ID: 975735032

View in Genome Browser
Species Human (GRCh38)
Location 4:77372735-77372757
Sequence TAATTCCCCTCCTACTGGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 1, 2: 0, 3: 9, 4: 67}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975735028_975735032 26 Left 975735028 4:77372686-77372708 CCACTTGTGAGTTGTAGCTCTGA 0: 1
1: 0
2: 1
3: 8
4: 89
Right 975735032 4:77372735-77372757 TAATTCCCCTCCTACTGGTAAGG 0: 1
1: 1
2: 0
3: 9
4: 67
975735029_975735032 2 Left 975735029 4:77372710-77372732 CCTTATAATCTTCTAGTCCAGAT 0: 1
1: 0
2: 1
3: 12
4: 118
Right 975735032 4:77372735-77372757 TAATTCCCCTCCTACTGGTAAGG 0: 1
1: 1
2: 0
3: 9
4: 67
975735027_975735032 27 Left 975735027 4:77372685-77372707 CCCACTTGTGAGTTGTAGCTCTG 0: 1
1: 0
2: 0
3: 15
4: 101
Right 975735032 4:77372735-77372757 TAATTCCCCTCCTACTGGTAAGG 0: 1
1: 1
2: 0
3: 9
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975735032 Original CRISPR TAATTCCCCTCCTACTGGTA AGG Intronic
900543330 1:3215190-3215212 GAAGTCCACTCCTACTGCTAAGG + Intronic
902959448 1:19952307-19952329 TAATGCCAGTACTACTGGTAGGG - Intergenic
902962440 1:19974426-19974448 TACTTCCCCTCCTGCTGTTCAGG - Intergenic
905915515 1:41681806-41681828 TATGTCCCCTCCTCCTGATATGG + Intronic
907478352 1:54723659-54723681 TAATTCTCCTTCTACTAGTGAGG - Intronic
913265342 1:117037801-117037823 TTATTCCTGTCCTACAGGTAAGG + Intergenic
917999125 1:180474597-180474619 TAATTCCCCTCTTACAGATGAGG - Intronic
918567083 1:185947143-185947165 CAATGTCCCACCTACTGGTAAGG + Intronic
923978078 1:239287446-239287468 TATTTCCCCTCTTTCTGGGAAGG + Intergenic
924658939 1:245998477-245998499 TAATAGCCCTCCTAATGGGATGG - Intronic
1065395301 10:25229884-25229906 CAATTCCTCTCCTACTGAGAAGG - Intronic
1068798171 10:61107474-61107496 CCTTTCCCCTCCTGCTGGTAAGG - Intergenic
1075252725 10:120895708-120895730 TATTTGACCTCCTACTGGTAAGG + Intronic
1076369610 10:129943210-129943232 GAAATCCCCTCCAACTGGGAAGG - Intronic
1084509986 11:69597365-69597387 TCATTCCCCTCCTACTTGTGGGG - Intergenic
1086295295 11:85360331-85360353 TTATTCTCCTCCTACAGGTGAGG - Intronic
1086530285 11:87777275-87777297 TGAATCCCCTTCTACTGATATGG + Intergenic
1092654906 12:10674003-10674025 TATTTCCCCTCCGACTGGGCCGG - Exonic
1099119645 12:78672264-78672286 TAATTTCCCTCATCCTGCTAGGG - Intergenic
1101285159 12:103304179-103304201 TAATTCCCATCTTTCGGGTAAGG - Intronic
1106652074 13:31702062-31702084 TACTTCCTATCATACTGGTATGG + Intergenic
1111793237 13:92885353-92885375 TAATTACCGTTCTTCTGGTAAGG - Intergenic
1113628968 13:111867343-111867365 TCTTTCTCCCCCTACTGGTATGG + Intergenic
1114726083 14:24939181-24939203 TAAATCCCCTCCTAGTGCTCCGG + Intronic
1116655081 14:47642221-47642243 TAATTCCCATTTTACTGGTGAGG - Intronic
1119307769 14:73621442-73621464 CAATTACCCTCCTACTGAGAAGG + Intergenic
1121368313 14:93334395-93334417 AAATTCCCCTCTAGCTGGTAAGG + Intronic
1133410313 16:5562687-5562709 ACATTCCCCTGCTTCTGGTATGG + Intergenic
1135949688 16:26902500-26902522 TAATTCCCCAAATACTGGAATGG - Intergenic
1144170241 17:12652832-12652854 TTATTCCCATCCTACGGATAGGG - Intergenic
1146818471 17:35964454-35964476 TAAATTCACTCCTACTGGTAGGG - Intergenic
1150197711 17:63318104-63318126 TAAATTCACTCCTACTGGTAAGG + Intronic
