ID: 975735031

View in Genome Browser
Species Human (GRCh38)
Location 4:77372730-77372752
Sequence GATAGTAATTCCCCTCCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 61}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975735028_975735031 21 Left 975735028 4:77372686-77372708 CCACTTGTGAGTTGTAGCTCTGA 0: 1
1: 0
2: 1
3: 8
4: 89
Right 975735031 4:77372730-77372752 GATAGTAATTCCCCTCCTACTGG 0: 1
1: 0
2: 0
3: 4
4: 61
975735029_975735031 -3 Left 975735029 4:77372710-77372732 CCTTATAATCTTCTAGTCCAGAT 0: 1
1: 0
2: 1
3: 12
4: 118
Right 975735031 4:77372730-77372752 GATAGTAATTCCCCTCCTACTGG 0: 1
1: 0
2: 0
3: 4
4: 61
975735027_975735031 22 Left 975735027 4:77372685-77372707 CCCACTTGTGAGTTGTAGCTCTG 0: 1
1: 0
2: 0
3: 15
4: 101
Right 975735031 4:77372730-77372752 GATAGTAATTCCCCTCCTACTGG 0: 1
1: 0
2: 0
3: 4
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975735031 Original CRISPR GATAGTAATTCCCCTCCTAC TGG Intronic
903099874 1:21019957-21019979 GAAAATAATTCCTCTACTACAGG + Intronic
913541747 1:119827592-119827614 GATGGTAATTTCCCTCCTTGTGG + Intergenic
921554083 1:216576041-216576063 GATATTAATTTCCCTGCTCCTGG + Intronic
1063124590 10:3127433-3127455 GACAGTAATTCCCCACCTCAGGG + Intronic
1071958457 10:90784425-90784447 TATAATAATTCCTCCCCTACAGG + Intronic
1075186950 10:120270825-120270847 GATAATAATGCCTCTCCAACAGG + Intergenic
1076170738 10:128317642-128317664 TATAGGAATTCCCCACCTTCTGG - Intergenic
1081743297 11:45455934-45455956 GATAGTAATTCCTCTCTCAAAGG - Intergenic
1086925039 11:92631059-92631081 GATATTTATTTCCCTCCTTCAGG + Intronic
1087893853 11:103565650-103565672 GATAATCATTTCCCTCTTACTGG + Intergenic
1088359000 11:108971498-108971520 GAGAGTAATTACCCTACAACTGG - Intergenic
1090081656 11:123617629-123617651 GACAGTAATACCTATCCTACTGG - Intronic
1090517101 11:127440463-127440485 TATAGTCATTCCCCTACTATTGG - Intergenic
1096072594 12:48783475-48783497 GGTATTAATACCACTCCTACTGG - Exonic
1096228951 12:49887022-49887044 GTTAGTAGTTACCCTCCTAGGGG - Intronic
1108283479 13:48882565-48882587 GATTGTAATTCTGCTCCTACTGG - Intergenic
1117835668 14:59803358-59803380 GATACTAGTTCCCCTCCTGAAGG - Intronic
1120256386 14:82124680-82124702 GATTGTAATTTGCCTCCTCCTGG - Intergenic
1120816807 14:88869462-88869484 GATTGTTATTCCTCTCCTAATGG + Intronic
1130427894 15:83819870-83819892 CATAGTAATGCCCCTGATACTGG - Exonic
1130538639 15:84804583-84804605 GTTAGTAATTCCCATCCAACTGG + Exonic
1132479837 16:161501-161523 TCTAGTAATTCCCCTTCTAGAGG + Intronic
1138183601 16:54959886-54959908 GACATTAATTCCCCTCCTGATGG + Intergenic
1138998869 16:62484573-62484595 TCTAGTAATTCCCCTTCTCCAGG + Intergenic
1149154837 17:53615535-53615557 TTTCGTTATTCCCCTCCTACAGG + Intergenic
1162731968 19:12723737-12723759 GATAGCTGTTCCCCTCCTTCAGG - Intronic
