ID: 975735029

View in Genome Browser
Species Human (GRCh38)
Location 4:77372710-77372732
Sequence ATCTGGACTAGAAGATTATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 118}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975735029_975735032 2 Left 975735029 4:77372710-77372732 CCTTATAATCTTCTAGTCCAGAT 0: 1
1: 0
2: 1
3: 12
4: 118
Right 975735032 4:77372735-77372757 TAATTCCCCTCCTACTGGTAAGG 0: 1
1: 1
2: 0
3: 9
4: 67
975735029_975735031 -3 Left 975735029 4:77372710-77372732 CCTTATAATCTTCTAGTCCAGAT 0: 1
1: 0
2: 1
3: 12
4: 118
Right 975735031 4:77372730-77372752 GATAGTAATTCCCCTCCTACTGG 0: 1
1: 0
2: 0
3: 4
4: 61
975735029_975735038 17 Left 975735029 4:77372710-77372732 CCTTATAATCTTCTAGTCCAGAT 0: 1
1: 0
2: 1
3: 12
4: 118
Right 975735038 4:77372750-77372772 TGGTAAGGGATCTGCTCTGTAGG 0: 1
1: 0
2: 1
3: 10
4: 148
975735029_975735033 3 Left 975735029 4:77372710-77372732 CCTTATAATCTTCTAGTCCAGAT 0: 1
1: 0
2: 1
3: 12
4: 118
Right 975735033 4:77372736-77372758 AATTCCCCTCCTACTGGTAAGGG 0: 1
1: 1
2: 0
3: 4
4: 79
975735029_975735039 25 Left 975735029 4:77372710-77372732 CCTTATAATCTTCTAGTCCAGAT 0: 1
1: 0
2: 1
3: 12
4: 118
Right 975735039 4:77372758-77372780 GATCTGCTCTGTAGGTTTGCTGG 0: 1
1: 0
2: 2
3: 9
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975735029 Original CRISPR ATCTGGACTAGAAGATTATA AGG (reversed) Intronic
903408409 1:23118540-23118562 GTCTTGACTACAAGATTATAAGG + Intronic
909875339 1:80795702-80795724 ATCTTTACTAGAAATTTATAAGG + Intergenic
911610871 1:99958079-99958101 ATCTGAAATAGAAGAGTGTAAGG - Intergenic
912118009 1:106431720-106431742 ATCTGGACTAGAGGATTCTTCGG + Intergenic
912444420 1:109724169-109724191 ATCTGGAAGAAAAGATTAAATGG - Intronic
912686298 1:111768987-111769009 AGTTGGACTAGAAGATTTTTAGG + Intergenic
917632658 1:176905119-176905141 ATCTGGACAAGAAGAGCACAGGG + Intronic
918430840 1:184459164-184459186 ATCTTTACTAGAAGAATAAAAGG + Intronic
918708678 1:187700723-187700745 ATATGGACTAGAGGAATATGTGG + Intergenic
918731439 1:188002104-188002126 ATCTGCAATAGCAAATTATACGG + Intergenic
920523896 1:206651241-206651263 ATCTCGACTAGCAGATCATGAGG - Intronic
922513512 1:226188788-226188810 ATCAGAAGTGGAAGATTATAAGG - Intergenic
922641395 1:227235471-227235493 ATCTGAACTAAAAGAATAAAAGG - Intronic
1063287149 10:4702504-4702526 GTCAGTACTAGAAGATTGTATGG + Intergenic
1068782886 10:60940943-60940965 CTCTGGCCTTGAAGATTTTATGG - Intronic
1073457475 10:103646371-103646393 ATCTGGACTAGGGGAGTATCTGG - Intronic
1073956532 10:108877869-108877891 TTCTGGACTAGAATATTCTGGGG - Intergenic
1077699010 11:4422570-4422592 TTGTGGATTAGAAGAATATAAGG + Intergenic
