ID: 975732789

View in Genome Browser
Species Human (GRCh38)
Location 4:77354048-77354070
Sequence CCTGTGGAGAAGGAACTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975732784_975732789 -9 Left 975732784 4:77354034-77354056 CCTCCAGAGGGTGTCCTGTGGAG 0: 2
1: 0
2: 0
3: 12
4: 152
Right 975732789 4:77354048-77354070 CCTGTGGAGAAGGAACTGGCAGG No data
975732777_975732789 22 Left 975732777 4:77354003-77354025 CCTTGGTGAGGTTGGAGCCTCAG 0: 2
1: 0
2: 3
3: 27
4: 202
Right 975732789 4:77354048-77354070 CCTGTGGAGAAGGAACTGGCAGG No data
975732782_975732789 -1 Left 975732782 4:77354026-77354048 CCAGGCAGCCTCCAGAGGGTGTC 0: 2
1: 0
2: 1
3: 28
4: 287
Right 975732789 4:77354048-77354070 CCTGTGGAGAAGGAACTGGCAGG No data
975732779_975732789 5 Left 975732779 4:77354020-77354042 CCTCAGCCAGGCAGCCTCCAGAG 0: 2
1: 0
2: 2
3: 83
4: 514
Right 975732789 4:77354048-77354070 CCTGTGGAGAAGGAACTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975732789 Original CRISPR CCTGTGGAGAAGGAACTGGC AGG Intronic
No off target data available for this crispr