ID: 975735028

View in Genome Browser
Species Human (GRCh38)
Location 4:77372686-77372708
Sequence TCAGAGCTACAACTCACAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 89}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975735028_975735032 26 Left 975735028 4:77372686-77372708 CCACTTGTGAGTTGTAGCTCTGA 0: 1
1: 0
2: 1
3: 8
4: 89
Right 975735032 4:77372735-77372757 TAATTCCCCTCCTACTGGTAAGG 0: 1
1: 1
2: 0
3: 9
4: 67
975735028_975735031 21 Left 975735028 4:77372686-77372708 CCACTTGTGAGTTGTAGCTCTGA 0: 1
1: 0
2: 1
3: 8
4: 89
Right 975735031 4:77372730-77372752 GATAGTAATTCCCCTCCTACTGG 0: 1
1: 0
2: 0
3: 4
4: 61
975735028_975735033 27 Left 975735028 4:77372686-77372708 CCACTTGTGAGTTGTAGCTCTGA 0: 1
1: 0
2: 1
3: 8
4: 89
Right 975735033 4:77372736-77372758 AATTCCCCTCCTACTGGTAAGGG 0: 1
1: 1
2: 0
3: 4
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975735028 Original CRISPR TCAGAGCTACAACTCACAAG TGG (reversed) Intronic
903617362 1:24670426-24670448 TCAGATGTATAACTCACAAATGG - Intronic
904860190 1:33532074-33532096 TCAGAGCTAGAACTTACTAACGG - Intronic
906944117 1:50281046-50281068 TCAGAGCTCCAAGTCACATCAGG - Intergenic
907091067 1:51726172-51726194 CCTGAGCAAAAACTCACAAGGGG - Intronic
910123876 1:83819401-83819423 ACAGAGCAACCACTCACTAGAGG + Intergenic
915246134 1:154557781-154557803 TCAGAGGTACTACTGAGAAGGGG + Intronic
916312474 1:163412387-163412409 TGAGACCTACAGCCCACAAGAGG + Intergenic
919554867 1:199038593-199038615 TCAGAGCTACAATTTACATGTGG - Intergenic
920333217 1:205227478-205227500 TCAGAGCTGCAAATGCCAAGGGG - Intergenic
920642556 1:207767554-207767576 TGAGAGCAATAACTCCCAAGTGG + Intronic
922077735 1:222264570-222264592 TCAGGGGTACAACTCATAGGTGG - Intergenic
1063288107 10:4712351-4712373 TCAGAGCCTCAGCTCACATGTGG + Intergenic
1067350882 10:45474496-45474518 TCAGAGCTCTATCTCACAAAGGG + Intronic
1071211397 10:83345803-83345825 CAAAAGCTACACCTCACAAGGGG + Intergenic
1071306814 10:84306632-84306654 TCTGATCTACAACTTACATGTGG - Intergenic
1074975008 10:118572874-118572896 TCACAGCTTCCACCCACAAGTGG + Intergenic
1075567213 10:123513512-123513534 ACAGAGCTACTTATCACAAGAGG - Intergenic
1079978540 11:27124046-27124068 TCAGAGCCACCATGCACAAGGGG + Intronic
1080293131 11:30693803-30693825 TCAGAGAGATAACTCAAAAGTGG + Intergenic
1083361356 11:62110974-62110996 ACAGGGCAACAACTAACAAGAGG + Intergenic
1093528006 12:20125890-20125912 TCAGAGCTTCAAGTAAGAAGTGG - Intergenic
1098661572 12:73101039-73101061 TCAGAGCTACAAGTCACCTGGGG - Intergenic
1106505414 13:30366858-30366880 TCAGAGCTAGAACACTCAGGGGG + Intergenic
1106651416 13:31694363-31694385 TTAGAGCTACTATTCACAATAGG - Intergenic
