ID: 975734379

View in Genome Browser
Species Human (GRCh38)
Location 4:77367144-77367166
Sequence CCTGTGGAGAAGGAACTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 2, 1: 0, 2: 3, 3: 30, 4: 343}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975734372_975734379 -1 Left 975734372 4:77367122-77367144 CCAGGCAGCCTCCAGAGGGTGTC 0: 2
1: 0
2: 1
3: 28
4: 287
Right 975734379 4:77367144-77367166 CCTGTGGAGAAGGAACTGGCAGG 0: 2
1: 0
2: 3
3: 30
4: 343
975734367_975734379 22 Left 975734367 4:77367099-77367121 CCTTGGTGAGGTTGGAGCCTCAG 0: 2
1: 0
2: 3
3: 27
4: 202
Right 975734379 4:77367144-77367166 CCTGTGGAGAAGGAACTGGCAGG 0: 2
1: 0
2: 3
3: 30
4: 343
975734374_975734379 -9 Left 975734374 4:77367130-77367152 CCTCCAGAGGGTGTCCTGTGGAG 0: 2
1: 0
2: 0
3: 12
4: 152
Right 975734379 4:77367144-77367166 CCTGTGGAGAAGGAACTGGCAGG 0: 2
1: 0
2: 3
3: 30
4: 343
975734369_975734379 5 Left 975734369 4:77367116-77367138 CCTCAGCCAGGCAGCCTCCAGAG 0: 2
1: 0
2: 2
3: 83
4: 514
Right 975734379 4:77367144-77367166 CCTGTGGAGAAGGAACTGGCAGG 0: 2
1: 0
2: 3
3: 30
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975734379 Original CRISPR CCTGTGGAGAAGGAACTGGC AGG Intronic
900035473 1:404517-404539 CATGTGGAGAATGAACTTGAAGG - Intergenic
900057094 1:640267-640289 CATGTGGAGAATGAACTTGAAGG - Intergenic
900366351 1:2313419-2313441 CCCGTGGAGATACAACTGGCTGG + Intergenic
900500795 1:3003575-3003597 CCTGCGGAAGAGGAACTGCCGGG + Intergenic
901051417 1:6427571-6427593 CCTGTGGAGGTGGAAGTTGCTGG - Intronic
901065362 1:6491639-6491661 CCCATGGAGAAGGGACGGGCAGG - Intronic
901148722 1:7086062-7086084 GCTTTGGAGAACAAACTGGCAGG - Intronic
901745444 1:11370062-11370084 GAAGTGGAGAAGGAACTGGGTGG + Intergenic
902270682 1:15302242-15302264 AGTGGGGAGAAGGAACTGCCCGG + Intronic
902405992 1:16183963-16183985 CCTGTGGGGAAGGAAATGGCGGG - Intergenic
903008873 1:20316592-20316614 CCTGTGGAGACAGAACAGGATGG + Intronic
903015362 1:20358116-20358138 CCCGCAGAGAAGGGACTGGCTGG - Intergenic
903189302 1:21647858-21647880 CCTGTGGAAATGGAAGTGGAGGG + Intronic
903216662 1:21847285-21847307 CCTGGGGAGAAGGAACTTTCAGG - Intronic
903227504 1:21902066-21902088 CCTGTGGACAGGGCACTGGGTGG - Intronic
903500534 1:23797920-23797942 CCTGTGGAGGAGTAACAGGGTGG - Intronic
903564647 1:24255660-24255682 CCTGTGCATAAGGTACTGACAGG + Intergenic
903687607 1:25143382-25143404 TCTGAGGAGGAGGCACTGGCAGG - Intergenic
904102212 1:28041065-28041087 CCTGACAAGAAGGAAATGGCTGG + Intronic
904458989 1:30664267-30664289 CCAGAGCAGAAGGAACTTGCTGG + Intergenic
904496873 1:30892075-30892097 TGTGTGGAGAAGGGGCTGGCAGG - Intronic
904600673 1:31671024-31671046 TCTCTGGAGAAGAAAATGGCTGG - Intronic
905312118 1:37056579-37056601 GCTGTGGAGATGGAGCTGGAGGG - Intergenic
905454165 1:38076099-38076121 CCTATGCAAAGGGAACTGGCTGG + Intergenic
907542822 1:55231926-55231948 CCTGTAGAAAAGGAACTGAAAGG + Intergenic
907717540 1:56941137-56941159 CCTGTGGACAAGGAAGTGTCTGG - Intronic
911104542 1:94119502-94119524 CCTGAGGAGAAAGCCCTGGCAGG - Intronic
911565325 1:99457095-99457117 CCTTTGAAGAGGGAACTGCCTGG + Intergenic
912406743 1:109445465-109445487 ACTGTGGACAAGGGACTGACTGG - Intergenic
914239644 1:145845071-145845093 ACTGTAGAGAATGAACTGGTAGG + Intergenic
915010170 1:152678097-152678119 CCACTGGAGAAGGAAAGGGCCGG - Intergenic
915500719 1:156315106-156315128 GCTGTGGAGGAAGAACGGGCTGG - Intronic
916405701 1:164495966-164495988 TATTTGGAGAAGGAATTGGCAGG + Intergenic
