ID: 975735093

View in Genome Browser
Species Human (GRCh38)
Location 4:77373068-77373090
Sequence CTCAATCCCCAGAGTAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 147}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975735082_975735093 17 Left 975735082 4:77373028-77373050 CCCAGCCAGAACTGGGGCAGCCG 0: 1
1: 1
2: 4
3: 9
4: 147
Right 975735093 4:77373068-77373090 CTCAATCCCCAGAGTAAGGAGGG 0: 1
1: 0
2: 0
3: 13
4: 147
975735084_975735093 12 Left 975735084 4:77373033-77373055 CCAGAACTGGGGCAGCCGTCATG 0: 1
1: 0
2: 1
3: 14
4: 105
Right 975735093 4:77373068-77373090 CTCAATCCCCAGAGTAAGGAGGG 0: 1
1: 0
2: 0
3: 13
4: 147
975735083_975735093 16 Left 975735083 4:77373029-77373051 CCAGCCAGAACTGGGGCAGCCGT 0: 1
1: 1
2: 3
3: 9
4: 127
Right 975735093 4:77373068-77373090 CTCAATCCCCAGAGTAAGGAGGG 0: 1
1: 0
2: 0
3: 13
4: 147
975735081_975735093 18 Left 975735081 4:77373027-77373049 CCCCAGCCAGAACTGGGGCAGCC 0: 2
1: 0
2: 8
3: 44
4: 336
Right 975735093 4:77373068-77373090 CTCAATCCCCAGAGTAAGGAGGG 0: 1
1: 0
2: 0
3: 13
4: 147
975735090_975735093 -3 Left 975735090 4:77373048-77373070 CCGTCATGGACATGGGGGCACTC 0: 1
1: 0
2: 1
3: 7
4: 115
Right 975735093 4:77373068-77373090 CTCAATCCCCAGAGTAAGGAGGG 0: 1
1: 0
2: 0
3: 13
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975735093 Original CRISPR CTCAATCCCCAGAGTAAGGA GGG Intronic
902173736 1:14633729-14633751 CTGAATCCTCAGAGAGAGGATGG - Intronic
902640053 1:17761370-17761392 CTCAGTCCCCGGAGGTAGGAGGG - Intronic
902712502 1:18249955-18249977 CTCTCTCCCCAGGGAAAGGAGGG - Intronic
904377375 1:30090338-30090360 CTGCATCCCCAGAGAAAGGGAGG + Intergenic
905361418 1:37423405-37423427 AGCATTCCCCAGAGAAAGGAGGG + Intergenic
910195981 1:84640112-84640134 CTGAATTCCAAGAGGAAGGAGGG + Intergenic
910413953 1:86977668-86977690 CTCAAGCCCAAGAGAAAGCAAGG + Intronic
914392809 1:147237170-147237192 CTCCATTCCCAGAGCAAGGTTGG - Intronic
915098892 1:153484495-153484517 CCTAATTCCCAGAGTGAGGAGGG - Intergenic
915648821 1:157293022-157293044 CTCCATCCCCACAGTAGAGAAGG + Intergenic
916610939 1:166390873-166390895 CTCAGACCTCAGAGAAAGGAAGG + Intergenic
917132200 1:171754764-171754786 GGCAGTCACCAGAGTAAGGAAGG + Intergenic
917630083 1:176883100-176883122 CTCAATCTCTAGAGTAGAGAAGG + Intronic
918113778 1:181480666-181480688 CTCAATGCCCAGAATAAGCAGGG - Intronic
919690648 1:200525626-200525648 CTAAATCCTCAGAGTAAGAATGG - Intergenic
920560822 1:206937223-206937245 CTCAACCCCCAGGACAAGGATGG - Exonic
920856361 1:209665827-209665849 CTCAATCCCCAGAATATGCCAGG + Intergenic
