ID: 975735033

View in Genome Browser
Species Human (GRCh38)
Location 4:77372736-77372758
Sequence AATTCCCCTCCTACTGGTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 1, 2: 0, 3: 4, 4: 79}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975735027_975735033 28 Left 975735027 4:77372685-77372707 CCCACTTGTGAGTTGTAGCTCTG 0: 1
1: 0
2: 0
3: 15
4: 101
Right 975735033 4:77372736-77372758 AATTCCCCTCCTACTGGTAAGGG 0: 1
1: 1
2: 0
3: 4
4: 79
975735028_975735033 27 Left 975735028 4:77372686-77372708 CCACTTGTGAGTTGTAGCTCTGA 0: 1
1: 0
2: 1
3: 8
4: 89
Right 975735033 4:77372736-77372758 AATTCCCCTCCTACTGGTAAGGG 0: 1
1: 1
2: 0
3: 4
4: 79
975735029_975735033 3 Left 975735029 4:77372710-77372732 CCTTATAATCTTCTAGTCCAGAT 0: 1
1: 0
2: 1
3: 12
4: 118
Right 975735033 4:77372736-77372758 AATTCCCCTCCTACTGGTAAGGG 0: 1
1: 1
2: 0
3: 4
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975735033 Original CRISPR AATTCCCCTCCTACTGGTAA GGG Intronic
901747340 1:11382900-11382922 ACTACCCCTCCTACTAGAAATGG - Intergenic
902096907 1:13953187-13953209 AATTCACCTCCAACATGTAAGGG - Intergenic
902962439 1:19974425-19974447 ACTTCCCCTCCTGCTGTTCAGGG - Intergenic
904472076 1:30742201-30742223 AAATCCCCACCAGCTGGTAAAGG - Intronic
909342652 1:74549068-74549090 TATTCAAATCCTACTGGTAATGG - Intergenic
922120448 1:222662109-222662131 AAACCCTCTCCTTCTGGTAAGGG + Exonic
923978079 1:239287447-239287469 ATTTCCCCTCTTTCTGGGAAGGG + Intergenic
1075086855 10:119419466-119419488 TATTCCCATCTTACTGGCAAAGG + Intronic
1078006802 11:7538270-7538292 CATCCTCCTCCTACTGGAAATGG - Intronic
1079437085 11:20467353-20467375 TATTCCCATCTTACTGGTGAAGG + Intronic
1080161081 11:29177270-29177292 AATTGCCCTCCCACTGGGACTGG + Intergenic
1084509985 11:69597364-69597386 CATTCCCCTCCTACTTGTGGGGG - Intergenic
1100737985 12:97559211-97559233 ATTTCCACTCCTACTGTTATCGG + Intergenic
1104630311 12:130395208-130395230 AATTACACTCACACTGGTAATGG + Intergenic
1107407767 13:40130588-40130610 AATTCGCCTCCTATGGGGAAAGG - Intergenic
1108771516 13:53707555-53707577 AATTTCCTTCTCACTGGTAAAGG + Intergenic
1108796850 13:54042598-54042620 AATTCTCCTCTTCCAGGTAAAGG + Intergenic
1112666335 13:101578666-101578688 AATTCCCTTTCTACTTGTCAAGG - Intronic
1115081855 14:29462926-29462948 AATTGCCCTCTTACAGGGAATGG - Intergenic
1116655080 14:47642220-47642242 AATTCCCATTTTACTGGTGAGGG - Intronic
1118927322 14:70204649-70204671 ACTTCCCCTCATGCTTGTAACGG + Intergenic
1121368314 14:93334396-93334418 AATTCCCCTCTAGCTGGTAAGGG + Intronic
1122255466 14:100472751-100472773 ATTCCCCTTCCTCCTGGTAATGG + Intronic
1133410314 16:5562688-5562710 CATTCCCCTGCTTCTGGTATGGG + Intergenic
1133948200 16:10366937-10366959 AATTCCCCTCTTACTGAGTATGG - Intronic
1136379171 16:29884032-29884054 CATTCCTCTTCTTCTGGTAACGG + Intronic
1138548940 16:57736498-57736520 AATTCCCCAGCTCCTGGCAAGGG - Intronic
1151267989 17:72971414-72971436 ACTTCCCCTCCCACAGGAAATGG + Intronic
1154953977 18:21237925-21237947 AATTCACCTTCTACTAGAAAGGG - Intergenic
1161422067 19:4181386-4181408 AAAACCCCTCCTTCTAGTAAGGG - Intronic
1168085763 19:54044710-54044732 TATTTCCCTCCCACTGGTGAAGG + Intronic
925472126 2:4174227-4174249 GATTCCCTTCCTATTGGCAATGG + Intergenic
927684328 2:25160384-25160406 AATAACCCTCATACTGGGAAGGG + Intergenic
931538331 2:63302365-63302387 ATTTCCTATCCTACTGGGAATGG - Intronic
937339033 2:121079218-121079240 AATGCCCCTCCTTCTGCTCAAGG - Intergenic
