTTCTAATCTTATGG + Intronic
1162667691 19:12228772-12228794 TATCCTAACTTCTAATCTTATGG - Intronic
1163774972 19:19212466-19212488 AATCCCTACTTAAAATCCTGGGG - Intronic
1163929192 19:20372466-20372488 TATCCTAACTTCTAATCTTGTGG + Intergenic
1164992529 19:32694630-32694652 TATCCTAACTTCTAATCTTATGG - Intronic
925204232 2:1992802-1992824 AATCATAATTTTAAATCTTATGG - Intronic
927447704 2:23179713-23179735 AATCCTAATTTGAATTCTTTTGG - Intergenic
930113483 2:47698687-47698709 AATCATAATTTCTAATCTTGTGG - Intronic
930335872 2:50044841-50044863 AATTCTAAATGAAAATTTTGTGG + Intronic
930983662 2:57558808-57558830 AATCATAAATTAAAATATTTAGG - Intergenic
931933661 2:67170307-67170329 AATGCCAACTTAGAATCTTTGGG - Intergenic
934867731 2:97828371-97828393 TATCCTAACTTCTAATCTTATGG + Intronic
935048220 2:99500750-99500772 TATCCTGACTTCTAATCTTGTGG + Intergenic
935247915 2:101235428-101235450 TATCCTGACTTCTAATCTTGTGG + Intronic
936626372 2:114153657-114153679 AACCATAATTTAAAAACTTGTGG - Intergenic
936716537 2:115193386-115193408 TATCCTAACTTCTAATCTGGTGG - Intronic
937057382 2:118950879-118950901 TATCCTAACTTCTAATCTTGTGG - Intronic
937411486 2:121680610-121680632 TATCCTAACTTCAAATCTTGTGG - Intergenic
938805692 2:134805275-134805297 TATCCTAACTTCCAGTCTTGTGG - Intergenic
938916852 2:135950493-135950515 AATCTTTACTTAGAAACTTGAGG - Intronic
939104706 2:137935742-137935764 AACCATAACTTCTAATCTTGTGG + Intergenic
940362871 2:152814477-152814499 AATCATAATTTCTAATCTTGTGG - Intergenic
940427879 2:153551635-153551657 AATAATAACTTTAAATTTTGTGG + Intergenic
940659804 2:156532305-156532327 AAAACTAAATTAAAATCTGGGGG - Intronic
940766944 2:157799804-157799826 AATTCAAACCTAAAATCTTTTGG - Intronic
941049548 2:160717092-160717114 TATCCTAACTTACAATTTTTTGG + Intergenic
943134250 2:183891568-183891590 TATCCTAACTTCTAATCTTGTGG + Intergenic
943429159 2:187776179-187776201 AAAACTAACTAAAAATTTTGAGG - Intergenic
943586057 2:189741718-189741740 AATCCTAATTTTAAGTCTTAGGG - Intronic
943706152 2:191036865-191036887 ATTCCTAATTTAAAGTCTTTTGG + Intronic
943993445 2:194728822-194728844 AATTCTAATTTATAATGTTGTGG - Intergenic
944331072 2:198467160-198467182 AATCTTAATATAAAATCTTTCGG - Intronic
945103037 2:206280426-206280448 AATCCTAAAATAAACTTTTGGGG - Intronic
945560043 2:211328473-211328495 AATCCTAGATTTAAATTTTGTGG - Intergenic
945720149 2:213408946-213408968 TATCCTAACTTTTAATCTTGTGG + Intronic
945875178 2:215270694-215270716 CATCCTAAATTAAAGGCTTGGGG + Intergenic
946088402 2:217197435-217197457 AACCCTAACTTGAGATCTTTCGG - Intergenic
948004484 2:234595995-234596017 AACCATAATTTATAATCTTGCGG + Intergenic
948774114 2:240272780-240272802 ACTCCTAAGTTATAATCTTTTGG + Intergenic
1168822988 20:788999-789021 TATCCTAACTTCTAATCTTGTGG - Intergenic
1170143061 20:13144180-13144202 GATGGTAACTTAACATCTTGTGG - Intronic
1170644343 20:18183381-18183403 AATCATAAATAAAAATCTTAAGG - Intronic