916421152 1:164638965-164638987 CCTGTAGAGAAAAAACGGGCAGG - Intronic
917095158 1:171392481-171392503 ACTGTAGAGAAGGAAGTGTCTGG + Intergenic
918447619 1:184630746-184630768 GCTTTGTAGAAGGAAGTGGCAGG - Intergenic
919806363 1:201383108-201383130 CTCTTTGAGAAGGAACTGGCGGG - Exonic
919816130 1:201440972-201440994 CCTGTGGAGAAAGAGCTAACAGG + Intergenic
919948540 1:202341158-202341180 CCTAAGGAGAAGAAACTGTCAGG - Intronic
920400435 1:205672864-205672886 CCCGTGAAGAAGCAACTGCCGGG - Intronic
920657809 1:207889341-207889363 GCTGGGGAGAAGGACTTGGCTGG - Intronic
921294364 1:213688232-213688254 CTTGGGGAGAAGGAAGTGGGAGG - Intergenic
921507359 1:215988852-215988874 ACTGTGGAGCAGGACCAGGCTGG + Intronic
922258011 1:223910072-223910094 CATGTGGAGAATGAACTTGAAGG - Intergenic
922583622 1:226717669-226717691 CCTGTGGAGACGGAGCTGGGAGG + Intronic
922611282 1:226930666-226930688 CCTGGGGAGAGGGAGCTGGGGGG + Intronic
922703541 1:227776374-227776396 TCTGTGGAGGTCGAACTGGCTGG + Intronic
923936464 1:238765733-238765755 CCTGTGGAGAGGGAAGAGACAGG + Intergenic
924339206 1:243012851-243012873 CATGTGGAGAATGAACTTGAAGG - Intergenic
924383187 1:243481920-243481942 CCTCTGGGGAAGGAAGGGGCTGG + Intronic
1062790435 10:300886-300908 TCTGTGGAGAAGGAGTTGCCCGG - Intronic
1065714688 10:28554622-28554644 AATGTGGAGAATGAACTGGGAGG - Intronic
1065787415 10:29229537-29229559 CCTGGGGAGGAGGCTCTGGCAGG + Intergenic
1067226802 10:44382102-44382124 CCTGGGGACAAGGAAGTGGGGGG - Intronic
1067760134 10:49038918-49038940 CCTGTGGAGGAGCAACAGCCAGG + Intronic
1069179976 10:65346688-65346710 CCTGAAGACAAGGAACTGGTCGG - Intergenic
1070342489 10:75510700-75510722 CCTGTGGGGAAGGAGGAGGCTGG + Intronic
1071671612 10:87614273-87614295 CCTGTGGAGAAAGATCAGGTTGG - Intergenic
1071718643 10:88121082-88121104 CCCTTGGAGAAGGACCAGGCTGG + Intergenic
1072041274 10:91609016-91609038 GGTGTCCAGAAGGAACTGGCCGG + Intergenic
1073109086 10:101050250-101050272 CCTGTGAGGAGGGAGCTGGCTGG + Intergenic
1073489851 10:103845933-103845955 CATGTTGAGAATGAACTTGCAGG - Intronic
1073958604 10:108900163-108900185 CATGGGGAGAAGGAAATTGCAGG + Intergenic
1074224236 10:111467978-111468000 TCTGAGAAGAAGGCACTGGCTGG - Intergenic
1074533980 10:114315607-114315629 CCTGTGGCGCAAGAAGTGGCTGG - Exonic
1075511006 10:123073129-123073151 CCAGTGGACCAGGAAATGGCCGG - Intergenic
1076091449 10:127689821-127689843 GCTGTGGGGAAGTAACTGGATGG - Intergenic
1076783543 10:132737609-132737631 CCTGTGGCTGAGGAGCTGGCAGG - Intronic
1077081340 11:725968-725990 CCTGGGCAGAAGGAAAGGGCTGG + Intronic
1077198053 11:1291402-1291424 ACTGGGAAGGAGGAACTGGCGGG - Intronic
1077239495 11:1503126-1503148 CCTGTGGAGAAGGGATGGGGAGG + Intergenic
1077398983 11:2343689-2343711 CCAGTGTAGGAGGAACTGTCTGG - Intergenic
1079374326 11:19878704-19878726 ACTGGGGGGAAGGCACTGGCAGG + Intronic
1080601113 11:33821188-33821210 CATGAGGGGAAGGAACAGGCTGG - Intergenic
1080879185 11:36303094-36303116 TGTGTGGAGAAGGAAGTGGAGGG + Intronic
1081600412 11:44488683-44488705 CCTGGGAGGAAGGATCTGGCAGG + Intergenic
1081776473 11:45679067-45679089 CCTGAAGAGAAGGGGCTGGCGGG - Intergenic
1082839216 11:57675236-57675258 CCTTTGGAGAAGGAAATTGAGGG + Intronic
1083660341 11:64249128-64249150 CCTGTGGACACGGACATGGCTGG - Intergenic
1084119311 11:67059731-67059753 GCTGTGGAGAAGGCCCTGGTCGG - Intronic
1084580510 11:70020243-70020265 GCTGTTGGGCAGGAACTGGCAGG - Intergenic
1085479023 11:76806425-76806447 CCTGTGAAGACGGAAGAGGCTGG + Intergenic