1107257965 13:38453424-38453446 TGAGACCTACTACTCAAAAGAGG + Intergenic
1107577028 13:41735997-41736019 TGAGAGGAACAATTCACAAGAGG - Intronic
1109527325 13:63593534-63593556 TGAGTGCTACAACTCATAAAAGG - Intergenic
1113211114 13:107982326-107982348 GCAGAGCTTCTACCCACAAGAGG - Intergenic
1121461251 14:94080482-94080504 GCAGAGCCACAGCTGACAAGTGG - Intronic
1126692726 15:51300330-51300352 CCTAAGCTACAACTCACGAGAGG + Intronic
1128690048 15:69717357-69717379 TCAAAGCTTCAAATAACAAGGGG - Intergenic
1129661955 15:77557776-77557798 TCACTGCCACAACTCACATGTGG - Intergenic
1131224819 15:90615742-90615764 TCAAGGCTACTTCTCACAAGAGG - Intronic
1138333296 16:56232252-56232274 TCAGAGCTACGAGGCTCAAGAGG - Intronic
1141083403 16:81073692-81073714 TCAGAGATACAAAGCACAAGAGG + Intronic
1142793166 17:2284989-2285011 ACAGAGATACAACTTACAATCGG + Intronic
1146635931 17:34504541-34504563 TGAGAGTTCCATCTCACAAGAGG - Intergenic
1147338978 17:39742711-39742733 TCTGAGGGACAACTCACATGGGG - Exonic
1150945811 17:69744230-69744252 TAAGACCTACTAGTCACAAGAGG + Intergenic
1151418450 17:73982048-73982070 CCAGAGCTCCGTCTCACAAGTGG - Intergenic
1153325617 18:3816731-3816753 TCAGAGTTACAGCTAAGAAGGGG + Intronic
1153759908 18:8320484-8320506 TCATAGCTACAAATCACATGTGG + Intronic
1155307304 18:24490882-24490904 CCAGAGCCACGACTCAAAAGAGG + Intergenic
1157396208 18:47343764-47343786 TGACAGCTACAACCCACCAGAGG - Intergenic
1157414806 18:47493360-47493382 TGGGAGCTACAACTCACGATGGG - Intergenic
1158850262 18:61489047-61489069 TCAGAGCTGGAGCTCATAAGAGG + Intronic
1165580222 19:36855996-36856018 TCACAGGTTAAACTCACAAGTGG - Intronic
926293705 2:11551880-11551902 TAAGTGCTACAACTTAAAAGAGG - Intronic
926643308 2:15260996-15261018 TCTGAGTTATAACTCACTAGTGG - Intronic
927886406 2:26721323-26721345 TCTGAGCTGCATCTCACAGGAGG + Intronic
929200829 2:39233838-39233860 TCAGATATTCAAATCACAAGTGG + Intergenic
931507300 2:62943945-62943967 TCATAACTACAACTCACAGAGGG + Intronic
933502448 2:83131438-83131460 TCAGAGCTAAAACAAACAATGGG + Intergenic
939126282 2:138181240-138181262 CCAGAGCTAAATCTCAGAAGAGG + Intergenic
941098569 2:161271488-161271510 ATAGAGCTATAACTTACAAGAGG - Intergenic
943989537 2:194670357-194670379 TCAGAGCTATAACTGGTAAGAGG + Intergenic
945194563 2:207226180-207226202 TGAGAGCCACTACTCACATGTGG + Intergenic
946001694 2:216487679-216487701 TCAGAGCAACCACTCACAAGGGG - Intergenic
946870037 2:224076717-224076739 TCAGAGCTACTACTCACCCTGGG + Intergenic
1170696717 20:18665569-18665591 CCTGAGTTACAACTGACAAGTGG + Intronic
1171238212 20:23545101-23545123 CCAGAACTCCAACTCACAGGAGG + Intergenic