1172457681 20:35090885-35090907 AAGCATAACTCAAAAGCTTGAGG + Intronic
1173868187 20:46326203-46326225 AATCCTACCTTTAAATCTTTTGG - Intergenic
1174490814 20:50893761-50893783 AAGCCTAACTTAAATTCTACAGG - Exonic
1178097535 21:29232118-29232140 AAACATAATTTCAAATCTTGTGG + Intronic
1178453339 21:32725294-32725316 AATTCTGAATTAAAATATTGTGG - Intronic
1178836966 21:36106628-36106650 TATCCTAACTTCTAATCTTGTGG + Intergenic
1182193006 22:28483689-28483711 AATCATCAAATAAAATCTTGTGG + Intronic
1184313928 22:43667553-43667575 AAGCATAACTGAAAATCTCGAGG - Intronic
949116542 3:332864-332886 ATTCCTAACCTAAATTCTAGGGG + Intronic
949611316 3:5706631-5706653 TATCCTAACTTCTAATCTGGTGG - Intergenic
951021003 3:17780858-17780880 TATCCTAACTTCTAATCTTGTGG + Intronic
951239843 3:20274939-20274961 TATCCTAACTTCTAATCTTATGG + Intergenic
951695751 3:25444017-25444039 AATCGCAACTTTAAATCATGGGG - Intronic
952156947 3:30653746-30653768 GATCCATACTTAAAATCTTGTGG - Intronic
952248495 3:31624843-31624865 GAGGCTAACTTAAAATCTTGAGG - Intronic
952329678 3:32352793-32352815 AATCCTAAGTGAACAGCTTGGGG - Intronic
952674606 3:36012644-36012666 AATTCCAACTTAAAATCTGCTGG + Intergenic
952940452 3:38440180-38440202 TATCCTAACTTCTAATCTTGAGG - Intergenic
953248608 3:41221665-41221687 AATACAGAATTAAAATCTTGTGG + Intronic
953437779 3:42892818-42892840 AACCATAACTTCTAATCTTGTGG + Intronic
954599295 3:51855451-51855473 CATCCTAACTTCTAATCTTGTGG + Intergenic
954604590 3:51899102-51899124 TATCCTAACTTCTAATCTTGTGG + Intronic
955686656 3:61556022-61556044 CATCCTAACTTTAAATTTTGAGG - Intergenic
955699250 3:61667218-61667240 AATCCAAATTTAAATTGTTGAGG - Intronic
956748941 3:72331308-72331330 AAGCCTAACTTCAAGTCTAGTGG + Intergenic
956842579 3:73154194-73154216 TATCCTAACTTCTAATCTTGTGG - Intergenic
957509492 3:81169263-81169285 AATCATAATTTCAAATTTTGTGG + Intergenic
957913730 3:86658412-86658434 AACATTTACTTAAAATCTTGTGG - Intergenic
959136473 3:102428447-102428469 AATTTAAACTTAAAATCTTGAGG - Intronic
959689690 3:109185495-109185517 ACTTGTAACTTAAAATCTTCTGG + Intergenic
959855095 3:111144189-111144211 AATCCTTTCTTAAAAAATTGTGG + Intronic
960006561 3:112787246-112787268 AATCATAATTTCTAATCTTGTGG - Intronic
960720489 3:120620699-120620721 TATCCTAACTTCTAATCTTGAGG - Intergenic
962017319 3:131455090-131455112 AACCCTAACTTAAAAACTTTAGG + Intergenic
962472858 3:135728679-135728701 AATCATAATTTCTAATCTTGTGG + Intergenic
963021620 3:140877580-140877602 TATCCTAACTTCTAATCTTGCGG + Intergenic
963234040 3:142938190-142938212 AATACTCATTTAAAATTTTGAGG - Intergenic
963712644 3:148764920-148764942 ACTCCTAACTAAGAATGTTGAGG + Intergenic
965116086 3:164490892-164490914 AATGATAACTTAAATTGTTGAGG + Intergenic
967032304 3:185619383-185619405 TATCCTAAATTAAAGTCTGGGGG + Exonic
969204665 4:5634534-5634556 AATCCTAAAATAAAATATTTGGG + Intronic
970357579 4:15270992-15271014 CATCTTAACTTTATATCTTGAGG + Intergenic