920966385 1:210704944-210704966 CACAAACCCCAGAGAAGGGAAGG - Intronic
921345238 1:214176960-214176982 ATCAATTCCCACATTAAGGATGG + Intergenic
922033596 1:221827048-221827070 CTCAATCCCCAGAACAATGTGGG - Intergenic
924449538 1:244165150-244165172 CTTAATCAACAGAGTGAGGAAGG + Intergenic
1064219846 10:13431262-13431284 CTCAATCCCAACAGCAAAGAGGG + Intergenic
1064749139 10:18508369-18508391 CTGAATCCACAGAGGAAGGGAGG + Intronic
1067131607 10:43570296-43570318 CTCAAGCCCCGGAGTAAAGGTGG + Intronic
1073336412 10:102713971-102713993 CCCTGTCCCCAGAGTAATGATGG + Intronic
1073440119 10:103547567-103547589 CAGAATCCCCAGAGGAAGGAGGG + Intronic
1076223650 10:128756108-128756130 CTCCAGCACCAGAGGAAGGAAGG + Intergenic
1077485500 11:2836600-2836622 AGCAATCCCCACAGAAAGGAGGG + Intronic
1078100186 11:8325853-8325875 ATCATACCACAGAGTAAGGAAGG - Intergenic
1083541608 11:63515484-63515506 CTCAGCCCCCAGGGGAAGGATGG - Intronic
1083581953 11:63830675-63830697 CTCACTACCCAGAGTTAGCACGG + Intergenic
1084489611 11:69471230-69471252 CTCAAACCCCAGGGTAGGGAAGG + Intergenic
1084495271 11:69499819-69499841 CTCAAGCCCTGGAGTCAGGAAGG - Intergenic
1085491589 11:76924095-76924117 CTCAAGCCACAGCATAAGGAGGG - Intronic
1086854585 11:91850977-91850999 CTCAATCCACAGAGTCTGGCTGG - Intergenic
1088894363 11:114066632-114066654 CTCTCTCCCCAGAGGAATGAGGG - Intronic
1089638110 11:119829620-119829642 CTCAGTCCCCAGGGTCAGGCTGG + Intergenic
1090169267 11:124584465-124584487 CTCAATTCTCAGAGTGTGGAGGG - Intergenic
1091556145 12:1574775-1574797 GTAAGTCCCCAGAGTAAGGCGGG - Intronic
1091996541 12:4998192-4998214 CTCAGTCCCCTGAGGAAGGGTGG - Intergenic
1093653520 12:21670989-21671011 CACAAACTCCAGAGAAAGGAAGG + Intronic
1094131933 12:27083903-27083925 GTGAAGCCCCAGAGTAAGTAGGG + Intergenic
1095324298 12:40869382-40869404 CTCAGTCGCCAGAGTAAGTTTGG + Intronic
1097079922 12:56422419-56422441 CTCAGTCCCTAGAGTCAGAATGG - Intronic
1097240035 12:57568866-57568888 CTCAGTCCACGGAGGAAGGAAGG - Intronic
1098695444 12:73548123-73548145 CTCAGTCCAGAGAGAAAGGAAGG + Intergenic
1101407627 12:104442524-104442546 TTCTTTCTCCAGAGTAAGGAAGG - Intergenic
1103424656 12:120822671-120822693 CTTGAGCCCCAGAGCAAGGAGGG + Intronic
1103719427 12:122965529-122965551 CTCAAGTCCCAGAGTGAGGCTGG - Intronic
1106433732 13:29706102-29706124 GTCTGTCCCCAGAGTCAGGAGGG - Intergenic
1108556617 13:51599646-51599668 CTCAAAGTCCAGAGTAAGAAGGG - Intronic
1109442880 13:62398058-62398080 CTGAATTCCCAAAGGAAGGAGGG - Intergenic
