ID: 975732782

View in Genome Browser
Species Human (GRCh38)
Location 4:77354026-77354048
Sequence GACACCCTCTGGAGGCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 2, 1: 0, 2: 1, 3: 28, 4: 287}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975732782_975732794 13 Left 975732782 4:77354026-77354048 CCAGGCAGCCTCCAGAGGGTGTC 0: 2
1: 0
2: 1
3: 28
4: 287
Right 975732794 4:77354062-77354084 ACTGGCAGGGAGTGGGGCTTTGG 0: 2
1: 0
2: 2
3: 51
4: 453
975732782_975732790 0 Left 975732782 4:77354026-77354048 CCAGGCAGCCTCCAGAGGGTGTC 0: 2
1: 0
2: 1
3: 28
4: 287
Right 975732790 4:77354049-77354071 CTGTGGAGAAGGAACTGGCAGGG 0: 2
1: 0
2: 1
3: 34
4: 347
975732782_975732795 16 Left 975732782 4:77354026-77354048 CCAGGCAGCCTCCAGAGGGTGTC 0: 2
1: 0
2: 1
3: 28
4: 287
Right 975732795 4:77354065-77354087 GGCAGGGAGTGGGGCTTTGGTGG 0: 2
1: 0
2: 6
3: 72
4: 755
975732782_975732793 7 Left 975732782 4:77354026-77354048 CCAGGCAGCCTCCAGAGGGTGTC 0: 2
1: 0
2: 1
3: 28
4: 287
Right 975732793 4:77354056-77354078 GAAGGAACTGGCAGGGAGTGGGG 0: 2
1: 0
2: 7
3: 59
4: 664
975732782_975732787 -5 Left 975732782 4:77354026-77354048 CCAGGCAGCCTCCAGAGGGTGTC 0: 2
1: 0
2: 1
3: 28
4: 287
Right 975732787 4:77354044-77354066 GTGTCCTGTGGAGAAGGAACTGG 0: 2
1: 0
2: 2
3: 19
4: 239
975732782_975732796 17 Left 975732782 4:77354026-77354048 CCAGGCAGCCTCCAGAGGGTGTC 0: 2
1: 0
2: 1
3: 28
4: 287
Right 975732796 4:77354066-77354088 GCAGGGAGTGGGGCTTTGGTGGG 0: 2
1: 1
2: 4
3: 37
4: 399
975732782_975732789 -1 Left 975732782 4:77354026-77354048 CCAGGCAGCCTCCAGAGGGTGTC 0: 2
1: 0
2: 1
3: 28
4: 287
Right 975732789 4:77354048-77354070 CCTGTGGAGAAGGAACTGGCAGG No data
975732782_975732792 6 Left 975732782 4:77354026-77354048 CCAGGCAGCCTCCAGAGGGTGTC 0: 2
1: 0
2: 1
3: 28
4: 287
Right 975732792 4:77354055-77354077 AGAAGGAACTGGCAGGGAGTGGG No data
975732782_975732791 5 Left 975732782 4:77354026-77354048 CCAGGCAGCCTCCAGAGGGTGTC 0: 2
1: 0
2: 1
3: 28
4: 287
Right 975732791 4:77354054-77354076 GAGAAGGAACTGGCAGGGAGTGG 0: 2
1: 0
2: 8
3: 83
4: 1184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975732782 Original CRISPR GACACCCTCTGGAGGCTGCC TGG (reversed) Intronic