933660240 2:84921543-84921565 GATAAGAATTCCTGTCCTACAGG - Intergenic
938736910 2:134193986-134194008 GATGGTATTGCACCTCCTACTGG + Intronic
942403584 2:175629466-175629488 GTTTGTAATTCCCTTTCTACAGG + Intergenic
946210082 2:218140452-218140474 GTTCCTAATTCCTCTCCTACTGG - Intergenic
946896506 2:224329542-224329564 AAGACTATTTCCCCTCCTACAGG + Intergenic
1174881008 20:54279699-54279721 GATACTAATTCCATTCCTAAGGG + Intergenic
1175572304 20:60033213-60033235 AATAGTAACACCCCTCTTACAGG + Intronic
1181263913 22:21619031-21619053 GGTAGTAATTCTCCTGTTACAGG + Intronic
1181848207 22:25730172-25730194 GATGCTATTTCCCCTCCTTCTGG - Intergenic
962026761 3:131555958-131555980 GATAGTTATTCCCCTTCTGCAGG + Intronic
967765319 3:193272583-193272605 TGTAGTAATTCCCCTGCTTCGGG - Intronic
971084411 4:23254805-23254827 AATAGTAATTGCCATCCTAACGG + Intergenic
975728903 4:77319011-77319033 AGAAGTAATTCCTCTCCTACTGG + Intronic
975735031 4:77372730-77372752 GATAGTAATTCCCCTCCTACTGG + Intronic
977714220 4:100163133-100163155 GATAGTAATTTCCACCCTGCAGG + Intergenic
979211896 4:118114784-118114806 GATAATATTTCCCCCCCTAAAGG + Exonic
980002169 4:127502682-127502704 GAAAATAATTCCCATACTACAGG + Intergenic
981083958 4:140663707-140663729 GATAGGACTTCCCCTCTTATAGG - Intronic
982117982 4:152113599-152113621 GATACTATTTCCTCTCCTTCAGG + Intergenic
993530728 5:89021521-89021543 GATAATAATCCCCTTCCTTCTGG - Intergenic
996399128 5:123041612-123041634 GATATTAATTCTCCGTCTACTGG + Intergenic
996744176 5:126831847-126831869 GATAGTACTTCCTCCCCTGCAGG + Intronic
998573250 5:143284711-143284733 GCCTGGAATTCCCCTCCTACTGG + Intronic
1008394648 6:50992565-50992587 GATAGGCATTCCCCTACTATTGG - Intergenic
1016052905 6:139549026-139549048 GATAATGATACCCATCCTACAGG - Intergenic
1016581349 6:145632113-145632135 GATAGTAATTTCCACCTTACAGG - Intronic
1018428636 6:163705527-163705549 GAAACTATTTCCCCTCCCACAGG - Intergenic
1021694033 7:23259034-23259056 GGAAGTAATTCCTCTCCTTCAGG - Intronic
1035577469 8:716943-716965 GATAGAAATAACCCTCCTACAGG + Intronic
1039483164 8:37890548-37890570 GACAGAAATTCCTCTCCTGCAGG - Intronic
1041854269 8:62432603-62432625 GATAGTGATTTCCCTGATACAGG - Intronic
1042068182 8:64901928-64901950 GATAGCACTTGCCCTGCTACTGG + Intergenic
1042666846 8:71216342-71216364 GGTTGTAAATCTCCTCCTACAGG - Intronic
1048767889 8:137863838-137863860 GATAGTAAGTGCCTTCCTAGAGG - Intergenic
1055915576 9:81396891-81396913 GATTTTAATTCCCATCCTCCAGG - Intergenic
1059355318 9:113694748-113694770 GAAAGAAATTCCCATTCTACTGG + Intergenic
1060813465 9:126622934-126622956 GGTAGTAATTCCAATCTTACAGG + Intronic
1189254041 X:39623677-39623699 GATAGACATTCCCTTCCTAAAGG + Intergenic
1193841746 X:86415777-86415799 TATTGTAATTTCCCTCTTACTGG - Intronic
1197980850 X:132217471-132217493 GATGGTAATGCCCTTCCTATAGG + Exonic