1173089347 20:39955442-39955464 GCAGAGCCACAACTCAAAAGAGG - Intergenic
1185156368 22:49195730-49195752 TCAGAGCTGAAACTCTGAAGTGG + Intergenic
949924748 3:9032269-9032291 TCACACCTACATCTCCCAAGAGG - Intronic
955656417 3:61250073-61250095 TCGGAACTACAACTCCCATGTGG - Intronic
957408653 3:79807377-79807399 TCTGAGCTAGGACTCAAAAGTGG + Intergenic
957509251 3:81166661-81166683 TCAGAAATACAACTAAAAAGGGG - Intergenic
962627892 3:137245258-137245280 TAAGAGTTACTACTCAGAAGGGG + Intergenic
962926143 3:139995037-139995059 CCAGAGCCACAACTCAGAACAGG - Intronic
967206288 3:187125450-187125472 TCTGAGCTACAAATAACAAAGGG - Intronic
967946162 3:194805803-194805825 TCAGAACTCCAGCTCCCAAGGGG - Intergenic
975728898 4:77318964-77318986 TTAGCGCTACAACTCACAGGTGG - Intronic
975735028 4:77372686-77372708 TCAGAGCTACAACTCACAAGTGG - Intronic
977211382 4:94222337-94222359 TCAGAGATACAACTGACATAAGG + Intronic
978039293 4:104039572-104039594 TGAGAGCTACAACTAAGATGAGG + Intergenic
980848424 4:138352356-138352378 TTAGAAATACAACTTACAAGGGG - Intergenic
981960502 4:150531969-150531991 ACTGAGCTAAAACTAACAAGAGG - Intronic
982705710 4:158706711-158706733 TCAGAGCCACAGATGACAAGAGG - Exonic
989988389 5:50731043-50731065 TCAGTGCGAAAAATCACAAGAGG + Intronic
992830390 5:80588080-80588102 TCAAAGCTACAATTCCAAAGAGG - Intergenic
995457760 5:112369907-112369929 TCAGACCTACACCTCAGAGGTGG - Intronic
999728410 5:154456360-154456382 TCCAAGCTACAGCTCACACGTGG - Exonic
1000029525 5:157390001-157390023 ACAAAGCTCCAACTCTCAAGAGG - Intronic
1001249754 5:170137979-170138001 TCAGAGCTACAGCTTCAAAGTGG + Intergenic
1026307972 7:69159063-69159085 TGAGAAATACAACTTACAAGAGG - Intergenic
1028919896 7:96299253-96299275 TCAGAACTACACCTCAAAGGGGG + Intronic
1037666955 8:20978128-20978150 TCAGAGCTAGAACTCAAACTGGG + Intergenic
1042350733 8:67774765-67774787 TCAGAGCTACCACTCTCATTAGG - Intergenic
1043488304 8:80720745-80720767 TCAGAGGGAAAACTCAGAAGCGG + Intronic
1044927622 8:97223027-97223049 GCAGACTTACAGCTCACAAGAGG - Intergenic
1047019617 8:120760949-120760971 ACAGATTTACAACTAACAAGAGG + Intronic
1049748294 8:144272224-144272246 TCAGAGCTACAACTTCCAGGTGG + Intronic
1052206194 9:25843854-25843876 TAAGAGATACAAATGACAAGGGG + Intergenic
1052280815 9:26731316-26731338 TTAGGAATACAACTCACAAGGGG - Intergenic
1057266076 9:93619128-93619150 TCAGAGCTACAAAGGAGAAGCGG - Intronic
1186558122 X:10582371-10582393 TCAGTGCTCCAGCTCACAAGAGG + Intronic
1193540145 X:82761255-82761277 TCAGAGTTCTCACTCACAAGTGG - Intergenic
1198127568 X:133661253-133661275 TCAGAACTACAAATCACTTGTGG + Intronic
1199143344 X:144336113-144336135 TCAGAGGAAGAACACACAAGTGG - Intergenic