ID: 975735032

View in Genome Browser
Species Human (GRCh38)
Location 4:77372735-77372757
Sequence TAATTCCCCTCCTACTGGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 1, 2: 0, 3: 9, 4: 67}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975735027_975735032 27 Left 975735027 4:77372685-77372707 CCCACTTGTGAGTTGTAGCTCTG 0: 1
1: 0
2: 0
3: 15
4: 101
Right 975735032 4:77372735-77372757 TAATTCCCCTCCTACTGGTAAGG 0: 1
1: 1
2: 0
3: 9
4: 67
975735029_975735032 2 Left 975735029 4:77372710-77372732 CCTTATAATCTTCTAGTCCAGAT 0: 1
1: 0
2: 1
3: 12
4: 118
Right 975735032 4:77372735-77372757 TAATTCCCCTCCTACTGGTAAGG 0: 1
1: 1
2: 0
3: 9
4: 67
975735028_975735032 26 Left 975735028 4:77372686-77372708 CCACTTGTGAGTTGTAGCTCTGA No data
Right 975735032 4:77372735-77372757 TAATTCCCCTCCTACTGGTAAGG 0: 1
1: 1
2: 0
3: 9
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975735032 Original CRISPR TAATTCCCCTCCTACTGGTA AGG Intronic