1086745979 11:90427372-90427394 GCTCTAGAGAAGAAACTGGCTGG - Intergenic
1087097006 11:94328755-94328777 CCTGTGGAGATGGTACTGCATGG + Intergenic
1088535137 11:110852267-110852289 CATGTGGGGAGGGAATTGGCTGG + Intergenic
1088986136 11:114910139-114910161 CCTGTGTAGAAGGAGCTGGTGGG - Intergenic
1089738185 11:120564146-120564168 CGTGGGGAGAGGGAGCTGGCTGG - Intronic
1090315171 11:125779919-125779941 TCTGTGGAGAATGGACTGGAGGG - Intergenic
1090485766 11:127110627-127110649 GTCCTGGAGAAGGAACTGGCTGG + Intergenic
1093244831 12:16723339-16723361 CATGTGGAAAATGAACTGGAAGG + Intergenic
1093767569 12:22982460-22982482 ACTTTGGAGAAGAATCTGGCCGG + Intergenic
1094461584 12:30702310-30702332 CCTCTGGAGAAGAAAGTTGCTGG - Intergenic
1099092734 12:78333872-78333894 CGTGGGGAGAAGCAACTGGTTGG + Intergenic
1101964545 12:109273525-109273547 CCGGTGGAGAAGGAAGCAGCTGG + Intergenic
1104482067 12:129116086-129116108 CCTCTGGAGGAGGCCCTGGCTGG - Intronic
1104991260 12:132625044-132625066 CCTGTGAAGAAGCAGCAGGCAGG - Intronic
1105502393 13:20983806-20983828 CCTGTGTAGAAGGAAAAGGAAGG + Exonic
1105606813 13:21932758-21932780 GCTTTGGAGAAGGAAATTGCAGG + Intergenic
1107821345 13:44288565-44288587 CCTGTGGAGGGGGCACTGCCTGG + Intergenic
1108248593 13:48542391-48542413 ACTTTGGAGAAGAATCTGGCTGG + Intergenic
1108279559 13:48847978-48848000 ACTGCAGAGAAGGGACTGGCTGG + Intergenic
1109508707 13:63339316-63339338 ACTGTGGAAAAGGAACTGATAGG - Intergenic
1110013052 13:70363553-70363575 CCTGTGGGGAATGATCTGGAAGG - Intergenic
1110067124 13:71122443-71122465 CATGTCGAGAATGAACTGCCTGG + Intergenic
1111976028 13:94968031-94968053 CGTGTGGAGAACGCCCTGGCCGG - Intergenic
1113429463 13:110237010-110237032 CCTGTAGAACAGGAACTGGGAGG + Intronic
1113814153 13:113159900-113159922 CCTGTGGAGACGGACGGGGCTGG + Intronic
1114424489 14:22610837-22610859 CCTGTGGAGAGAGAACCCGCAGG - Exonic
1114537985 14:23435072-23435094 CCTCTGCAGAAGGAACTCACAGG - Intronic
1118313410 14:64708864-64708886 CCTGTGATGAAGGAACTTCCTGG + Intronic
1118875475 14:69781287-69781309 CCTATGGAGAAGCAACTACCCGG - Intronic
1119668594 14:76501513-76501535 TCTGTGCAGATGGAAGTGGCAGG + Exonic
1122124531 14:99571953-99571975 CCTCAGGGGAAGGAACTGGAGGG + Intronic
1122613269 14:103000300-103000322 CCGGTGGCGAGGGAACTCGCGGG - Intronic
1122908428 14:104814190-104814212 CCTGTGGGGAGGGAACTCGGTGG + Intergenic
1123004158 14:105313596-105313618 CCTTTGCAGAAGGAGCTGACGGG + Exonic
1123944088 15:25230612-25230634 CATGTGGAGAAGGGGGTGGCGGG - Intergenic
1125199945 15:37094675-37094697 GCTGGGGAGAAGAAACGGGCAGG + Intronic
1126212091 15:46111418-46111440 ACTTTGGAGAAGAATCTGGCCGG + Intergenic
1126418620 15:48446776-48446798 CCTGTGGGAATGGAACTTGCCGG - Exonic
1126697908 15:51341452-51341474 CCTGCGGAGGAGGGGCTGGCAGG - Intergenic
1127985848 15:64069837-64069859 CCTTTGGAGGAGGAAGGGGCAGG - Intronic
1128940326 15:71782838-71782860 CATTTGGAGAAGGAAATGGGAGG + Exonic
1129795406 15:78372707-78372729 CTTGTGGAGAAGGGACTGGATGG + Intergenic
1130070847 15:80645514-80645536 CCTCTGGAGAAGGCATTGGTTGG + Intergenic
1130809843 15:87365335-87365357 ACTAGGAAGAAGGAACTGGCAGG + Intergenic
1131219853 15:90573835-90573857 CCTGTGGGGAGTGAACTGGGTGG - Intronic
1132892145 16:2209706-2209728 CCTGTTGAGAAGGCTCTGGTGGG + Exonic
1132981597 16:2741040-2741062 CTGGTGGAGAAGGAACTTGGTGG + Intergenic
1133003060 16:2860769-2860791 CCCGAGGAGAAGGACCTGGTAGG + Intergenic