971636405 4:29064938-29064960 AATCCTAACTCAAAAGGATGTGG + Intergenic
971737002 4:30466597-30466619 AATCAAAACTTAAAATCCTCTGG - Intergenic
971944309 4:33254302-33254324 TATCCTAGCTTCTAATCTTGTGG - Intergenic
972389325 4:38598989-38599011 AAACCAAAAGTAAAATCTTGTGG + Intergenic
972455905 4:39254926-39254948 AATCCTAACATCAATTCTTATGG - Intronic
972784839 4:42316887-42316909 TATCCTAACTTCTAATCTTGTGG + Intergenic
973887835 4:55340705-55340727 TATCCTAACTTCTAATCTTGTGG + Intergenic
973888822 4:55348953-55348975 AATCCAAATTTAAAATCATTTGG + Intronic
974520269 4:62973676-62973698 TATCCTAACTTCTAATCTTGTGG + Intergenic
975319283 4:72992237-72992259 AATTCTAAATTAAAATAGTGTGG - Intergenic
975728900 4:77318985-77319007 AATCCTAACTTAAAATCTTGTGG + Intronic
977237826 4:94529513-94529535 AATCCTATTTTAAGATATTGAGG - Intronic
978314036 4:107416170-107416192 CATCCTAACTTCTGATCTTGTGG + Intergenic
978430054 4:108624153-108624175 AAACCTAAATTCAAATCTTCAGG - Intronic
981064406 4:140467011-140467033 AATAGTAACTTAAAAACTTGGGG + Intronic
983012143 4:162560969-162560991 TATCCTAACTTCTAATCATGTGG - Intergenic
986357096 5:6939393-6939415 AAGGCTCATTTAAAATCTTGAGG - Intergenic
987931069 5:24399877-24399899 TATCCTAACTTCTAATCTTATGG + Intergenic
988358263 5:30203864-30203886 TATCCTAACTTCTAATCTTGTGG + Intergenic
988415561 5:30942960-30942982 AAGCCCTAATTAAAATCTTGAGG + Intergenic
990419400 5:55616798-55616820 TATCCTAACTTCAAAGCTTGTGG + Intergenic
991224840 5:64258073-64258095 AGTCCTTACATGAAATCTTGTGG + Intronic
991239888 5:64445468-64445490 AACCATAACTTCTAATCTTGTGG - Intergenic
991623825 5:68576171-68576193 AAACCTATATTAAAATATTGAGG - Intergenic
992367596 5:76109356-76109378 AAACCTCACTTAAAAATTTGAGG + Intronic
992805867 5:80337384-80337406 ATTCATAACTTAAAATCGTCAGG - Intergenic
992816347 5:80443653-80443675 ACTCCTAACATCAAATCTGGAGG - Intronic
993055322 5:82973796-82973818 TATCCTAACTTCTAATTTTGTGG - Intergenic
993673397 5:90789072-90789094 ATTCCTAAGTTACAGTCTTGAGG + Intronic
994778289 5:104062506-104062528 AACCATAATTTCAAATCTTGTGG - Intergenic
995977684 5:118060886-118060908 AATCCTAATTTCAATTCCTGTGG + Intergenic
996100354 5:119439029-119439051 TCTCCTAACTTTTAATCTTGTGG + Intergenic
998552681 5:143092633-143092655 TATCCTAACTTCTAATCTTGTGG - Intronic
998915432 5:147006438-147006460 TATCCTAACTTCTAATCTTATGG + Intronic
998938806 5:147258760-147258782 TATCCTAACTTCAAATCTTGTGG - Intronic
1001558570 5:172654072-172654094 TATCCTAACTTCTAATCTTATGG - Intronic
1002162405 5:177322943-177322965 CAACCTAACTTAAAAACTTAAGG + Intergenic
1002676706 5:180921188-180921210 AATCCTGACTTCAATTCTTTTGG - Intronic
1003255994 6:4475378-4475400 AACCATAATTTATAATCTTGTGG + Intergenic
1003267935 6:4582921-4582943 AATCATAATTTCTAATCTTGTGG - Intergenic
1003806026 6:9726801-9726823 TATGCTAACTTCTAATCTTGTGG + Intronic
1005458901 6:26048864-26048886 AACCATAATTTATAATCTTGTGG - Intergenic
