ID: 975732777

View in Genome Browser
Species Human (GRCh38)
Location 4:77354003-77354025
Sequence CTGAGGCTCCAACCTCACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 2, 1: 0, 2: 3, 3: 27, 4: 202}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975732777_975732786 12 Left 975732777 4:77354003-77354025 CCTTGGTGAGGTTGGAGCCTCAG 0: 2
1: 0
2: 3
3: 27
4: 202
Right 975732786 4:77354038-77354060 CAGAGGGTGTCCTGTGGAGAAGG 0: 2
1: 0
2: 6
3: 32
4: 345
975732777_975732790 23 Left 975732777 4:77354003-77354025 CCTTGGTGAGGTTGGAGCCTCAG 0: 2
1: 0
2: 3
3: 27
4: 202
Right 975732790 4:77354049-77354071 CTGTGGAGAAGGAACTGGCAGGG 0: 2
1: 0
2: 1
3: 34
4: 347
975732777_975732781 -4 Left 975732777 4:77354003-77354025 CCTTGGTGAGGTTGGAGCCTCAG 0: 2
1: 0
2: 3
3: 27
4: 202
Right 975732781 4:77354022-77354044 TCAGCCAGGCAGCCTCCAGAGGG 0: 2
1: 0
2: 4
3: 35
4: 328
975732777_975732789 22 Left 975732777 4:77354003-77354025 CCTTGGTGAGGTTGGAGCCTCAG 0: 2
1: 0
2: 3
3: 27
4: 202
Right 975732789 4:77354048-77354070 CCTGTGGAGAAGGAACTGGCAGG No data
975732777_975732793 30 Left 975732777 4:77354003-77354025 CCTTGGTGAGGTTGGAGCCTCAG 0: 2
1: 0
2: 3
3: 27
4: 202
Right 975732793 4:77354056-77354078 GAAGGAACTGGCAGGGAGTGGGG 0: 2
1: 0
2: 7
3: 59
4: 664
975732777_975732780 -5 Left 975732777 4:77354003-77354025 CCTTGGTGAGGTTGGAGCCTCAG 0: 2
1: 0
2: 3
3: 27
4: 202
Right 975732780 4:77354021-77354043 CTCAGCCAGGCAGCCTCCAGAGG No data
975732777_975732792 29 Left 975732777 4:77354003-77354025 CCTTGGTGAGGTTGGAGCCTCAG 0: 2
1: 0
2: 3
3: 27
4: 202
Right 975732792 4:77354055-77354077 AGAAGGAACTGGCAGGGAGTGGG No data
975732777_975732783 6 Left 975732777 4:77354003-77354025 CCTTGGTGAGGTTGGAGCCTCAG 0: 2
1: 0
2: 3
3: 27
4: 202
Right 975732783 4:77354032-77354054 AGCCTCCAGAGGGTGTCCTGTGG 0: 2
1: 0
2: 1
3: 20
4: 228
975732777_975732791 28 Left 975732777 4:77354003-77354025 CCTTGGTGAGGTTGGAGCCTCAG 0: 2
1: 0
2: 3
3: 27
4: 202
Right 975732791 4:77354054-77354076 GAGAAGGAACTGGCAGGGAGTGG 0: 2
1: 0
2: 8
3: 83
4: 1184
975732777_975732787 18 Left 975732777 4:77354003-77354025 CCTTGGTGAGGTTGGAGCCTCAG 0: 2
1: 0
2: 3
3: 27
4: 202
Right 975732787 4:77354044-77354066 GTGTCCTGTGGAGAAGGAACTGG 0: 2
1: 0
2: 2
3: 19
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975732777 Original CRISPR CTGAGGCTCCAACCTCACCA AGG (reversed) Intronic