1133594299 16:7275857-7275879 CCTGTGCAGAAGGATCTGAGAGG + Intronic
1135165211 16:20133169-20133191 CCTTTGGAGAAGAAACAGTCAGG + Intergenic
1135246024 16:20857792-20857814 CCTCTGAAGGAGGAACTGTCAGG + Exonic
1135686093 16:24499429-24499451 CCTGTGGAGAAGGAACAGCGAGG + Intergenic
1135723005 16:24833015-24833037 GGTGTGGAGCAGGAACTGGAAGG + Intergenic
1135738847 16:24956172-24956194 CTTGTGGTGAAGGCAATGGCGGG - Intronic
1136315991 16:29455000-29455022 CCTGTTGAGAAGGACCGGCCAGG + Intronic
1136430568 16:30194342-30194364 CCTGTTGAGAAGGACCGGCCAGG + Intronic
1137861825 16:51854660-51854682 CCTGCAGAGAAGTAACAGGCAGG + Intergenic
1139216197 16:65125939-65125961 CCTTTGATGAAGGAACTGACAGG - Intronic
1139264798 16:65628754-65628776 ACTGAGGGGAGGGAACTGGCAGG + Intergenic
1140039522 16:71396885-71396907 CCTGTGGAGAAAAATATGGCCGG - Intergenic
1141220532 16:82065408-82065430 TCTGTGCAGAAGGAACATGCTGG + Intronic
1141833475 16:86523000-86523022 CATGTAGAGAAGGAAATGGATGG - Intergenic
1143030006 17:3962668-3962690 CCAGCGGAGGAGGAACTGACTGG - Intronic
1143659276 17:8314884-8314906 CCTGTGGAGAAAGAAAGGGAAGG - Exonic
1144260835 17:13518784-13518806 CCTGTGCAGAAGGAATTAGCTGG - Intronic
1146790593 17:35748475-35748497 CCTGTGCCCAAGGAAATGGCTGG + Intronic
1148450573 17:47775218-47775240 CCTATGTGCAAGGAACTGGCTGG - Intergenic
1150410067 17:64935179-64935201 TCTGGGGAGAAGGCACCGGCAGG + Intergenic
1151305659 17:73261355-73261377 CCTGTAGAGAAGGAAGGGGGAGG + Intronic
1151508672 17:74545034-74545056 CGTGTGGAGAAGGCAATGGCAGG + Intronic
1152676727 17:81645148-81645170 CCTGGGGAGAGGGAAGGGGCTGG - Exonic
1152905145 17:82965900-82965922 CCTGTGGAGAAGGGACACGTCGG - Intronic
1153128818 18:1830853-1830875 CCTGGTGAGAAGGATCAGGCAGG - Intergenic
1154313793 18:13287535-13287557 CCTCTGGATAAGTAATTGGCTGG + Intronic
1155900083 18:31378452-31378474 CCTGTGCAGAAGGCAATGGGAGG - Intronic
1160025606 18:75212501-75212523 TCTCTGGAGGAGGAACTGGCAGG + Intronic
1160563542 18:79773132-79773154 CCTGGGCAGGAGGACCTGGCTGG - Intergenic
1162752429 19:12836924-12836946 CCTGTGGATAGAAAACTGGCTGG + Intronic
1164633018 19:29774051-29774073 CCTGTGGGGCAGGGGCTGGCTGG - Intergenic
1164738864 19:30561983-30562005 CCTGTGGAGAGGGAAGTGCATGG + Intronic
1165689926 19:37855392-37855414 GCTGTGGAGCAGGAGCTGCCGGG - Intergenic
1165745418 19:38227812-38227834 CCTGGGGAGAAGGAGCTGCAGGG - Intronic
1166274885 19:41746291-41746313 TGTGTGGAGAAAGAACTGGATGG + Intronic
1166381394 19:42357051-42357073 CCTCTGGGGATGGAGCTGGCAGG - Intronic
1166503206 19:43355806-43355828 CCTGTGGGGACTGAACTGGAAGG + Intronic
1166665330 19:44676386-44676408 CCTGGTGACAAGGAACTGGAGGG + Exonic
1166713467 19:44951659-44951681 CCTGAGGAGAAGGGACTGGGGGG - Intronic
1166782601 19:45350319-45350341 CCTGCGGAGAAGGGAGTGTCTGG - Exonic
925388870 2:3482392-3482414 CCTGTGGAGCAGGATCGGGGAGG - Intronic
925625838 2:5841645-5841667 CCTGAACAGTAGGAACTGGCTGG - Intergenic
926709276 2:15864202-15864224 CCTGGGGAGAAAGTGCTGGCTGG + Intergenic
927963565 2:27255493-27255515 CCGGGGGAGAAAGAACAGGCAGG + Intronic
928684376 2:33733201-33733223 CCTCTGGCGGAGGAACTGGGTGG - Intergenic
929933654 2:46277584-46277606 CCTGTGGGTGAGGGACTGGCGGG + Intergenic
931835670 2:66096213-66096235 CCAGTGGGGTAGGGACTGGCTGG + Intergenic
932412812 2:71557334-71557356 CCTTTGGAGAGGGGACTGCCAGG + Intronic
932782338 2:74568399-74568421 CCTCTGGAGAAGGAAGAGTCCGG + Intronic
933131684 2:78680956-78680978 ACTGTTTTGAAGGAACTGGCAGG + Intergenic