1005717478 6:28564834-28564856 AATGCTTACTGAGAATCTTGGGG - Intergenic
1005748309 6:28860809-28860831 AACCATAATTTATAATCTTGTGG - Intergenic
1006680480 6:35793711-35793733 AATCCTAACTCATAAGCCTGTGG + Intergenic
1006981324 6:38150578-38150600 AATCTTAACCTTAAATCTTAAGG + Intronic
1007813533 6:44503644-44503666 GATCCCAAGTGAAAATCTTGCGG + Intergenic
1007939673 6:45768306-45768328 AATCCTAAAATAAAATCTGAGGG - Intergenic
1009635640 6:66261097-66261119 TATCCTAACTTCTAATCTTGTGG + Intergenic
1009669791 6:66732216-66732238 ACTCCTTATTTAAAATTTTGAGG + Intergenic
1009995588 6:70891895-70891917 AATTCTAACTTAAAAATTTGTGG - Intronic
1010064038 6:71659431-71659453 AATGCTTACTTCAAATCTTGTGG + Intergenic
1010075313 6:71791005-71791027 TATCCTAATTTCTAATCTTGTGG + Intergenic
1010261557 6:73823098-73823120 CATCCTAAAATAAACTCTTGAGG + Intronic
1011189996 6:84718436-84718458 TATCCTAATTTCTAATCTTGTGG - Intronic
1011449986 6:87482325-87482347 TATCCTAACTTCTAATCTTGTGG - Intronic
1011570234 6:88726899-88726921 TATCCTAACTTCTAATCTTGTGG + Intronic
1011939800 6:92828734-92828756 TATCATAACTTCTAATCTTGTGG + Intergenic
1012306900 6:97669629-97669651 AATCCTCACTTAATTTCTTCTGG + Intergenic
1012369987 6:98492301-98492323 AATATTAACTTTGAATCTTGTGG - Intergenic
1012729634 6:102865764-102865786 AAATCTAACATAAATTCTTGTGG + Intergenic
1014203483 6:118629784-118629806 GCTGCTAACTTAAAATTTTGGGG - Intronic
1016214123 6:141574814-141574836 AATGCTGGCTTATAATCTTGTGG + Intergenic
1016223202 6:141701964-141701986 ACACCTTAATTAAAATCTTGGGG - Intergenic
1017785567 6:157754172-157754194 AATCATAATTTCTAATCTTGTGG + Intronic
1017795950 6:157844555-157844577 AATCATAATTTTTAATCTTGTGG + Intronic
1018191519 6:161313396-161313418 TATCCTAACGTCTAATCTTGTGG - Intergenic
1018248585 6:161845500-161845522 AATTAGAATTTAAAATCTTGTGG - Intronic
1018965333 6:168481956-168481978 AAACCTAACTTTACAACTTGAGG + Intronic
1020655590 7:10924965-10924987 TATCCTAACCTCTAATCTTGTGG + Intergenic
1022552288 7:31252301-31252323 AAAGCTAACTGAGAATCTTGAGG + Intergenic
1023436475 7:40145588-40145610 TATCCTAACTTCTAATCTTGTGG - Intronic
1023798963 7:43816544-43816566 TATCCTAACTTATAATCTTGTGG + Intergenic
1023799363 7:43820226-43820248 TATCCTAACTTCTAATCTCGTGG + Intergenic
1024821790 7:53339694-53339716 AATCATAACTTCTAATCTTGTGG + Intergenic
1024906758 7:54391654-54391676 TACCCTAACTTCTAATCTTGTGG - Intergenic
1025110189 7:56209996-56210018 AATCCTAACTTAGAACTTTGGGG + Intergenic
1027932817 7:84561154-84561176 GATCCTAACTTAAGTTCTTTTGG - Intergenic
1028333847 7:89627257-89627279 TACCCTAACTTCTAATCTTGTGG + Intergenic
1028793624 7:94880074-94880096 TATCCTAACTTCTAATTTTGTGG + Intergenic
1030487331 7:110186179-110186201 GATTCTAACTTAAATTCTTCTGG - Intergenic
1030934168 7:115563798-115563820 AATCCAAACCTAAACTATTGGGG - Intergenic
1032909165 7:136409341-136409363 AATCCTACCTTAAAATTATGAGG + Intergenic