1077863775 11:6206178-6206200 CTCTGCTCTAGAAGATTATTAGG - Intronic
1078563356 11:12392162-12392184 ATATGGAATAGAATAATATATGG + Intronic
1080722472 11:34863218-34863240 ATCTTGACTAGAAAAGTGTAAGG - Intronic
1081416312 11:42820507-42820529 ATCTGGACCAGAAGCAAATATGG + Intergenic
1081480285 11:43480024-43480046 ATGTGCACTAGAAGATTGGAAGG - Intronic
1083098396 11:60277397-60277419 AACTGGAATAGGAGAATATAAGG + Intergenic
1086858645 11:91898230-91898252 ATCTTCACAAGAAGGTTATAAGG + Intergenic
1088088480 11:106009237-106009259 TTCTGGGCTAGAATTTTATATGG + Exonic
1089425039 11:118366263-118366285 CTCTGGTTTAGAAGATTGTAGGG + Intronic
1095360289 12:41329913-41329935 ATCAGGTATAAAAGATTATAGGG - Intronic
1098703594 12:73659628-73659650 ATCTGGATTAGATGATGAGATGG - Intergenic
1099481167 12:83168446-83168468 AGATGGCCTAGAAGTTTATAGGG - Intergenic
1100960742 12:99960304-99960326 ATCTGTCTTAGAAGTTTATAAGG - Intronic
1101162779 12:101995762-101995784 ATCTAGACTAGAACAGTATCTGG + Intronic
1101189628 12:102318088-102318110 ACCTCCACTAGAAGATTAGAAGG + Intergenic
1108411545 13:50153255-50153277 ACCTGGAGCAGAAGTTTATATGG + Intronic
1108929840 13:55805317-55805339 ATGTGGAACAGAAGATCATAAGG + Intergenic
1109471467 13:62811365-62811387 ATCTTGACTAGATTTTTATATGG + Intergenic
1110294272 13:73843629-73843651 ATCTAGCCTAGAAGATTATTGGG - Intronic
1110461144 13:75747070-75747092 ATCTGGACTAAAAAATGATCTGG + Intronic
1111317280 13:86579643-86579665 ATCTGTACTAGACTATTATTTGG - Intergenic
1112003023 13:95229227-95229249 ATCTGCCCTAGAAGAATATATGG - Intronic
1115049048 14:29033799-29033821 ACCAGGACTACAAGATAATAGGG - Intergenic
1115617693 14:35112071-35112093 AACTGGACAAGAAGAATAAATGG - Intronic
1126272433 15:46835792-46835814 ATCTGAAGTATAATATTATAAGG + Intergenic
1126653771 15:50954364-50954386 ATCTGGACTTGTAGATTTTTGGG + Intronic
1127824876 15:62694333-62694355 ATTTGGACTAGAAGGTGATGAGG + Exonic
1137388710 16:48063705-48063727 ATCTTGACTAGAAGGTAATATGG + Intergenic
1139973655 16:70791945-70791967 ACCTGGACTATAAGAGTAGAGGG - Intronic
1147943561 17:44066997-44067019 ACTTGGACAAGATGATTATAAGG + Intronic
1148322090 17:46763385-46763407 ATCTGGATTAGAAGTTCAAAGGG - Exonic
1149524357 17:57342534-57342556 ATCTGGACTAGAAAATTGAGAGG + Intronic
1153049322 18:886198-886220 CTCTGGACCAGCAGAGTATAAGG - Intergenic
1154965895 18:21355817-21355839 ATCTTTTCAAGAAGATTATAAGG - Intronic
1155569935 18:27182418-27182440 ATGTGTACTTGAAGATTATCAGG - Intronic
1159424813 18:68271568-68271590 ATCTGGACTCGAAGTTTATAAGG - Intergenic
1159848739 18:73500148-73500170 ATTTGGGATAGAAGATTATTAGG - Intergenic
925957370 2:8980448-8980470 ATCTGCACTTGTAGATTATGAGG + Intronic