935102987 2:100014569-100014591 CCTGTGGTCAGGGCACTGGCAGG + Intronic
936868630 2:117107432-117107454 ACTTTGGAGAAGAATCTGGCTGG + Intergenic
937114765 2:119397283-119397305 CCTGAGGAGGAGGAACAGGCTGG + Intergenic
937949265 2:127371208-127371230 CCTCTAGAGGAGGTACTGGCTGG - Intronic
942944393 2:181657049-181657071 CCTTTGGAGAAGGAGGTGGAGGG + Intronic
943529237 2:189058454-189058476 CCTGGTGAGAAGGGAATGGCTGG - Exonic
945579524 2:211575751-211575773 CCTGTGGTAAAGGAGCAGGCAGG + Intronic
947610010 2:231518929-231518951 CCTGGGGAGAAGGGTCTGACTGG - Intergenic
948284371 2:236772373-236772395 TCTGTGGACATGGAACTGGGTGG - Intergenic
948639805 2:239368536-239368558 CCAATGGAGAAGGAAGTGGGTGG - Intronic
1172037450 20:32019644-32019666 ACGTTGGAGAAGGAACGGGCTGG - Intronic
1172903100 20:38349204-38349226 CCTGTGTAGAAGAAACTGGAAGG - Intronic
1172904695 20:38360417-38360439 CCTGAGGAGGGGGCACTGGCTGG - Intronic
1173336765 20:42118453-42118475 CTTTTGGAGAATGATCTGGCAGG - Exonic
1173964694 20:47103256-47103278 CAGGGGGAGAAGGAAATGGCAGG - Intronic
1175372537 20:58501660-58501682 CGTGTGGAGGTGGAACTGTCAGG - Intronic
1175883586 20:62274708-62274730 CCTGGGGAGAAGGAGCTGGAGGG + Intronic
1176074778 20:63243470-63243492 CCTGTGGAGAAGGATAGAGCCGG - Intronic
1176423509 21:6533811-6533833 CCTGGGAAGATGGAACTGGAGGG + Intergenic
1178767884 21:35471494-35471516 CATGTGGAGCAGGACCTGGAAGG + Intronic
1179631278 21:42680130-42680152 CCTCAGGAGAAGGCACAGGCAGG - Intronic
1179699003 21:43142127-43142149 CCTGGGAAGATGGAACTGGAGGG + Intergenic
1182418541 22:30236987-30237009 CCTGTGCAGAAGGCTGTGGCTGG + Intergenic
1182585652 22:31343109-31343131 CCTGTGGAGCCAGAACTGGGTGG - Intronic
1182805527 22:33066820-33066842 GCAGTGGAGAAGCACCTGGCTGG + Intergenic
1183186080 22:36292375-36292397 CCTGTGGAGAGGGAAGTGACTGG - Intronic
1183832977 22:40428827-40428849 CCTGATGAGAAGGCACTGGAAGG - Intronic
1183922307 22:41178641-41178663 GCCGTGGAGAAGGGACAGGCTGG - Exonic
1183987016 22:41575559-41575581 GCTGAGGAGGAGGGACTGGCCGG - Exonic
1184482516 22:44756158-44756180 ACTGTCCAGAAGGAACTGGTTGG + Intronic
1184885363 22:47341802-47341824 CTTCTGGAGAAGGAACTGGAGGG + Intergenic
1185291758 22:50030925-50030947 GCTGTGGGGAAGGAACAGGTTGG + Exonic
949347359 3:3089170-3089192 CCTGGGGAGAGGGAACTGAAAGG - Intronic
949394745 3:3602759-3602781 CCTGTGGAGGAAGGAGTGGCAGG + Intergenic
950028118 3:9834538-9834560 CCTCTGGAGGAGGAACCGGGAGG + Intronic
950100243 3:10352268-10352290 CCTGTGCAGAGGGCACTGCCTGG + Intronic
950590856 3:13935009-13935031 CCTGAGAAGGAGGAACTGGCCGG + Intergenic
950712056 3:14819831-14819853 CCTGAGAAGGAGGAGCTGGCCGG + Exonic
953791545 3:45951531-45951553 CCTGTGGAGTAAGGGCTGGCAGG - Intronic
954384482 3:50237065-50237087 CCTGCAGAGAAGGATCTGGAGGG - Intronic
956055371 3:65293084-65293106 CCTGTAGAGAAAGAAGTGGGAGG - Intergenic
960720704 3:120622393-120622415 CCCCTGGAGGAGGGACTGGCAGG + Intergenic
960996993 3:123346784-123346806 CCTGGGGAGAAGGAACTCTCCGG + Intronic
962351564 3:134660201-134660223 CCTGTGGGGAGGGGACCGGCAGG - Intronic
963466067 3:145684811-145684833 GTTTTGGAGAAGGAAGTGGCTGG + Intergenic
963594056 3:147303285-147303307 CCTGTAGAGAAGAAACTTCCAGG - Intergenic
966118801 3:176498777-176498799 CATGTGAAGGAGGAACTGTCAGG + Intergenic
969197500 4:5574666-5574688 CCAGGTGAGAAGGTACTGGCAGG - Exonic
969279733 4:6161769-6161791 TGTGTGGAGGAGGAACTGGAGGG + Intronic
