ID: 975728903

View in Genome Browser
Species Human (GRCh38)
Location 4:77319011-77319033
Sequence AGAAGTAATTCCTCTCCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975728897_975728903 25 Left 975728897 4:77318963-77318985 CCCACCTGTGAGTTGTAGCGCTA 0: 1
1: 0
2: 0
3: 1
4: 25
Right 975728903 4:77319011-77319033 AGAAGTAATTCCTCTCCTACTGG No data
975728899_975728903 21 Left 975728899 4:77318967-77318989 CCTGTGAGTTGTAGCGCTAATCC 0: 1
1: 0
2: 0
3: 0
4: 13
Right 975728903 4:77319011-77319033 AGAAGTAATTCCTCTCCTACTGG No data
975728898_975728903 24 Left 975728898 4:77318964-77318986 CCACCTGTGAGTTGTAGCGCTAA 0: 1
1: 0
2: 0
3: 6
4: 33
Right 975728903 4:77319011-77319033 AGAAGTAATTCCTCTCCTACTGG No data
975728901_975728903 0 Left 975728901 4:77318988-77319010 CCTAACTTAAAATCTTGTGGTCC 0: 1
1: 0
2: 1
3: 16
4: 147
Right 975728903 4:77319011-77319033 AGAAGTAATTCCTCTCCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975728903 Original CRISPR AGAAGTAATTCCTCTCCTAC TGG Intronic
No off target data available for this crispr