928818454 2:35328468-35328490 ATAGTGACTAGAATATTATATGG - Intergenic
937575265 2:123413063-123413085 ATCTGGACTTGAAAATTATGGGG - Intergenic
939610527 2:144304147-144304169 ATTTGGAATAGAAGAGTAGACGG + Intronic
939973676 2:148691197-148691219 AGCTAGATTAGAAGAGTATAGGG - Intronic
941661487 2:168199971-168199993 ATCTGGGCTATAAGAGTATCTGG + Intronic
942962332 2:181846297-181846319 ATCATCACTAGAAAATTATAAGG - Intergenic
944835478 2:203575101-203575123 AACAGGACAAGCAGATTATAAGG + Intergenic
945127711 2:206531261-206531283 ATCTGGATTAGAAGACTGGATGG + Intronic
945228851 2:207562433-207562455 ATTTGGACATGAAGATTTTATGG + Intronic
945654735 2:212609420-212609442 ATCTGGAGAAAAAAATTATATGG + Intergenic
946680253 2:222206625-222206647 ATCTTGATTGGAAGATTATATGG + Intronic
1183759691 22:39804908-39804930 GTCTGGGCTAGAAGCTTATATGG - Intronic
952094076 3:29927253-29927275 AACTGGACAAGAAGATTCAATGG - Intronic
953580889 3:44155345-44155367 ATCTAGCCTAAAAGATTATTTGG + Intergenic
954018405 3:47716445-47716467 ATCAAGACTGGAAGAGTATAAGG - Intronic
954934217 3:54312079-54312101 ATCTGAATTAGAGGATTTTAAGG + Intronic
957123002 3:76120412-76120434 ATCAGGATAAGCAGATTATATGG - Intronic
957413235 3:79867447-79867469 ATGTGCAATAGAAGATTTTAGGG - Intergenic
958589659 3:96139364-96139386 ATATGGAATACAAGATTATATGG - Intergenic
958680400 3:97323239-97323261 ATTTTGACTATAAAATTATAAGG + Intronic
959208885 3:103350070-103350092 ATCTGGAACAGAAGAAGATATGG - Intergenic
959887316 3:111517509-111517531 AACTTGACTAGAAGATTCTCAGG + Intronic
959980552 3:112511730-112511752 AACTGGACTACCAGATTTTATGG - Intergenic
964973202 3:162586623-162586645 ATCTGGTCTATAATATTGTAGGG + Intergenic
966168425 3:177048930-177048952 ATCTGAACTAAAATATAATAAGG + Intronic
971941799 4:33224979-33225001 ATTGGCACTAAAAGATTATAAGG - Intergenic
974042673 4:56870962-56870984 ATCTGGTCTATCAGATTTTATGG + Intergenic
974811417 4:66951235-66951257 AGCTGGTGTAGAAGCTTATATGG + Intergenic
975735029 4:77372710-77372732 ATCTGGACTAGAAGATTATAAGG - Intronic
977405739 4:96596103-96596125 ATATGTACTAGAAGATAATAAGG - Intergenic
979836409 4:125373905-125373927 ATCTGTATTAGAAAATAATAAGG + Intronic
979847586 4:125535569-125535591 TTCTGGCCTTGAAGATTAGAGGG + Intergenic
980576891 4:134694487-134694509 ATGTGGAATAGTAGATTTTAGGG + Intergenic
983713681 4:170751369-170751391 ATCTGTATTATAAAATTATATGG - Intergenic
983829746 4:172311549-172311571 ATCTGTTCTAGAAGATAAAATGG + Intronic
983852249 4:172595504-172595526 CTCTGGATTAGAGGAATATATGG - Intronic
984829197 4:183955534-183955556 ATCGGGACTAGTAGCTTTTAAGG + Intronic
987127130 5:14824332-14824354 AACTGGACTAGAAGCATAAAGGG + Intronic
