ID: 975728904

View in Genome Browser
Species Human (GRCh38)
Location 4:77319016-77319038
Sequence TAATTCCTCTCCTACTGGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 101}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975728901_975728904 5 Left 975728901 4:77318988-77319010 CCTAACTTAAAATCTTGTGGTCC 0: 1
1: 0
2: 1
3: 16
4: 147
Right 975728904 4:77319016-77319038 TAATTCCTCTCCTACTGGTAAGG 0: 1
1: 1
2: 0
3: 10
4: 101
975728899_975728904 26 Left 975728899 4:77318967-77318989 CCTGTGAGTTGTAGCGCTAATCC 0: 1
1: 0
2: 0
3: 0
4: 13
Right 975728904 4:77319016-77319038 TAATTCCTCTCCTACTGGTAAGG 0: 1
1: 1
2: 0
3: 10
4: 101
975728898_975728904 29 Left 975728898 4:77318964-77318986 CCACCTGTGAGTTGTAGCGCTAA 0: 1
1: 0
2: 0
3: 6
4: 33
Right 975728904 4:77319016-77319038 TAATTCCTCTCCTACTGGTAAGG 0: 1
1: 1
2: 0
3: 10
4: 101
975728897_975728904 30 Left 975728897 4:77318963-77318985 CCCACCTGTGAGTTGTAGCGCTA 0: 1
1: 0
2: 0
3: 1
4: 25
Right 975728904 4:77319016-77319038 TAATTCCTCTCCTACTGGTAAGG 0: 1
1: 1
2: 0
3: 10
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975728904 Original CRISPR TAATTCCTCTCCTACTGGTA AGG Intronic
900543330 1:3215190-3215212 GAAGTCCACTCCTACTGCTAAGG + Intronic
902959448 1:19952307-19952329 TAATGCCAGTACTACTGGTAGGG - Intergenic
905013586 1:34762557-34762579 GAATTCCTCTCCTCCTGCTTTGG - Exonic
905420102 1:37836253-37836275 TATTTCTTGTCCTACAGGTAAGG + Intronic
909738291 1:78995134-78995156 TATTTGCTCTCCTATTGGGAAGG - Intronic
912055136 1:105587334-105587356 TAATCTCTCTCCTACCAGTAGGG + Intergenic
913265342 1:117037801-117037823 TTATTCCTGTCCTACAGGTAAGG + Intergenic
916212180 1:162367942-162367964 GAATTCCTCTCATAAAGGTAGGG - Exonic
917266408 1:173225211-173225233 TAATTCCTCTTTTAGTGTTAGGG - Intergenic
921775096 1:219088798-219088820 CAATTCCTCTCTTGCTGGGACGG - Intergenic
922120447 1:222662108-222662130 GAAACCCTCTCCTTCTGGTAAGG + Exonic
922359037 1:224804241-224804263 TCTTTCATCTCCTACTGCTAAGG - Intergenic
923956011 1:239021626-239021648 TATTTTCTCTCCTATTGTTACGG - Intergenic
1065395301 10:25229884-25229906 CAATTCCTCTCCTACTGAGAAGG - Intronic
1068087132 10:52388380-52388402 CACTTCCTCTCCTACTTGAAGGG + Intergenic
1068795085 10:61070631-61070653 TAATTTTTCTCTTACTGATAAGG + Intergenic
1070392222 10:75981489-75981511 TAGTTACTCTTCTACTGGAATGG + Intronic
1075252725 10:120895708-120895730 TATTTGACCTCCTACTGGTAAGG + Intronic
1075659307 10:124182364-124182386 AAATTCCTCCCCTCCTCGTAGGG + Intergenic
1076866872 10:133171033-133171055 TAATGCTTCTTCTACTGTTAGGG + Intronic
1080376300 11:31716672-31716694 TAATGCTTATCCTATTGGTAAGG - Intronic
1084509986 11:69597365-69597387 TCATTCCCCTCCTACTTGTGGGG - Intergenic
1088015588 11:105055107-105055129 TAATTCCTCATCTTCTAGTAAGG + Intronic
1097637394 12:62139549-62139571 TAATACCTCTTCTCCTGGTTTGG + Intronic
1102620531 12:114191219-114191241 TACTTCCTCCCTTACTGCTATGG - Intergenic
1106652074 13:31702062-31702084 TACTTCCTATCATACTGGTATGG + Intergenic
1110476774 13:75924792-75924814 AAATTCCTCTTTTACTGGTGAGG + Intergenic
