ID: 975735027

View in Genome Browser
Species Human (GRCh38)
Location 4:77372685-77372707
Sequence CAGAGCTACAACTCACAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 101}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975735027_975735032 27 Left 975735027 4:77372685-77372707 CCCACTTGTGAGTTGTAGCTCTG 0: 1
1: 0
2: 0
3: 15
4: 101
Right 975735032 4:77372735-77372757 TAATTCCCCTCCTACTGGTAAGG 0: 1
1: 1
2: 0
3: 9
4: 67
975735027_975735033 28 Left 975735027 4:77372685-77372707 CCCACTTGTGAGTTGTAGCTCTG 0: 1
1: 0
2: 0
3: 15
4: 101
Right 975735033 4:77372736-77372758 AATTCCCCTCCTACTGGTAAGGG 0: 1
1: 1
2: 0
3: 4
4: 79
975735027_975735031 22 Left 975735027 4:77372685-77372707 CCCACTTGTGAGTTGTAGCTCTG 0: 1
1: 0
2: 0
3: 15
4: 101
Right 975735031 4:77372730-77372752 GATAGTAATTCCCCTCCTACTGG 0: 1
1: 0
2: 0
3: 4
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975735027 Original CRISPR CAGAGCTACAACTCACAAGT GGG (reversed) Intronic
903617361 1:24670425-24670447 CAGATGTATAACTCACAAATGGG - Intronic
904707495 1:32402384-32402406 CAGGTCTACAACCCACATGTTGG + Intergenic
907711064 1:56881911-56881933 CAGAGCCACAACTTAGAAATAGG - Intronic
907830648 1:58061199-58061221 CAAAGCTAGAACTCACCCGTGGG - Intronic
909924168 1:81419062-81419084 CAGAACTAAAGCTCAAAAGTAGG + Intronic
910015988 1:82524624-82524646 CATAGCTGTAACTCACAAGCTGG - Intergenic
910123877 1:83819402-83819424 CAGAGCAACCACTCACTAGAGGG + Intergenic
917613604 1:176715057-176715079 CAGAGTTTCACCTAACAAGTAGG - Intronic
921524444 1:216200147-216200169 CAAAGTTACATTTCACAAGTTGG + Intronic
921713094 1:218392447-218392469 AAGAGCTACACCACATAAGTGGG - Intronic
922779989 1:228244430-228244452 CTGAGCTCCAGCTCAAAAGTGGG + Exonic
923636661 1:235704758-235704780 AAGAGCAACAATTGACAAGTGGG - Intronic
924826803 1:247548310-247548332 CAGAGCCACAAAGCACAAGCTGG - Intronic
1063556158 10:7081540-7081562 CAGTGCTAGAACTCCCACGTGGG - Intergenic
1067780820 10:49205486-49205508 CTGAGCTGCAACTAACAGGTGGG - Intergenic
1068887404 10:62111699-62111721 CAGCTCTGCAACTCACAAGCTGG - Intergenic
1069089759 10:64185665-64185687 CAGAGCTGCCACTACCAAGTTGG - Intergenic
1072521001 10:96230041-96230063 CAGATCTAAAACTCACAGGTTGG + Intronic
1074603604 10:114938727-114938749 GAGAACTACAACTGCCAAGTAGG - Intronic
1075427870 10:122355956-122355978 CAGAGCTTGAACTCAAAACTGGG + Intergenic
1079466006 11:20731642-20731664 CAGACTTACAATTCACAAGCCGG + Intronic
1081435675 11:43024912-43024934 CAGAGCCACAACTCACACCCAGG - Intergenic
1083361357 11:62110975-62110997 CAGGGCAACAACTAACAAGAGGG + Intergenic
1084549625 11:69833448-69833470 CAGAGCTACAACTGATAACCTGG - Intergenic
1084706593 11:70819516-70819538 CAGAGCTCCAACTCCCAAGCAGG - Intronic
1086892772 11:92277629-92277651 CAATGCTACCACTTACAAGTGGG - Intergenic
1087166809 11:95012830-95012852 CAGAGCTGCACCTCAGAATTTGG + Intergenic
1089657706 11:119963657-119963679 CAGAGCTAGAACTCACACACAGG - Intergenic
1092050451 12:5465982-5466004 CAGCTCTACCACTTACAAGTTGG - Intronic
1093488894 12:19682113-19682135 CAGAGCTAAAATTCACAATGTGG + Intronic