969323040 4:6424609-6424631 CCTCTGGAGGAGGCATTGGCTGG - Intronic
971467338 4:26977549-26977571 TCTGGTGAGAAGGAAATGGCTGG + Intronic
973703748 4:53561641-53561663 CCTTTGGAGAAGAAACTCCCAGG + Intronic
974678396 4:65127250-65127272 TCTCTGGAAATGGAACTGGCTGG + Intergenic
975188591 4:71432874-71432896 GTTGTGGAGATGGAAGTGGCAGG - Intronic
975732789 4:77354048-77354070 CCTGTGGAGAAGGAACTGGCAGG + Intronic
975734379 4:77367144-77367166 CCTGTGGAGAAGGAACTGGCAGG + Intronic
976077543 4:81316671-81316693 TGTGTGAGGAAGGAACTGGCGGG + Intergenic
979237916 4:118422371-118422393 CATGTGGAGAATGAACTTGAAGG + Intergenic
982439478 4:155418676-155418698 CCTGTCTAGAAGAAATTGGCTGG - Intergenic
985658876 5:1145761-1145783 CCTCTGCAGAAGGAAGGGGCTGG + Intergenic
985693522 5:1326766-1326788 CCTGTAGAGGAGGAGCTGGATGG - Intronic
985693553 5:1326969-1326991 CCTGTGGAGGAGGAGCTGGATGG - Intronic
985693565 5:1327027-1327049 CCTGTAGAGGAGGAGCTGGGTGG - Intronic
985693572 5:1327056-1327078 CCTGTCGAGGAGGAGCTGGGTGG - Intronic
985693603 5:1327259-1327281 CCTGTAGAGGAGGAGCTGGATGG - Intronic
985693616 5:1327346-1327368 CCTGTAGAGGAGGAGCTGGATGG - Intronic
985693621 5:1327375-1327397 CCTGTAGAGGAGGAGCTGGATGG - Intronic
985693635 5:1327462-1327484 CCTGTAGAGGAGGAGCTGGATGG - Intronic
985693646 5:1327520-1327542 CCTGTAGAGGAGGAGCTGGATGG - Intronic
985693652 5:1327549-1327571 CCTGTAGAGCAGGAGCTGGATGG - Intronic
985693682 5:1327752-1327774 CCTGTAGAGGAGGAGCTGGGTGG - Intronic
985693755 5:1328245-1328267 CCTGTAGAGGAGGAGCTGGATGG - Intronic
985693760 5:1328275-1328297 CCTGTAGAGGAGGAGCTGGATGG - Intronic
985731918 5:1554086-1554108 CCGCTGGTGGAGGAACTGGCAGG + Intergenic
986221485 5:5772585-5772607 CCTGGAGGGAAGGATCTGGCAGG - Intergenic
986589200 5:9351313-9351335 CCTTTGGAAAAGGTACAGGCTGG - Intronic
986680685 5:10230784-10230806 CCTGGGGAGGAGGAAGTGCCAGG - Intronic
986845033 5:11742251-11742273 CCTGAAGAGAAGGAACAGGACGG - Intronic
987605313 5:20127081-20127103 AATGTGGAGAAGGACCTGACAGG + Intronic
992554202 5:77887310-77887332 CAAGTGGAGAAGGTTCTGGCTGG - Intergenic
993297037 5:86153644-86153666 ACTTTGGAGAAGAATCTGGCTGG - Intergenic
994313257 5:98301728-98301750 TCTGTGGAGAAGAAAGTGGGGGG + Intergenic
996366081 5:122702858-122702880 AGAGTGGAGAAGGAACTGGTGGG - Intergenic
997299164 5:132789801-132789823 GCTGTGGAGAAGGGACAGGATGG - Intronic
997583609 5:135031922-135031944 CCTGAGGAGAAGAAAGTGGAGGG - Intronic
997646596 5:135486259-135486281 CCGGTGGAGAAGGAAATTGAAGG + Intergenic
1000006172 5:157186853-157186875 CATGTGGAGGATGAAGTGGCAGG - Intronic
1000190576 5:158906497-158906519 TGTGTGGAGAAGGAACAGGCAGG + Intronic
1000312836 5:160061888-160061910 CCTGTGGAGGAGGAAAGGCCGGG + Intronic
1000407490 5:160903974-160903996 CCTATGGCGAAGAAACTGTCAGG - Intergenic
1000441205 5:161265622-161265644 TCTGTGGAGAAGTGACTGGCAGG + Intergenic
1000537247 5:162493956-162493978 ACTTTGGAGAAGAATCTGGCTGG - Intergenic
1001854492 5:174999268-174999290 TTTGTTGAGAAGGAACTTGCGGG - Intergenic
1001888088 5:175313986-175314008 AGTGTGGAGGATGAACTGGCAGG - Intergenic
1002738346 5:181414354-181414376 CATGTGGAGAATGAACTTGAAGG + Intergenic
1004350000 6:14882647-14882669 CCTGGGGAGCAGGAGCTGTCAGG + Intergenic
1004426303 6:15509553-15509575 CCTGTGGAGCGGGGACTGACAGG + Intronic
1005150923 6:22749576-22749598 CATGTGAAGAAGGAACAGACTGG - Intergenic
1005952232 6:30640513-30640535 CCTGTGAGGAAGGAAGCGGCGGG - Exonic
1005958338 6:30679845-30679867 CCAGTGGGGAAAGAACTGGCTGG + Intronic