1110776122 13:79410078-79410100 TAACTCCTGTTCTACAGGTAGGG - Intergenic
1111184449 13:84713582-84713604 TAATTCCTCCTCTTCTTGTAAGG - Intergenic
1113221651 13:108111160-108111182 TAATGCGTCTCTCACTGGTAAGG - Intergenic
1114210778 14:20612599-20612621 CATTTCCTCTCCTTCGGGTAAGG - Intergenic
1114883388 14:26814817-26814839 AAATTCGTTTCCCACTGGTAAGG - Intergenic
1115525749 14:34279033-34279055 TAATTCTTCTGTTACTGGTGAGG - Intronic
1119840636 14:77790338-77790360 TAGGTCCTCTGCTAGTGGTAGGG + Intergenic
1119908993 14:78332789-78332811 TAGTTCCTGGCTTACTGGTATGG + Intronic
1125312830 15:38399145-38399167 TTTTTCCTCTCCTACTGCTTTGG + Intergenic
1128458195 15:67844912-67844934 TTATTCCTCTTTTACTGATAGGG + Intergenic
1130734685 15:86535878-86535900 TTATTCTTCTGCTACTGCTAAGG - Intronic
1130962765 15:88674408-88674430 TAACCCCTCTCCCATTGGTATGG - Intergenic
1136482090 16:30548394-30548416 TACTTCCTCTCTGACTGTTAAGG - Intronic
1138368059 16:56499516-56499538 TAATTCCTCTCTTTCCGTTATGG - Intronic
1144431353 17:15194890-15194912 TAATTGATCTTCCACTGGTAGGG + Intergenic
1146818471 17:35964454-35964476 TAAATTCACTCCTACTGGTAGGG - Intergenic
1149343087 17:55706996-55707018 TAAATCCTTTCCTACCGGAAGGG - Intergenic
1150197711 17:63318104-63318126 TAAATTCACTCCTACTGGTAAGG + Intronic
1153039431 18:797807-797829 TGATTTCTCTCTTACTGGTAGGG + Intronic
1155222244 18:23695987-23696009 TAATTCCTCCACTACTAGTGAGG + Intronic
1157027079 18:43857757-43857779 TAATTCATTTCCTGCTGATATGG + Intergenic
1167806207 19:51787657-51787679 TAATTCTTCTGTTACTGGAAGGG - Intronic
929905227 2:46039912-46039934 TTATTTCTCTGCTACTGGGATGG + Intronic
933868113 2:86543225-86543247 AAATTCATCTTCTAATGGTATGG - Intronic
940491810 2:154371275-154371297 TCATCCCTCTACTTCTGGTATGG - Intronic
942556691 2:177178880-177178902 TAATTCCTCACCTAGTGTTGGGG + Intergenic
945511362 2:210706888-210706910 TGGCTCCTCTCCTAGTGGTATGG + Intergenic
947300709 2:228685367-228685389 TCTTTCTTCTCCTTCTGGTATGG - Intergenic
947940730 2:234052795-234052817 TATTTCTTCTCCCACTGGAAGGG + Intronic
1173187812 20:40854680-40854702 TAACTGCTTTCCTTCTGGTATGG + Intergenic
1175526845 20:59640273-59640295 TAATTACTATCCTACTGTCAAGG + Intronic
1183337135 22:37256301-37256323 AAAATCCTCTCCTAGAGGTAGGG - Intergenic
950744799 3:15078980-15079002 TAATTCTTTTCCTACAGGTTGGG + Intronic
953505266 3:43479950-43479972 TAATTCCTCTTTTAGTGGAAAGG - Intronic
953794356 3:45972720-45972742 CACTTCCTCTCCTACTGCTTAGG + Intronic
959184813 3:103032980-103033002 TAATTCCCACCCAACTGGTATGG + Intergenic
960701320 3:120442221-120442243 TGATTCCCATTCTACTGGTAAGG + Intronic
961168917 3:124781929-124781951 CTATTCCTCTCCTACTGGTGAGG - Intronic
961252139 3:125516280-125516302 TATTTCCTCTCCTTCTGCTCGGG + Intronic
963430936 3:145201782-145201804 TAATTTCTGTCCTACTGGCATGG + Intergenic
963620966 3:147605830-147605852 TAATTCTTCTCAGACTGCTAGGG - Intergenic
963806927 3:149732315-149732337 GAATGCCTCTTCTACTGGAATGG + Intronic
964247395 3:154669653-154669675 TACTCTATCTCCTACTGGTATGG + Intergenic
