ID: 975736733

View in Genome Browser
Species Human (GRCh38)
Location 4:77388689-77388711
Sequence CTGAGGGTAAAGATTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 284}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975736733_975736738 17 Left 975736733 4:77388689-77388711 CCATCCTCAATCTTTACCCTCAG 0: 1
1: 0
2: 0
3: 36
4: 284
Right 975736738 4:77388729-77388751 AACCTATCCAAGGATTCTGATGG 0: 1
1: 0
2: 0
3: 8
4: 122
975736733_975736737 7 Left 975736733 4:77388689-77388711 CCATCCTCAATCTTTACCCTCAG 0: 1
1: 0
2: 0
3: 36
4: 284
Right 975736737 4:77388719-77388741 CTACATTGAAAACCTATCCAAGG 0: 1
1: 0
2: 2
3: 29
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975736733 Original CRISPR CTGAGGGTAAAGATTGAGGA TGG (reversed) Intronic
901892887 1:12283217-12283239 CTGAGGGGCAAGACTGAGAAAGG - Exonic
902786076 1:18733577-18733599 CAGAGGGAAAAGGTGGAGGAGGG + Intronic
904010708 1:27388620-27388642 CTGAGGCTAAAGTTTGACTAGGG - Intergenic
904273627 1:29366471-29366493 CAGAGGCTGAAGAATGAGGAGGG + Intergenic
904590295 1:31610756-31610778 CTGTGACTAAAGATAGAGGAAGG - Intergenic
905150973 1:35927399-35927421 GTGAGGATAAACATGGAGGATGG - Exonic
906840514 1:49133715-49133737 CTGAGGATAAATATTTAGCAGGG - Intronic
907648488 1:56268744-56268766 CTGAGGTTAAATAATGAGAAGGG + Intergenic
908028775 1:59977865-59977887 CTGAGGCTAAAGAAGGGGGAAGG - Intergenic
908871891 1:68622622-68622644 CTGAGTTTGAAGATAGAGGAAGG - Intergenic
909407761 1:75311791-75311813 ATGAGGGAAAATATTAAGGATGG + Intronic
913130518 1:115834425-115834447 CTCAGGGTAAAGGATGAGGCTGG + Intergenic
913168110 1:116208214-116208236 CTGAGGAGGAAGATTCAGGAGGG - Intergenic
913498479 1:119449500-119449522 CTGAGGGCAAAGAAGGAAGAAGG - Intergenic
915164075 1:153938999-153939021 CTGAGAGTAAAGTTTGTGGCTGG + Exonic
915263429 1:154696538-154696560 CTCTGGGTGAAGATTGAGGGAGG - Intergenic
915719729 1:157975914-157975936 CTGTGGGTATACATTCAGGAAGG - Intergenic
915895343 1:159807576-159807598 CTGAGGGTAGAGATGGAGGCTGG + Intronic
916090044 1:161300849-161300871 TTGAGGGGAAAGAAAGAGGAGGG - Intergenic
916944039 1:169706429-169706451 GTGAGGGTAAAGTATTAGGAAGG + Intronic
917135718 1:171786441-171786463 CTGAGGGTATAAATGGAAGAGGG + Intronic
918284550 1:183039247-183039269 CTAAGGATAAAGATTGTGGTGGG + Intronic
922088204 1:222370806-222370828 CAGAAATTAAAGATTGAGGAGGG + Intergenic
922319427 1:224472630-224472652 CTGGGGAAAAGGATTGAGGATGG + Intronic
922424523 1:225480835-225480857 CTGAGAGAAAAGAGTGAGGAGGG - Intergenic
922595299 1:226808689-226808711 CTCAGGGTAAAGTTTTAGGATGG + Intergenic
924680361 1:246224854-246224876 CTGGGGGTAATTATTGAGGTGGG + Intronic
1063631902 10:7741867-7741889 CTGAGTGTACAGAATGAGGAAGG - Intronic
1067794837 10:49313388-49313410 ATGAGGGGAAAGATGGAGCAAGG + Intronic
1068227997 10:54131973-54131995 CTGATGGTAAAGATTGATGCTGG + Intronic
1068937397 10:62649248-62649270 GTGAGGGCAAAGATTGAGCTGGG - Intronic
1069274115 10:66567770-66567792 AGGAGGGTAAAGATTGAACATGG - Intronic
1069515640 10:69074659-69074681 CTGAGGCTGGAGACTGAGGATGG + Intergenic