1006011090 6:31043639-31043661 CCTGTGGAGAGGGAATAGACTGG - Intergenic
1011351878 6:86432745-86432767 CCTGTGGAGGATGACCTGGGAGG - Intergenic
1012704154 6:102499855-102499877 CATGTGGATGAGGAACTGGCTGG - Intergenic
1013366380 6:109441012-109441034 CCTGCGAAGAAGGAACGGTCTGG + Exonic
1013481140 6:110553806-110553828 CCTGTGTAGAAGGATGGGGCTGG - Intergenic
1014171401 6:118282931-118282953 TCTGTGGAGAAGGGATTGGAAGG - Intronic
1014690981 6:124563522-124563544 CCTGTGGACATGGAAATAGCAGG - Intronic
1015201097 6:130582301-130582323 TCAGTGGAGAAGTAGCTGGCTGG - Intergenic
1015710094 6:136129946-136129968 CCTGTGGAGATGCAACTGGCAGG - Intronic
1016626744 6:146179358-146179380 CCTTTGGAGAAGGAATGGGTGGG + Intronic
1017095285 6:150799445-150799467 TCTGAGGACAAGGACCTGGCTGG - Intronic
1017153305 6:151300582-151300604 CCTGTGGAGAAGGAAGTGGATGG + Intronic
1017947751 6:159109549-159109571 TCGGTGGAGGAGGAACTTGCTGG + Intergenic
1018861101 6:167711421-167711443 CATGTGGAGACGAAGCTGGCTGG + Intergenic
1018899075 6:168042254-168042276 CCTGTGGAGGGGGAAATGCCTGG - Intronic
1019243448 6:170689906-170689928 CATGTGGAGAATGAACTTGAAGG + Intergenic
1019350466 7:551884-551906 GCTCTGGAGAAGGACCTGGGCGG - Intronic
1019350506 7:552007-552029 GCTCTGGAGAAGGACCTGGGTGG - Intronic
1019350524 7:552068-552090 GCTCTGGAGAAGGACCTGGGTGG - Intronic
1019350543 7:552129-552151 GCTCTGGAGAAGGACCTGGGTGG - Intronic
1019350562 7:552190-552212 GCTCTGGAGAAGGACCTGGGCGG - Intronic
1019350580 7:552251-552273 GCTCTGGAGAAGGACCTGGGTGG - Intronic
1019350657 7:552497-552519 GCTCTGGAGAAGGACCTGGGTGG - Intronic
1020013486 7:4818476-4818498 CCTGTGGGGCAGGCACTGGGGGG - Intronic
1020433021 7:8132664-8132686 GCAGTGGAGAAGGTACTGTCAGG - Intronic
1021451406 7:20785973-20785995 CCTGTAGAGTAGGAAGCGGCCGG - Intronic
1021842207 7:24729866-24729888 CCTGTGGAGAATCAACTGGAAGG + Intronic
1022116466 7:27265295-27265317 TCTGTGGACATGGAACTGGAAGG + Intergenic
1022441462 7:30436617-30436639 CCTGAGGACAAGGAAGGGGCAGG + Intronic
1025021666 7:55485250-55485272 CCTGTGGAGGAGAAGCTGGTGGG - Intronic
1025782450 7:64613846-64613868 CGTGTGGGCAAGGCACTGGCAGG - Intergenic
1030549825 7:110944588-110944610 CCTTTAGAGAAGGAACTGGAGGG - Intronic
1031723143 7:125202314-125202336 CCTGTGGAGTAGAAATTGACTGG - Intergenic
1032917598 7:136509918-136509940 ACTTTGGAGAAGAATCTGGCTGG - Intergenic
1033030302 7:137819785-137819807 CATGTGCAGGATGAACTGGCAGG - Intronic
1033520822 7:142158702-142158724 CCTGTGGAGAAGAAAAGGGAGGG + Intronic
1034297950 7:149990798-149990820 CCTGTGGAGATGGAGTGGGCAGG + Intergenic
1035374622 7:158399781-158399803 CCGGTGCAGTAGGAGCTGGCTGG - Intronic
1035504674 8:118252-118274 CATGTGGAGAATGAACTTGAAGG - Intergenic
1036206261 8:6807565-6807587 CTTGGGGAGAAGGGACTGGATGG - Intergenic
1036795277 8:11751463-11751485 CCTGGGGAGAAGGGATTGGAAGG + Intronic
1036959750 8:13230989-13231011 GGTGTGGAGAAGGGAATGGCGGG + Intronic
1038083548 8:24167885-24167907 CCTGTGGGTAATGAAATGGCAGG - Intergenic
1040023547 8:42761635-42761657 CCTATGGAGCAGGACCTGTCTGG + Intronic
1040375476 8:46820744-46820766 CCTGTGGGCAGGGCACTGGCAGG - Intergenic
1040376038 8:46825618-46825640 CCTGTGGGCAAGGCACTGGCAGG - Intergenic
1040919279 8:52598989-52599011 CCTGTGCACAATGACCTGGCCGG - Intergenic
1041024526 8:53670244-53670266 CCTGGGGAGGAGGAACCAGCAGG - Intergenic
1044585805 8:93868419-93868441 CCTGTGGAGATGGGAATGGAGGG - Intronic