1093528005 12:20125889-20125911 CAGAGCTTCAAGTAAGAAGTGGG - Intergenic
1093566959 12:20618303-20618325 CAGGGCTAAAACTCAAAAGAAGG - Intronic
1094808896 12:34118577-34118599 CACAGCTAAAATGCACAAGTTGG - Intergenic
1098661571 12:73101038-73101060 CAGAGCTACAAGTCACCTGGGGG - Intergenic
1098880314 12:75910479-75910501 CAGAGCTGTCATTCACAAGTTGG + Intergenic
1102150863 12:110688624-110688646 CAGAGCCAGAACTCACAACCAGG - Exonic
1104968279 12:132519537-132519559 CAGTGCCACACCTCACCAGTAGG + Intronic
1106388067 13:29307490-29307512 CAGATCCACAACTGACAAGTTGG - Intronic
1110115766 13:71814920-71814942 CAGCACTTCAACTAACAAGTTGG + Intronic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1113211113 13:107982325-107982347 CAGAGCTTCTACCCACAAGAGGG - Intergenic
1114594041 14:23895905-23895927 CAAAGCTACCACACAAAAGTTGG + Intergenic
1116847758 14:49880652-49880674 CAGAAGTACAAGTCACAACTTGG - Intergenic
1118434334 14:65755755-65755777 CATAGCTCCAAGTCACAAGCAGG - Intergenic
1120390382 14:83899701-83899723 CAGAGCTAAAGCACACATGTGGG + Intergenic
1122348456 14:101074451-101074473 CGGAGCTACAGGTCACAAGCTGG + Intergenic
1126692727 15:51300331-51300353 CTAAGCTACAACTCACGAGAGGG + Intronic
1129461127 15:75700546-75700568 CAGACCTCCAAGTCACCAGTGGG - Intronic
1129661954 15:77557775-77557797 CACTGCCACAACTCACATGTGGG - Intergenic
1135228344 16:20681370-20681392 CAGAGCTAGAATGCACAAGTTGG + Intronic
1136283536 16:29228436-29228458 CAGAGAAACTACTCCCAAGTGGG - Intergenic
1137484882 16:48882562-48882584 CAGAGCTAGAACTCCCAAGCTGG + Intergenic
1138903659 16:61304165-61304187 GAGAGCTAAAATTCACATGTGGG - Intergenic
1139463259 16:67139754-67139776 CAGAGCTTCATGTCACATGTGGG + Intronic
1142087960 16:88194386-88194408 CAGAGAAACTACTCCCAAGTGGG - Intergenic
1147467516 17:40621802-40621824 CAGAGCTAGTATTTACAAGTTGG + Intergenic
1151418449 17:73982047-73982069 CAGAGCTCCGTCTCACAAGTGGG - Intergenic
1155307305 18:24490883-24490905 CAGAGCCACGACTCAAAAGAGGG + Intergenic
1156838971 18:41588922-41588944 CCGAGCTATAACTCAAAAGGCGG + Intergenic
926643307 2:15260995-15261017 CTGAGTTATAACTCACTAGTGGG - Intronic
932779605 2:74551871-74551893 CAGAGCTAAAACTAACAAGGTGG - Intronic
938625455 2:133104056-133104078 CAGAGCTGCCCCTCCCAAGTGGG + Intronic
938740685 2:134228842-134228864 CACAACTACAACTCACTAGATGG - Intronic
940070373 2:149679901-149679923 CATGGCTACTACTTACAAGTAGG + Intergenic
941624475 2:167815623-167815645 CATAGCTAGCACTCATAAGTCGG + Intergenic
943776957 2:191775954-191775976 CAGAGCTACCACTAACCAGTTGG + Intergenic
944163870 2:196696103-196696125 CACAGCCAAAACTCAAAAGTAGG - Intronic
945014055 2:205496289-205496311 AAGAGCTACAAATCAGAAATTGG + Intronic
946001693 2:216487678-216487700 CAGAGCAACCACTCACAAGGGGG - Intergenic
946535140 2:220619584-220619606 TAGAGCTGCAACTCTCAAGTTGG + Intergenic
947523986 2:230867450-230867472 CAGAGCTACAGCTGAGAAATGGG - Intronic
1170419624 20:16179936-16179958 AAGTGCTCCAACTCTCAAGTTGG + Intergenic
1173089346 20:39955441-39955463 CAGAGCCACAACTCAAAAGAGGG - Intergenic