1071465911 10:85939528-85939550 CTGATTGTGAAGATGGAGGAAGG - Intronic
1071782070 10:88856887-88856909 CTGAGGGAACAGAGTGAGGTTGG - Intergenic
1073472118 10:103729259-103729281 CTGTGGGTAAAGCTAGAGGCAGG - Intronic
1074678700 10:115881537-115881559 CTGAATGTAAAGGTTGAGGGAGG - Intronic
1074710313 10:116172052-116172074 CTGAGGGTAAACACCGTGGAAGG - Intronic
1074781357 10:116804521-116804543 CTGGGGGTAAAGGGAGAGGAAGG - Intergenic
1075333844 10:121595294-121595316 CTGAGGACAAAAATGGAGGAGGG + Intronic
1076022968 10:127089470-127089492 CTGAGAGTGGAGATTGAGGCTGG - Intronic
1076352432 10:129826186-129826208 CTGAGGACAAAGACTCAGGAGGG + Intergenic
1079346497 11:19657105-19657127 CTGAGGGGAGAGTTTGAGGCTGG + Intronic
1081229342 11:40565155-40565177 CTGAGAGGAAACATTGAAGAAGG - Intronic
1083671848 11:64304355-64304377 CTGAGTGTTAAGGTGGAGGATGG - Intronic
1083824078 11:65188457-65188479 CTCCGGGTCAAGATGGAGGACGG + Exonic
1084477683 11:69398307-69398329 CTGAGGCGAAATCTTGAGGAGGG - Intergenic
1086302177 11:85438843-85438865 CAGAGGGTAGAGATAGAGGTGGG - Intronic
1086344911 11:85886497-85886519 CTAAGGGTAAAGGTGGAGGGAGG + Intronic
1086918339 11:92557140-92557162 CAGAAGGTGAAGATGGAGGAGGG - Intronic
1087126495 11:94631951-94631973 CTGAGGGTAAAAACTCAGAAGGG + Intergenic
1087399512 11:97647276-97647298 ATGAGTGCAAAGCTTGAGGATGG + Intergenic
1088805208 11:113346109-113346131 CTGAGGATAAACATTGTGGGAGG - Intronic
1088901052 11:114117533-114117555 TTGGGGGTGAAGTTTGAGGAAGG + Intronic
1089391186 11:118103045-118103067 CTGAGGGTCAGGCTTGAGCAGGG - Intronic
1089890052 11:121871749-121871771 CTGAAGGGAAAGAATGAGCAAGG + Intergenic
1090235240 11:125142094-125142116 CTGAACATAAAGCTTGAGGAAGG + Intergenic
1091713596 12:2760360-2760382 CTGAGGATAAAGATGGAGGGAGG + Intergenic
1091991019 12:4955898-4955920 CTTAGGGTGAAGACTGGGGATGG - Intergenic
1092495964 12:8995476-8995498 ATAAGGGTAAAGAGTGGGGAGGG - Intronic
1092880959 12:12887614-12887636 CAGAGGATAAAGATCGAGTATGG + Intergenic
1094505191 12:31055538-31055560 CTGAGGATAAAGATGGAGAGAGG - Intergenic
1094607102 12:31958514-31958536 TTGAGTGCAAAGTTTGAGGATGG + Intergenic
1094640647 12:32271729-32271751 CTGAGCACAAAGTTTGAGGAGGG - Intronic
1097143924 12:56926509-56926531 CTGTGGGTGATGATTGAGGAGGG - Intronic
1098388854 12:69947943-69947965 TGGAGAGTAAAGATTTAGGATGG - Intronic
1100765947 12:97865820-97865842 CTGGGGGGATAGATTGAGGAGGG - Intergenic
1102653744 12:114462657-114462679 CTGAGGTTACAGAATGAGAACGG - Intergenic
1104202721 12:126607389-126607411 CTGGGGGTGAGGGTTGAGGATGG - Intergenic
1104400670 12:128473431-128473453 GTGAGGATAAAGATAGAGGCTGG - Intronic
1104715429 12:131013082-131013104 CTGAAGGGCAAGATTGAAGAAGG - Intronic
1107238992 13:38209856-38209878 CTGAGTATAAAGGTAGAGGAGGG + Intergenic
1107630020 13:42333728-42333750 ATGAGGGAAGAGATGGAGGAGGG + Intergenic
1108554640 13:51581256-51581278 TGGAGGGCAAAGTTTGAGGAGGG - Intergenic
1110523286 13:76505878-76505900 TTGAGGCTAAAGGATGAGGACGG - Intergenic
1111931601 13:94518305-94518327 CTGAGGGTAAGCAGTGTGGAGGG - Intergenic