1047561299 8:125990456-125990478 CCTGTCCATAAGAAACTGGCTGG - Intergenic
1048059065 8:130898866-130898888 CCTGTGAAGAATGGACTGTCGGG - Intronic
1048672011 8:136732999-136733021 CCTGTGCAGAAGGAAAGAGCAGG + Intergenic
1048788419 8:138077093-138077115 CCTGTTGAGAAGGAAAAGGCAGG + Intergenic
1049393174 8:142382441-142382463 CCCGAGCAGAAGGGACTGGCGGG - Intronic
1049858886 8:144883656-144883678 CATGTGGAGAATGCAGTGGCAGG + Intronic
1056972027 9:91213293-91213315 CCTGGGGAGTAGGCACTGGTGGG - Intergenic
1057094784 9:92295915-92295937 TCTGGGGAGCAGGAACTGGGGGG + Intergenic
1057237444 9:93373707-93373729 CATGTGTTAAAGGAACTGGCTGG + Intergenic
1057369982 9:94462678-94462700 CATCTGGAGAAGGAATGGGCAGG - Intergenic
1058607080 9:106734456-106734478 CCTGTGGAGCAGGAGCTTGGAGG + Intergenic
1059245325 9:112844833-112844855 CCTGTGGGGAAGGGGCGGGCAGG - Intronic
1059487467 9:114637768-114637790 CCTGTGGTCATGGAGCTGGCTGG + Intronic
1061033833 9:128102577-128102599 CCTGTGGAAGAGGAGGTGGCTGG - Intronic
1061968440 9:134029568-134029590 CCAGGGGAGAAGGTTCTGGCTGG - Intergenic
1062279763 9:135746728-135746750 GCTGGGGAGATGGAGCTGGCTGG + Intronic
1062673350 9:137724375-137724397 CCTGTGGAGATGGGATGGGCCGG + Intronic
1203603637 Un_KI270748v1:39129-39151 CATGTGGAGAATGAACTTGAAGG + Intergenic
1185592207 X:1284998-1285020 CATGTGGAGAAGGAGCAAGCTGG + Intronic
1192203681 X:69082616-69082638 TCTGAGGAGCAGGACCTGGCAGG - Intergenic
1192435256 X:71139383-71139405 CCTGGGGAGAAGGGCCTGGATGG + Intronic
1192458448 X:71297212-71297234 TCTGTGGAGAAGGAAATGATAGG + Intronic
1193318557 X:80093645-80093667 CCTTTGGAGAAGGAAACTGCTGG + Intergenic
1195822366 X:108959706-108959728 CCTGTGTAGAAGGAAAAGACTGG + Intergenic
1199616363 X:149659196-149659218 CTTGTGGTGACAGAACTGGCAGG + Intergenic
1199626278 X:149744052-149744074 CTTGTGGTGACAGAACTGGCAGG - Intergenic
1200844026 Y:7813120-7813142 CCTGTGGGAAGGGCACTGGCAGG + Intergenic
1200844723 Y:7819976-7819998 CCTGTGGACAGGGCACTGGCAGG + Intergenic
1200866058 Y:8044932-8044954 CCAGTGGACAGTGAACTGGCAGG - Intergenic
1200869599 Y:8083121-8083143 CCTGTGGGCAGGGCACTGGCAGG + Intergenic
1200890657 Y:8320180-8320202 CCTGTGGGCAAGGCACTAGCAGG - Intergenic
1200890989 Y:8323935-8323957 CCTGTGGGCAGGGCACTGGCAGG - Intergenic
1200897727 Y:8393383-8393405 CCTGTGGGTAGGGCACTGGCAGG + Intergenic
1200902355 Y:8445497-8445519 CCTATGGAAAAGGCACTGACAGG + Intergenic
1200907138 Y:8495402-8495424 CCTGTGAGCAAGGCACTGGCAGG - Intergenic
1202251916 Y:22881734-22881756 CCAGTGGACAGGGAACTGGCAGG + Intergenic
1202259955 Y:22960051-22960073 CCTGTGGGCAGGGCACTGGCAGG - Intergenic
1202261031 Y:22970595-22970617 CCTGTGGGCAAGACACTGGCAGG - Intergenic
1202262042 Y:22980284-22980306 CCTGTGGACAAGACATTGGCAGG - Intronic
1202385702 Y:24324172-24324194 CATGTGGAGAATGAACTTGAAGG + Intergenic
1202404904 Y:24515483-24515505 CCAGTGGACAGGGAACTGGCAGG + Intergenic
1202412941 Y:24593795-24593817 CCTGTGGGCAGGGCACTGGCAGG - Intergenic
1202414019 Y:24604336-24604358 CCTGTGGGCAAGACACTGGCAGG - Intergenic
1202415031 Y:24614025-24614047 CCTGTGGACAAGACATTGGCAGG - Intronic
1202455755 Y:25056061-25056083 CCTGTGGACAAGACATTGGCAGG + Intronic
1202456765 Y:25065750-25065772 CCTGTGGGCAAGACACTGGCAGG + Intergenic
1202457840 Y:25076275-25076297 CCTGTGGGCAGGGCACTGGCAGG + Intergenic
1202465875 Y:25154599-25154621 CCAGTGGACAGGGAACTGGCAGG - Intergenic
1202485084 Y:25345956-25345978 CATGTGGAGAATGAACTTGAAGG - Intergenic