1112788739 13:102980497-102980519 CTCAATCAGCACAGAAAGGACGG - Intergenic
1114039985 14:18668813-18668835 CTTAATCACCAGAGAAAAGAGGG - Intergenic
1114045019 14:18867336-18867358 CTTAATCACCAGAGAAAAGAGGG - Intergenic
1114069182 14:19094659-19094681 CTGCATCCCCAGAGTAAGATGGG + Intergenic
1114093078 14:19305344-19305366 CTGCATCCCCAGAGTAAGGTGGG - Intergenic
1114119191 14:19652132-19652154 CTTAATCACCAGAGAAAAGAGGG + Intergenic
1115023097 14:28707092-28707114 TTCAATCCCCAGCATAAAGAGGG + Intergenic
1117067321 14:52023544-52023566 CTCAGGCCCCTGAGTAATGATGG + Intronic
1121091203 14:91184018-91184040 CTCATTCCCCAGAGTCAGGTGGG + Intronic
1121507795 14:94489885-94489907 CTCCATCCACAGAATGAGGAGGG + Intronic
1123933067 15:25181177-25181199 CTCCATCCCCAGAGAAAGGTGGG + Intergenic
1125241514 15:37582251-37582273 CTCAGTGCCCAGAGTCCGGAGGG - Intergenic
1125678850 15:41517972-41517994 CTCCATCTTCAGAGGAAGGAAGG - Intronic
1125921462 15:43528052-43528074 CTCGATCCCCAGAGAAGGCAAGG - Exonic
1129480570 15:75821843-75821865 ATAAAACCCCAGAGTAAGGTAGG - Intergenic
1129872453 15:78949278-78949300 CTTAATCCCCATTGTACGGATGG + Intronic
1130135834 15:81181329-81181351 TTCAATAATCAGAGTAAGGAAGG + Intronic
1131041647 15:89273624-89273646 ATCAATCCCCAGAGAACAGAGGG - Intronic
1133003087 16:2860868-2860890 CTCAATTCCCAGGGTATAGAGGG + Intergenic
1133461248 16:5988499-5988521 CTAAGTTCCCAGAGGAAGGAGGG + Intergenic
1137334380 16:47533527-47533549 ATCAATGCCCAGAGTCTGGAGGG + Intronic
1142044915 16:87919277-87919299 CGCTGTTCCCAGAGTAAGGATGG - Intronic
1143254850 17:5548390-5548412 CTCTATCCTCAGAGGGAGGAGGG - Intronic
1145948838 17:28799722-28799744 CTCAATCTCCTGAGTAAGCTGGG + Intronic
1148018449 17:44538708-44538730 CTCAGTCCACAGGGAAAGGAAGG + Intergenic
1149664175 17:58354281-58354303 CTCAACCCCCAGAGGAACCAAGG + Exonic
1150468750 17:65417767-65417789 CTCAGTGCCCAAACTAAGGATGG + Intergenic
1151930369 17:77228246-77228268 TGCCATCCCCAGAGCAAGGAGGG + Intergenic
1152941504 17:83175115-83175137 CTCAGCCTCCAGAGCAAGGAGGG - Intergenic
1156345899 18:36256989-36257011 CTCATTCACCAGAGAAAGGGTGG - Exonic
1159392408 18:67809845-67809867 CTCCATCCACAGGGTAAGCAGGG + Intergenic
1161308435 19:3579821-3579843 GTCAATCCACAGAGGCAGGAAGG - Intergenic
1161917264 19:7238036-7238058 TTCATTTCCCAGAGGAAGGATGG + Intronic
1163823365 19:19509066-19509088 CTCCATCCCCACAGTAAGTGAGG - Intergenic
1166750986 19:45163953-45163975 CTCAATGCCCAGGGTATAGAGGG + Exonic
929178820 2:39010586-39010608 CTCAAACCACAGAGTGAGGTTGG + Exonic
934937141 2:98473566-98473588 GCCAGTGCCCAGAGTAAGGAGGG - Intronic