1114846435 14:26328596-26328618 CTAAGGGAAAAGACTGAGGGAGG + Intergenic
1115667165 14:35563450-35563472 ATGAGGGTAAAGATGGGGGATGG + Intronic
1116278172 14:42864362-42864384 CTGAGGATAAAATTTGAGGATGG - Intergenic
1116604082 14:46967604-46967626 CAGTGGGTAAGGATTGATGAAGG - Intronic
1116831685 14:49726487-49726509 TTGTGGGTAAAGAATGACGATGG - Intronic
1118133545 14:62995714-62995736 CTGAGAGTAAAGATGGTGAAGGG - Intronic
1118431350 14:65721836-65721858 CCAAGGGTAAATATGGAGGACGG - Exonic
1119829381 14:77687549-77687571 GTGAGGGGAGAGAGTGAGGAAGG - Intronic
1120653661 14:87164013-87164035 CTGAGGGTGCTGATAGAGGAGGG + Intergenic
1120655859 14:87189155-87189177 CTGTAGGTCAAGGTTGAGGATGG - Intergenic
1121506292 14:94479985-94480007 CTGAGGGTAGAGATAGGGAAGGG + Intergenic
1121553616 14:94820303-94820325 CTGGGGGTGGAGAGTGAGGAGGG - Intergenic
1121753354 14:96378390-96378412 ATTATGTTAAAGATTGAGGAAGG + Intronic
1122411364 14:101527717-101527739 CTGAGGGTAGAGAGTGAGTTGGG - Intergenic
1122508379 14:102246840-102246862 CTGAGGGGAATGCTTGAGGGTGG - Intronic
1126321684 15:47430791-47430813 GGGATGGTAAAGAGTGAGGAGGG - Intronic
1126417401 15:48432092-48432114 CAGAAAGTAAAGACTGAGGAAGG - Intronic
1127232693 15:57014352-57014374 CTGATGGTAGGGAATGAGGAAGG - Intronic
1127764017 15:62166984-62167006 CTGAGTGAATAGATGGAGGAAGG - Intergenic
1128068548 15:64779231-64779253 CTGGGGGTGGAGAGTGAGGATGG - Intergenic
1128127715 15:65205225-65205247 GTGAGGCTGAAGAATGAGGAGGG - Intronic
1128810665 15:70569587-70569609 CTGGGGTTAAAGGTGGAGGAAGG + Intergenic
1130751708 15:86719543-86719565 CTGAGAGAAAAGCTTCAGGATGG - Intronic
1133747620 16:8699216-8699238 CAGAGGGAAGAGATTGGGGAGGG + Intronic
1135206707 16:20491309-20491331 CTGTGGGTAAAGAATATGGAAGG + Intergenic
1135212178 16:20532323-20532345 CTGTGGGTAAAGAATATGGAAGG - Intergenic
1136104775 16:28022163-28022185 CTCAGGGTAAAGATGGGGGTAGG + Intronic
1136456326 16:30381829-30381851 CGGGGCGTAGAGATTGAGGAAGG - Exonic
1137464213 16:48693370-48693392 TTGAGGGGCAAGATTGATGAAGG + Intergenic
1138522577 16:57579342-57579364 CTGAGAAGAAAAATTGAGGAGGG + Intronic
1139472384 16:67185108-67185130 TTGGGGGAAAAGATTGGGGAAGG - Intronic
1140305919 16:73802550-73802572 CTCAGGGAAAAGAATGAGAAAGG + Intergenic
1140619299 16:76708506-76708528 CTGACGTTGAAGATGGAGGAAGG + Intergenic
1140650614 16:77084061-77084083 CTGAGGGCAAGGCTTGAAGAGGG + Intergenic
1140816428 16:78625243-78625265 CTGAGGCTAAAGAGTGGGGCTGG - Intronic
1141493786 16:84392982-84393004 CTCAGGGTAAATCGTGAGGAAGG - Intronic
1143858301 17:9869212-9869234 GTGAGGGTAAGGCTGGAGGAGGG - Intronic
1144723986 17:17492198-17492220 CTGAGGGTGATGAACGAGGAAGG - Exonic
1145052124 17:19670862-19670884 GGGAGGGTAAAGAATGAGGGAGG - Intronic
1145231162 17:21174376-21174398 CTGTGGCTAAAGCTGGAGGAAGG - Intronic
1147459005 17:40556780-40556802 CTGGGGGTCAAGGTTGAGGAGGG + Intronic
1148410801 17:47465400-47465422 CTGAGATTAAAAATTGAGGTGGG - Intergenic
1148775079 17:50090599-50090621 TTGAGGGTAAAGATTGATGGAGG + Intergenic