1153039431 18:797807-797829 TGATTTCTCTCTTACTGGTAGGG + Intronic
1156500977 18:37558166-37558188 TAATTCCCCTTCTACTTTTGAGG + Intronic
1159969074 18:74627013-74627035 TAATGCCCCTCCTTGTGCTATGG + Intronic
933001606 2:76931562-76931584 TAGTTGTCCTCCTACTGATAAGG + Intronic
939257375 2:139760998-139761020 TCAATCCCCTACTGCTGGTATGG + Intergenic
942403585 2:175629471-175629493 TAATTCCCTTTCTACAGGTGAGG + Intergenic
943902282 2:193455653-193455675 TAATACCCCTACTACTTATAGGG + Intergenic
945364187 2:208930589-208930611 TAATACCCTTCTGACTGGTATGG - Intergenic
956771789 3:72532845-72532867 CTGTCCCCCTCCTACTGGTAGGG + Intergenic
957532346 3:81456425-81456447 TTATTCTCTTCTTACTGGTAGGG - Intergenic
959184813 3:103032980-103033002 TAATTCCCACCCAACTGGTATGG + Intergenic
960701320 3:120442221-120442243 TGATTCCCATTCTACTGGTAAGG + Intronic
961168917 3:124781929-124781951 CTATTCCTCTCCTACTGGTGAGG - Intronic
961419957 3:126795314-126795336 TAATTTCCATCATGCTGGTATGG + Intronic
963430936 3:145201782-145201804 TAATTTCTGTCCTACTGGCATGG + Intergenic
970112863 4:12658242-12658264 GTGTTCCCCTCCTACTGGGATGG - Intergenic
973694116 4:53472904-53472926 TTATTCTCTTCTTACTGGTAGGG - Intronic
974869086 4:67616548-67616570 TAAATCCCATACTACTGGTTAGG - Exonic
975728904 4:77319016-77319038 TAATTCCTCTCCTACTGGTAAGG + Intronic
975735032 4:77372735-77372757 TAATTCCCCTCCTACTGGTAAGG + Intronic
978036915 4:104006454-104006476 TACTTCCTCTCCAACTGGAATGG + Intergenic
981629428 4:146801356-146801378 TAATTCTCATACTACTGGCATGG - Intronic
986624355 5:9709497-9709519 GAAGTCCCCTCCCACTGGTTGGG + Intronic
987945966 5:24609150-24609172 GAATTCCCATCCCACTGGGAAGG + Intronic
995286951 5:110400132-110400154 TAATTCCCCTCTTATAGGTCAGG + Intronic
997888178 5:137650390-137650412 TGTTTCCCCTCCTCCTGGTCTGG + Intronic
998055854 5:139076741-139076763 CAATTCCCCTTCTATTGGTATGG + Intronic
998585918 5:143427537-143427559 GAATTCCCATCCTAGTGGGAAGG + Intronic
1001468901 5:171994320-171994342 TTATTTCCCCCCTACTGGTGAGG - Intronic
1006129629 6:31861518-31861540 TAATTTCCCACCTTCTGCTAGGG + Intronic
1009929686 6:70162708-70162730 TAATTACATTCCTACTGGTGTGG - Intronic
1015251623 6:131133931-131133953 TCATTCTCCTCTTTCTGGTATGG + Intergenic
1017698354 6:157042008-157042030 TGATTCACCTCCTACAGGTCTGG + Intronic
1018202135 6:161404972-161404994 TAATTCTTCTCTTACTGGGATGG + Intronic
1022320288 7:29281565-29281587 AAGTTCCCCTCCTATTGGCAAGG + Intronic
1024356257 7:48416497-48416519 TGATTCCCAACCTACAGGTAAGG - Intronic
1024581101 7:50801856-50801878 TCCTTGCCCTCCTACTGTTAGGG + Intergenic
1028163456 7:87511611-87511633 TAATTCCCATTTTACTGATAAGG + Intronic
1032448656 7:132007022-132007044 TGATTTCCCTCCTACTAGAATGG - Intergenic
1044841191 8:96338574-96338596 TTATTCCCCTGCTCCTGGTCTGG - Intergenic
1046390276 8:113563263-113563285 TAATTGCCCTTTGACTGGTAGGG + Intergenic
1049402050 8:142432651-142432673 TAATTCCCCTCTTAAAGGTAGGG - Intergenic
1192833587 X:74776118-74776140 AAATTCCCCTTCTACTTGGATGG - Intronic
1194266929 X:91765611-91765633 TCATTCCCCTCTTTCTGGTATGG - Intergenic
1196160105 X:112473882-112473904 TAATTGCCCACCTGCTGGGATGG - Intergenic
1200584128 Y:4986522-4986544 TCATTCCCCTCTTTCTGTTATGG - Intergenic