970419567 4:15892885-15892907 TAAGTCCTCTGCTTCTGGAAAGG + Intergenic
971463519 4:26928159-26928181 TAATTCCTCTCCTGAGGGTTGGG + Intronic
974430059 4:61784926-61784948 TAATTTCTCTTTTACTGATAAGG - Intronic
975368991 4:73561924-73561946 TAATTCCTCTTCTACTTTCAGGG - Intergenic
975728904 4:77319016-77319038 TAATTCCTCTCCTACTGGTAAGG + Intronic
975735032 4:77372735-77372757 TAATTCCCCTCCTACTGGTAAGG + Intronic
978036915 4:104006454-104006476 TACTTCCTCTCCAACTGGAATGG + Intergenic
979165841 4:117529673-117529695 TAATTCCTCTCTTATTCTTATGG + Intergenic
992891916 5:81211498-81211520 TAATTCCTCTCCTCACGCTAAGG + Intronic
993038871 5:82789249-82789271 TTATTCCTTTTCTACTGGTGAGG + Intergenic
994082833 5:95727348-95727370 TACTTCCTCTCCAGCTGTTAAGG + Intronic
998055854 5:139076741-139076763 CAATTCCCCTTCTATTGGTATGG + Intronic
1003478817 6:6512278-6512300 TAGATCCTCTCCCACTGGTGTGG - Intergenic
1004018187 6:11751387-11751409 TATTTCCTCTTCTACTGACATGG + Intronic
1009276197 6:61683936-61683958 AATTTCCTCTGCTAATGGTATGG - Intronic
1009929686 6:70162708-70162730 TAATTACATTCCTACTGGTGTGG - Intronic
1010428787 6:75754896-75754918 TTATTCCTTTTCTACAGGTAAGG + Intronic
1011090582 6:83593872-83593894 TAACTACTATCCTACTGGCAGGG + Intronic
1011903898 6:92336324-92336346 AAATTCCTCTGTTACTGATATGG + Intergenic
1013825747 6:114208984-114209006 TAATTCCTATCCTTCTTGTTTGG - Intronic
1014775519 6:125504629-125504651 TAATTTCTTTCCTACTGTCAAGG - Intergenic
1015180620 6:130357967-130357989 TATTTCCTTTCCTACTGACAAGG - Intronic
1018202135 6:161404972-161404994 TAATTCTTCTCTTACTGGGATGG + Intronic
1019773644 7:2899246-2899268 TAACTGCTCTTCAACTGGTAAGG + Intergenic
1021261713 7:18466604-18466626 GACTTCCTCTCCTACTTTTAAGG + Intronic
1022964969 7:35464225-35464247 TCAATCCTTTCCTATTGGTATGG + Intergenic
1025223731 7:57138586-57138608 CAATACCTCTCCTACTGGCTGGG - Intronic
1026379223 7:69782457-69782479 AAATCCATCTTCTACTGGTAGGG - Intronic
1033518197 7:142130665-142130687 TAATTGCTTTCCTAATTGTATGG + Intronic
1038888591 8:31693162-31693184 TAGTTCCTCTCTTACTGCAAAGG + Intronic
1045976540 8:108136018-108136040 TAATTCCTCTGATAGTGGGAAGG + Intergenic
1046228029 8:111311702-111311724 TTATTTCTCTCTTACTAGTATGG + Intergenic
1047783896 8:128134992-128135014 TATTTCCTCTCCTACTACAAAGG + Intergenic
1048248647 8:132838204-132838226 AAATTACTATCCTACTGGAAGGG + Intronic
1048857718 8:138698332-138698354 TAATTCCTATCTCGCTGGTAGGG + Intronic
1049402050 8:142432651-142432673 TAATTCCCCTCTTAAAGGTAGGG - Intergenic
1053833686 9:42111122-42111144 TCATGCCTGTCCTACTGGAAAGG + Intronic
1062150348 9:135015095-135015117 TTATTCCTCTCTTCTTGGTAAGG + Intergenic
1186229419 X:7437215-7437237 TGATTCCTCTCCTACCTTTAGGG - Intergenic
1188887004 X:35562758-35562780 GCATACCTCTCCTACTGGAAAGG - Intergenic
1194266929 X:91765611-91765633 TCATTCCCCTCTTTCTGGTATGG - Intergenic
1200621441 Y:5454199-5454221 TAATGACTCTCCTGATGGTATGG - Intronic
1201315394 Y:12640356-12640378 TAACCCCTGTCCTCCTGGTATGG - Intergenic