1033069649 7:138190617-138190639 AATCGTAATTTCTAATCTTGTGG - Intergenic
1033340292 7:140486653-140486675 AACCATAACTTCTAATCTTGTGG + Intergenic
1034080045 7:148268294-148268316 AATGCTCACTTAAAAACATGCGG + Intronic
1034579407 7:152029453-152029475 TATTCTAACTTCTAATCTTGTGG - Intronic
1034838971 7:154377974-154377996 CATCCTAAGTTGAAATCTTAGGG + Intronic
1037083735 8:14819809-14819831 TGTGCTAACATAAAATCTTGTGG - Intronic
1037431008 8:18813189-18813211 AACCCTGACTTAAAAGCTGGTGG + Intronic
1038090411 8:24247034-24247056 AATCATAATTTCTAATCTTGTGG - Intergenic
1039276433 8:35938047-35938069 TATCCTAACTTCTAATCTTGTGG + Intergenic
1039301713 8:36216606-36216628 ACTCCTAAGTTTTAATCTTGTGG - Intergenic
1040667408 8:49650962-49650984 TATCCTAACTTCTAATCTTATGG - Intergenic
1040752215 8:50724265-50724287 ATTCCTTACTTAAAATCATTTGG - Intronic
1040798605 8:51315980-51316002 TTTACTATCTTAAAATCTTGGGG + Intergenic
1041226973 8:55710104-55710126 TATACTAACTTCTAATCTTGTGG + Intronic
1042088054 8:65130290-65130312 TATCCTAACTTCTAATCTTGTGG - Intergenic
1042802581 8:72736011-72736033 AATCACAGATTAAAATCTTGTGG - Intronic
1043677201 8:82972101-82972123 AACCATAACTTCTAATCTTGTGG - Intergenic
1043769339 8:84178638-84178660 CTTCATACCTTAAAATCTTGTGG + Intergenic
1044184797 8:89238626-89238648 TATCCTAACTTCTAATCTTGTGG - Intergenic
1044456182 8:92394870-92394892 TATCCTAACTTCTAATCTTGTGG - Intergenic
1045203116 8:100007909-100007931 AATCTTAACTCTAAATCTTAGGG + Intronic
1045956968 8:107919475-107919497 AATCATAATTTCTAATCTTGTGG - Intronic
1046385577 8:113504961-113504983 TACCCTAACTTCTAATCTTGTGG - Intergenic
1046725736 8:117671656-117671678 AGTCCAAACTTATAATGTTGGGG - Intergenic
1046813870 8:118562724-118562746 AATCCTAAATAAATATCTTCAGG - Intronic
1047444085 8:124904114-124904136 TATCCTAACTTCTAATCTTGTGG - Intergenic
1048746363 8:137618713-137618735 AATACTAAATTATAATCTTGAGG + Intergenic
1050846740 9:10230639-10230661 AAACCCAAATTAAAATTTTGTGG + Intronic
1050923266 9:11232833-11232855 TACCCTAACTTTTAATCTTGTGG - Intergenic
1051270838 9:15353606-15353628 AACCATAACTTCTAATCTTGTGG - Intergenic
1051460876 9:17313546-17313568 AGTCAAAAGTTAAAATCTTGGGG - Intronic
1051939596 9:22489889-22489911 AGACCTAACTGAAAATCTTTGGG - Intergenic
1053110923 9:35459442-35459464 TATCCTAACTTCTAATCTTATGG - Intergenic
1055457952 9:76490517-76490539 TATCCTAACTTCTAATCTTGTGG - Intronic
1055545588 9:77369588-77369610 AATCTTAAGTTTAAATTTTGAGG - Intronic
1055588363 9:77782092-77782114 AAAACTAACTTAAAATCTCCTGG + Intronic
1055831924 9:80389850-80389872 AATGCTAACTTAAAATATATAGG + Intergenic
1056414581 9:86364098-86364120 TATCCTAACTTCTAATCTTGTGG - Intergenic
1056509258 9:87287302-87287324 AATTCTAACTTTAAACATTGAGG - Intergenic
1056963548 9:91147324-91147346 TGTCCTAACTTCAAATCCTGGGG + Intergenic
1056995183 9:91450277-91450299 TAGCCTAACTTTATATCTTGAGG - Intergenic