941274374 2:163472195-163472217 ATCAATCCCCATGGGAAGGAGGG + Intergenic
946551594 2:220807456-220807478 TTCATTCCCCAGAGAAAGGCAGG - Intergenic
1169226999 20:3863178-3863200 CTCAGTCCCCAGAGGAAGTAAGG + Intronic
1173106503 20:40141833-40141855 CTGAATCCACAGGGTAAGGAGGG + Intergenic
1173262706 20:41451073-41451095 CCCAGTCCCCAGAGGGAGGAAGG - Exonic
1173495079 20:43513047-43513069 CTGAATCCCCAGAGGGAGGAGGG + Intronic
1174087794 20:48021445-48021467 CCCCATCCGTAGAGTAAGGAGGG + Intergenic
1174356997 20:50005351-50005373 CCCAAGTCCCAGAGGAAGGAGGG + Intergenic
1174628010 20:51931392-51931414 CTCTCGCCCCACAGTAAGGATGG - Intergenic
1175598679 20:60255543-60255565 CCCAACCCCCAGAGGAAAGAGGG + Intergenic
1178613397 21:34107873-34107895 CCCAATCCCCAGACTGAGGCAGG - Intronic
1178940376 21:36900504-36900526 CTCAAAGGCCACAGTAAGGACGG + Intronic
1178976586 21:37226240-37226262 CTCCTTCCCCAGTGTGAGGAGGG + Intronic
1180463551 22:15589950-15589972 CTTAATCACCAGAGAAAAGAGGG - Intergenic
1180487655 22:15817222-15817244 CTGCATCCCCAGAGTAAGATGGG + Intergenic
1180705417 22:17807026-17807048 CTCAACCTCATGAGTAAGGAGGG + Intronic
1181689936 22:24553608-24553630 CCCAAGCCACAGAGTAAGGAGGG - Intronic
1181752946 22:25002428-25002450 CTTCCTCCCCAGAGGAAGGAGGG + Intronic
1185369520 22:50454611-50454633 CTGAACCCCCAGAGGAAGAACGG - Exonic
953798178 3:46001463-46001485 CTCAAGCCCCAGAGGAACCAAGG + Intergenic
954043714 3:47910846-47910868 GTCAATAACCAGAGCAAGGAAGG - Intronic
956308355 3:67851623-67851645 CTAAATACCCAGAGTAAGTCAGG - Intergenic
964525118 3:157609386-157609408 CTCACACCCCTGGGTAAGGATGG - Intronic
966549963 3:181193951-181193973 CTCAATCTCCTGAGAAAGCAAGG - Intergenic
967673739 3:192271004-192271026 CTCATTCCCTGCAGTAAGGATGG + Intronic
968885836 4:3331746-3331768 CTCCATCCCCAGCGAAAGGAAGG + Intronic
970447338 4:16135297-16135319 CTCTATCCCCCAAGTAAGAAGGG - Intergenic
970449052 4:16149008-16149030 CTTAATCCTCACAGCAAGGAGGG - Intergenic
973864829 4:55101975-55101997 CACTATCCGCAGAGTGAGGAAGG - Exonic
975735093 4:77373068-77373090 CTCAATCCCCAGAGTAAGGAGGG + Intronic
977864566 4:102009086-102009108 CTCAATCCCCAAAGAAGAGATGG - Intronic
978411845 4:108434483-108434505 TTCAAGCCTCAGAGGAAGGATGG + Intergenic
982265631 4:153536091-153536113 CTCCATCCCCAGACAAAGCACGG - Intronic
983647133 4:170003420-170003442 CTCAATACACAGATGAAGGAGGG + Intronic
994344540 5:98669012-98669034 CTCCATCCACTGAGGAAGGATGG - Intergenic
998529092 5:142868664-142868686 CTGCATCCCCAGTGTAACGAAGG - Intronic