946210080 2:218140446-218140468 AATTCCTCTCCTACTGGCAGTGG - Intergenic
948503405 2:238411141-238411163 AATTCCCCTCCTCCTAGAAGAGG + Intergenic
1174308148 20:49629691-49629713 CATTCCCCTCCTAATGGACATGG - Intergenic
1179129846 21:38625286-38625308 AATTCACCTCTTAGAGGTAAAGG + Intronic
1183578571 22:38708284-38708306 AATACTCCTCGTAGTGGTAATGG + Intronic
950498437 3:13348477-13348499 AACTCCCCTCTTCTTGGTAATGG + Intronic
955803803 3:62713229-62713251 ATTTCTCCTTCTCCTGGTAAAGG + Intronic
965209008 3:165760246-165760268 AATTCACATTCTACTGGTATAGG - Intergenic
968348999 3:198036648-198036670 CATTCCCCTCCTGCTTCTAAAGG - Intronic
974869085 4:67616547-67616569 AAATCCCATACTACTGGTTAGGG - Exonic
975728905 4:77319017-77319039 AATTCCTCTCCTACTGGTAAGGG + Intronic
975735033 4:77372736-77372758 AATTCCCCTCCTACTGGTAAGGG + Intronic
977656632 4:99529322-99529344 ATTTCCCTTCCAACTGATAAAGG + Intronic
987945967 5:24609151-24609173 AATTCCCATCCCACTGGGAAGGG + Intronic
988196708 5:28013970-28013992 ACTTCCCTTCCTATTGGGAATGG - Intergenic
989373959 5:40740323-40740345 AAGTCCAGGCCTACTGGTAATGG + Intronic
994363312 5:98881092-98881114 AATTCATCTCCTACAGTTAAAGG + Exonic
995330881 5:110944694-110944716 AATGCCCCTCCTCCTGTTTAGGG - Intergenic
995929930 5:117428395-117428417 TATTCCTCTCCTACTCCTAAAGG + Intergenic
996165880 5:120222510-120222532 AATTCCCCTCCTACCTGAAATGG + Intergenic
998962780 5:147506646-147506668 AATTGCCCTCATACATGTAACGG + Intronic
1000705711 5:164508785-164508807 AATTACCCTCATTTTGGTAATGG - Intergenic
1000714298 5:164621817-164621839 ATGTCCCCTCCTCCTGGGAATGG + Intergenic
1005705395 6:28446759-28446781 AAAACCCATCCTACTGTTAATGG - Intergenic
1006289218 6:33121631-33121653 GCTTCCCTTCCTACTGGGAATGG + Intergenic
1010669495 6:78670983-78671005 ACCTCCCCACCTACTGGAAAAGG - Intergenic
1010831220 6:80532331-80532353 ACTTCCCCTCCTCATGGTAGTGG - Intergenic
1018035570 6:159878497-159878519 AAAGCCCCACCTCCTGGTAAAGG + Intergenic
1018968567 6:168508623-168508645 TTTTCCTCTCTTACTGGTAAAGG + Intronic
1021331837 7:19347554-19347576 AATTCCACTTCTACTAGTGAGGG - Intergenic
1021775901 7:24055342-24055364 AGTTCTCCACCTAATGGTAAAGG - Intergenic
1024356256 7:48416496-48416518 GATTCCCAACCTACAGGTAAGGG - Intronic
1026383131 7:69819209-69819231 AATTCCATTTCTACTGGAAAAGG - Intronic
1028798086 7:94928068-94928090 GATTCCTCTCCTCCTGATAAAGG - Intronic
1030621513 7:111795831-111795853 AATTTCCATCCTCCTGGAAAAGG + Intronic
1032329785 7:130967317-130967339 ACTTCCCCTGCTACTGGAACTGG - Intergenic
1034012019 7:147539334-147539356 TATTCCCCTTCTACAGATAATGG + Intronic
1034671692 7:152863560-152863582 CATTCCCCTCCTTCAGCTAAAGG - Intergenic
1048063963 8:130949014-130949036 AATTCTCCTCCCCCTAGTAACGG + Intronic
1059007957 9:110424242-110424264 AATTACCATCTTACTGGTAGAGG - Intronic
1059705686 9:116821208-116821230 AATTACACTCATACTGGTAGAGG - Intronic
1187665802 X:21608172-21608194 CATACCACTCCTCCTGGTAAAGG - Intronic
1190228148 X:48561283-48561305 ATTTCCCCTCCATCAGGTAAAGG - Exonic
1190453459 X:50603339-50603361 AATGCCACTCCTACTTGAAATGG + Intronic
1192833586 X:74776117-74776139 AATTCCCCTTCTACTTGGATGGG - Intronic
1194266928 X:91765610-91765632 CATTCCCCTCTTTCTGGTATGGG - Intergenic
1196074998 X:111566447-111566469 TATTCCCATCCTTCTGGTATAGG + Intergenic
1198523873 X:137480103-137480125 AATTTCCCTTCAACTGGAAAAGG - Intergenic
1200873461 Y:8127532-8127554 AATTCACCTACTACTGAGAAAGG + Intergenic
1200888069 Y:8291897-8291919 ACTTCCTCTTCTTCTGGTAAAGG + Intergenic