1057235864 9:93359354-93359376 TATCATAACTTCTAATCTTGTGG + Intergenic
1057897838 9:98924053-98924075 AAGCCTAACTTAGAATGTGGAGG + Intergenic
1058214503 9:102217044-102217066 AATCTTAATTTCTAATCTTGTGG + Intergenic
1058502879 9:105639335-105639357 AGGCCTAACTCAAAAGCTTGTGG - Exonic
1059022576 9:110592511-110592533 AACCCTAATTTCTAATCTTGTGG + Intergenic
1059830948 9:118095296-118095318 AATCCTAACCTAAAACATAGAGG + Intergenic
1060203186 9:121664421-121664443 AATCCAAAATAAAAATTTTGAGG - Intronic
1060959263 9:127667832-127667854 AATTCTGTCTTAAAATCTTTTGG - Intronic
1062132452 9:134906304-134906326 AAGCCAAACTTAAAATATTCAGG - Intronic
1185968369 X:4633388-4633410 AATCATACCTTAAATTCTTTAGG + Intergenic
1188098021 X:26046434-26046456 TATCCTAACTTCTAATCTTGTGG + Intergenic
1188136994 X:26503674-26503696 TATCCTAACTTCTAATCTTGTGG + Intergenic
1189034432 X:37481073-37481095 TATCCTAACTTCTAATCTTGTGG + Intronic
1189415274 X:40807191-40807213 AATCATAATTTCTAATCTTGTGG + Intergenic
1189834018 X:45002931-45002953 TATCCTAACTTCTAATCTTGTGG - Intronic
1190083884 X:47378422-47378444 AATCATTACTTCTAATCTTGTGG + Intronic
1190478505 X:50851233-50851255 AATCATAATTTCTAATCTTGTGG + Intergenic
1191890046 X:65930575-65930597 TATCCTAACTTGTAATCTTGTGG - Intergenic
1192161550 X:68792184-68792206 AACCATAATTTATAATCTTGTGG - Intergenic
1192176419 X:68888738-68888760 GTCCCTAACTTAAAACCTTGCGG - Intergenic
1192482283 X:71495857-71495879 TATCCTAACTTCTAATCTTATGG - Intronic
1192939282 X:75895911-75895933 AATCGTCATTTAACATCTTGAGG + Intergenic
1193365462 X:80626851-80626873 AATTGTAACTTAAAAACTTATGG - Intergenic
1193756261 X:85412348-85412370 ATTCCTAAAATAAAATATTGGGG - Intergenic
1194451263 X:94047277-94047299 TATCATAACTTCTAATCTTGTGG + Intergenic
1194844443 X:98787080-98787102 AATCCTAACATATTATTTTGAGG - Intergenic
1195082108 X:101381083-101381105 AATCCTAACATATTATATTGAGG - Intronic
1195630325 X:107049101-107049123 TGTCCTAACTAAAATTCTTGAGG + Intergenic
1196074392 X:111559387-111559409 TACCCTAACTTCTAATCTTGTGG - Intergenic
1196126894 X:112110519-112110541 TATCCTAAGTTCTAATCTTGTGG - Intergenic
1197238897 X:124101550-124101572 AATTCCAACTTAAAATTATGAGG + Intronic
1197480830 X:126983847-126983869 ATTCCTAACTTACAATCTTGTGG + Intergenic
1198742336 X:139854364-139854386 TATCCTAACTTCTAATCTTATGG + Intronic
1199637644 X:149828538-149828560 TATCCTAACTTCTAATCTTATGG + Intergenic
1200270896 X:154682060-154682082 AAACCTAACAAAAAATATTGTGG - Intronic
1200315667 X:155130496-155130518 CATCTTAACTTAAAATCATCTGG - Intronic
1200763412 Y:7060575-7060597 TATCCTAACTTCTAATCTTGTGG - Intronic
1200880380 Y:8206291-8206313 TATCCTAACTTCTAATCCTGAGG - Intergenic
1200945533 Y:8831803-8831825 TATCCTAACTTCTAATCTTGTGG + Intergenic
1201271732 Y:12262238-12262260 TATCCTAACTTCTAATCTTATGG - Intergenic
1202192173 Y:22256799-22256821 TATCCTAACTTCTCATCTTGAGG - Intergenic