987506179 5:18776035-18776057 CTCTGAACTAAAAAATTATACGG - Intergenic
989047806 5:37289996-37290018 TTCTACATTAGAAGATTATAGGG + Exonic
989118603 5:37980996-37981018 AACTGGACTATAAGACTATGAGG - Intergenic
991565963 5:68004656-68004678 ATCTGGACAAGAATAATCTAAGG + Intergenic
992336791 5:75779259-75779281 ATATGAACTATAAGATTTTAGGG + Intergenic
993108865 5:83631174-83631196 AACTGGAATAGAAAATGATATGG + Intergenic
994146950 5:96406033-96406055 GTCTGGACTGGAAGAAAATAGGG - Intronic
996246989 5:121276327-121276349 ATCTGCACTAGTAGTGTATAAGG + Intergenic
997920513 5:137974766-137974788 ACCTGGGCTAGAATATTGTAAGG - Intronic
1000951172 5:167485119-167485141 AAGTAGACTAGAGGATTATAAGG + Intronic
1001439127 5:171725155-171725177 ATCTGGATTAGAAGCCTAGACGG - Intergenic
1001819394 5:174698226-174698248 TTCTGGACTAGAAAGTGATATGG - Intergenic
1008465228 6:51822642-51822664 ATGTGGACCAGAAGATTGAAAGG - Intronic
1010558885 6:77323251-77323273 CTCTGGTCTAAAAGATAATATGG + Intergenic
1011041916 6:83039179-83039201 ATCTGGACGAGAGGAATGTATGG - Intronic
1012143644 6:95654168-95654190 ATCTGTGCTATAAAATTATATGG - Intergenic
1012824485 6:104129642-104129664 AGATTGACTAGAAGATTAAATGG + Intergenic
1015003088 6:128244245-128244267 ATTTGGAAGAGAAGATTATCAGG + Intronic
1021934240 7:25614430-25614452 ATCTGAACTAGGAGAATATAGGG + Intergenic
1026972529 7:74477018-74477040 ATGGGGACTAGAAGATGAAAGGG + Intronic
1027537759 7:79427223-79427245 ATCTAAACTTGAAGATTCTATGG + Intronic
1028267854 7:88749733-88749755 ATATGGGCTAGAAAAGTATATGG + Intergenic
1034033289 7:147791571-147791593 ATTTGCACTAGGAGAGTATAAGG + Intronic
1034552758 7:151832057-151832079 GTCTGGACTAGAAGGGTACAGGG + Intronic
1038336706 8:26651428-26651450 GTCTGGACTAGAGGATTAATAGG - Intronic
1038625838 8:29192663-29192685 ATCTGGACCAGAAGTCTAAAAGG + Intronic
1038899550 8:31826716-31826738 GTGTGGAGTAGAAGAATATAAGG + Intronic
1039588755 8:38729170-38729192 ATCTGGGCCAGAAGAATACATGG - Intronic
1041850250 8:62383037-62383059 CTCTAGACCAGAGGATTATAAGG - Intronic
1046862333 8:119107441-119107463 AACTGGAGTAGAAGTTTATAGGG - Intergenic
1048994318 8:139782803-139782825 TTCTTGACTAGAAGTTTAAAAGG + Intronic
1051118681 9:13727933-13727955 ATATGAACAAGAATATTATAGGG - Intergenic
1052876186 9:33567237-33567259 AACTGAATTAGAAGAGTATAAGG + Exonic
1057679253 9:97161810-97161832 AACTGAATTAGAAGAATATAAGG - Intergenic
1187986759 X:24821965-24821987 ATATGAACTACATGATTATACGG + Intronic
1191088955 X:56599518-56599540 ATCTTCAACAGAAGATTATAGGG + Intergenic
1194431303 X:93810163-93810185 ATCTGAAATGGAAGATAATAGGG + Intergenic
1196266655 X:113656570-113656592 TACTGGACTTGAAGATTCTACGG - Intergenic