1003304927 6:4917798-4917820 GTAATTACCCAGAGTAAGGAGGG - Intronic
1004600397 6:17144637-17144659 CCCCATCCCTAGAGGAAGGAGGG - Intergenic
1004610329 6:17233544-17233566 CTCAAAGCCCAGAGTCAGAATGG - Intergenic
1005335622 6:24793297-24793319 CTCACTCCCCAGAAGAAGAAGGG - Intergenic
1009655488 6:66539716-66539738 CTAAAAGCCCAGAGTAAGCAGGG - Intergenic
1013490814 6:110644750-110644772 CTAAAACACCAGAGGAAGGAGGG - Intronic
1013491208 6:110647342-110647364 CTAAAACACCAGAGGAAGGAGGG - Intronic
1013842188 6:114409994-114410016 CTCTATGGCCAGAGAAAGGAAGG - Intergenic
1014677929 6:124390814-124390836 TTCAGTCTACAGAGTAAGGAAGG + Intronic
1015803882 6:137089501-137089523 CTCACTCCCAAGAGGAAGAAAGG + Intergenic
1018489032 6:164272768-164272790 CTCAAGGCCCAGAGGAAGCAAGG - Intergenic
1019493997 7:1328450-1328472 CTCAGACCCCAGATTAAAGAAGG - Intergenic
1020524270 7:9238484-9238506 CTCAACCCCCAGAGTAGGTGGGG - Intergenic
1021577340 7:22116400-22116422 CCCCATCCCCAGGATAAGGATGG + Intergenic
1024474906 7:49799489-49799511 CTCAATTCCCAGAGGAAGTGAGG - Intronic
1024565094 7:50674069-50674091 CTCACTACCCAGAGTAGGGACGG - Intronic
1026576094 7:71572864-71572886 CCCAATCCCTAAAGCAAGGAGGG + Intronic
1027986748 7:85301973-85301995 CTCAATCCCCAGAGACAGCTGGG - Intergenic
1028832798 7:95345037-95345059 CTCAAGCCCCAGAGAAACCAAGG + Intergenic
1031351001 7:120730994-120731016 CCAAAGCCCCAGAGTAAGCATGG + Intronic
1033600921 7:142887994-142888016 CTCTCTCCCCAGCGTAACGAAGG - Intergenic
1035108575 7:156462076-156462098 CTCTCCCCCCAGAGTAAGCATGG - Intergenic
1039500028 8:38009348-38009370 CTCACTTCCAAGGGTAAGGAAGG + Intergenic
1045391425 8:101718782-101718804 CTGAATTCCAAGAGGAAGGAGGG - Intronic
1051349903 9:16189259-16189281 CTCAACCCCCAGAGCAAGCTTGG - Intergenic
1051612567 9:18975489-18975511 CTCATTGCCTAGAGTAGGGAGGG - Intronic
1056681982 9:88727369-88727391 CTGAATTCCAAGAGGAAGGAGGG + Intergenic
1061702796 9:132428734-132428756 CTCAAAACCCAGACTATGGATGG - Intronic
1062353503 9:136151098-136151120 GGCAGTCCCCAGAGTCAGGATGG - Intergenic
1190522556 X:51295150-51295172 CTCAATCCCAATATAAAGGAAGG + Intergenic
1190831956 X:54066496-54066518 CTTAATTGCCAGAATAAGGAAGG + Intergenic
1192583120 X:72301093-72301115 CTCAAACCCCAGTTTAATGATGG + Intronic
1193601552 X:83512625-83512647 CTCATTCCCCTGAGGAGGGATGG + Intergenic
1193909762 X:87289251-87289273 TTCAATCACCACAGTGAGGATGG + Intergenic
1197342833 X:125293790-125293812 CTTAATCCCCAAAGTAACAATGG - Intergenic
1199826752 X:151508053-151508075 ACCAACCCCCAGAGTAAAGAAGG + Intergenic