1176971245 21:15268485-15268507 CAGAGCTAGGATTCAAAAGTAGG + Intergenic
1177663028 21:24112622-24112644 CAGAGCTAGCACACAAAAGTTGG - Intergenic
1181486876 22:23237140-23237162 CAGAGATTCAACTCACAAACAGG - Intronic
1184442866 22:44529109-44529131 CAGAGCTACAACTCCAATTTAGG - Intergenic
950195060 3:11003480-11003502 CAGAGCTGAAACTCAAAACTGGG + Intronic
956388547 3:68747231-68747253 GAGAGAGAAAACTCACAAGTGGG - Intronic
957350869 3:79020233-79020255 CAGAGCTATAACTGGCAGGTTGG - Intronic
957408654 3:79807378-79807400 CTGAGCTAGGACTCAAAAGTGGG + Intergenic
965423244 3:168488681-168488703 CAGAGTTAGAAATCACAAGCTGG - Intergenic
971250730 4:24971247-24971269 GAGAGCAACAACTCACTACTAGG - Intronic
974286900 4:59880714-59880736 CTGACCTACAAATCACATGTTGG - Intergenic
975728897 4:77318963-77318985 TAGCGCTACAACTCACAGGTGGG - Intronic
975735027 4:77372685-77372707 CAGAGCTACAACTCACAAGTGGG - Intronic
975874839 4:78824405-78824427 CAGAGTTACAACTTACATGGTGG + Intronic
982425131 4:155249250-155249272 CACAGCCACCACTCACAATTAGG + Intergenic
988578425 5:32447900-32447922 CACACCTACAAGTCAAAAGTAGG + Intergenic
992867754 5:80974671-80974693 CAGATCAAGAACTCACAAGGTGG - Intronic
993919051 5:93777327-93777349 CACAGCTACAACTCACCAGATGG - Intronic
995457759 5:112369906-112369928 CAGACCTACACCTCAGAGGTGGG - Intronic
996969542 5:129347193-129347215 GAAAGATACAACTCACAAATTGG - Intergenic
998607561 5:143650466-143650488 CTCATCTACAACACACAAGTTGG - Intergenic
1000500759 5:162046484-162046506 AAGAGCAACATCTCAGAAGTTGG + Intergenic
1003180862 6:3790251-3790273 CAGGACTAGAACTCACAACTTGG - Intergenic
1009599596 6:65781480-65781502 CAGAGGAACAATTCACAAATAGG + Intergenic
1012894513 6:104933209-104933231 CAGATTTTCAATTCACAAGTAGG - Intergenic
1013324442 6:109030868-109030890 CAGAGCTACAAGTCAAATGCAGG + Intronic
1014276894 6:119398296-119398318 CCCAGCTACAAATCACAATTTGG + Intergenic
1020151220 7:5683347-5683369 CAGTGGTACAATCCACAAGTTGG + Intronic
1021447946 7:20753357-20753379 TAGAAATACAACACACAAGTTGG + Exonic
1022499685 7:30874674-30874696 CAGAGCTAGAACTCATACTTGGG + Intronic
1024642901 7:51345824-51345846 GAGAGAAACAACCCACAAGTAGG + Intergenic
1031976040 7:128094223-128094245 CAGAGAAAAAACTCAGAAGTGGG - Intergenic
1032271657 7:130413641-130413663 CTGAGCTATAACTCACATATAGG + Intronic
1036215791 8:6878565-6878587 CAGAGCTACAACTGCCAGATTGG + Intergenic
1049748295 8:144272225-144272247 CAGAGCTACAACTTCCAGGTGGG + Intronic
1056292853 9:85161119-85161141 CAGAATGACAACTCTCAAGTGGG - Intergenic
1057091109 9:92258774-92258796 CAGAGCTCCACCTCACAGCTTGG + Intronic
1060053163 9:120391402-120391424 CAGAGCTGGGACTCACATGTGGG + Intronic
1062418222 9:136464673-136464695 CAGACTTCCAACTCAAAAGTCGG + Intronic
1189248535 X:39581952-39581974 TAGAGCTATAACCCACAACTTGG + Intergenic
1193540144 X:82761254-82761276 CAGAGTTCTCACTCACAAGTGGG - Intergenic
1201755042 Y:17478022-17478044 CACAGCTAAAATGCACAAGTTGG - Intergenic
1201846510 Y:18427963-18427985 CACAGCTAAAATGCACAAGTTGG + Intergenic
1202036919 Y:20645588-20645610 CATAGCCACAACTAACAAGTCGG - Intergenic