1149514717 17:57271851-57271873 AGGAGGGGAAAGAGTGAGGAGGG + Intronic
1149594813 17:57858551-57858573 CTGAGGGTAGATGTTGAGTAAGG + Intergenic
1149612467 17:57967635-57967657 CTGAGGGAGAAGAATGGGGAGGG - Intergenic
1150953085 17:69824107-69824129 ATGAGAGTAAAGATGTAGGAAGG - Intergenic
1151868146 17:76818633-76818655 CTGATGGCAAACACTGAGGATGG - Intergenic
1152469606 17:80483354-80483376 CTGAGGGTGCAGAGGGAGGACGG + Intergenic
1154276966 18:12970151-12970173 CTGAGGCTAAAGGTTAAGCAAGG + Intronic
1155394539 18:25373050-25373072 CAGAAGGGAAAGATTGAGAAAGG - Intergenic
1155551781 18:26972705-26972727 GGGAGGGTAAAGATGGAGGCAGG + Intronic
1156245655 18:35295377-35295399 CTGGGGGAAAAGTATGAGGATGG - Intergenic
1156339312 18:36196998-36197020 CTGGGGGTTAAGTTTGAGGGAGG + Intronic
1160055922 18:75480471-75480493 CTGGGGTTGAAGATTGAGGGGGG - Intergenic
1161033877 19:2073198-2073220 CTGAGGCTCGAGACTGAGGAAGG + Exonic
1161351449 19:3794348-3794370 GAGAGGGTAAAGTCTGAGGAAGG + Intronic
1161465731 19:4429255-4429277 CTGAAGGGACAGATGGAGGAGGG - Intronic
1161644373 19:5444153-5444175 ATGAGGGTGAAGTTTGAGGGAGG - Intergenic
1163297408 19:16421248-16421270 CTGTGGGTGAAGACTGTGGAGGG - Intronic
1164500712 19:28817657-28817679 CTGAAGGTAGACATAGAGGAGGG - Intergenic
1164628867 19:29747830-29747852 CTGAGGGCAGAGATTGAGCATGG + Intergenic
1164928143 19:32147334-32147356 CTCAGGGGAAAGGGTGAGGATGG - Intergenic
1168340567 19:55620988-55621010 CTGAGTCTAAAGCTTTAGGAGGG + Exonic
925082165 2:1078843-1078865 CTGAGGGTCAGGAGGGAGGAAGG + Intronic
927679896 2:25132355-25132377 CTAAGAGAAAAGAATGAGGAAGG + Intronic
928401018 2:30978884-30978906 CTCAGGGTAAGCATAGAGGATGG + Intronic
929286946 2:40146222-40146244 CTGAGCTTAAAGCTTTAGGAGGG + Intronic
929401859 2:41592180-41592202 CTCAGAATAAAGATTGGGGAGGG + Intergenic
930593051 2:53353196-53353218 CTGAGGATTAAGATGGTGGATGG + Intergenic
931574977 2:63709347-63709369 CTGAGGGTAAGAATGGAGGAGGG - Intronic
932977071 2:76615589-76615611 CTGAGGGTAAAAATTGAAGGAGG - Intergenic
935540312 2:104340582-104340604 CGGAGGGGAAAGAGTGAGGAAGG - Intergenic
938692792 2:133807708-133807730 CTGAGGGACAAGAATGAAGAAGG - Intergenic
938949658 2:136244680-136244702 CTGAGGGAAAAGATTCAGAGAGG - Intergenic
940855845 2:158728222-158728244 CAGAGGGTAGAGATTGATGTGGG + Intergenic
941063817 2:160878370-160878392 CTGAGCTTGAAGATGGAGGAAGG - Intergenic
941273244 2:163457150-163457172 CTGAGGGTAAAGAGAGAAGAGGG - Intergenic
943070433 2:183134991-183135013 CTGACTGTGAAGATGGAGGAAGG - Intronic
943202771 2:184850083-184850105 GTGGGGGTAAAAAGTGAGGATGG + Intronic
943369993 2:187003670-187003692 CTGTGTGTAAAGACTGTGGAAGG - Intergenic
948785552 2:240350609-240350631 CTGACGTTGAAGATGGAGGAGGG + Intergenic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1170932740 20:20783441-20783463 CAGAGGCTAAAAACTGAGGATGG - Intergenic
1173223324 20:41146695-41146717 CTGAGGGAAATGATTGTTGAGGG + Intronic
1175019929 20:55835075-55835097 CTGATTTTGAAGATTGAGGAGGG - Intergenic
1175921512 20:62452530-62452552 CTGAGGAGAAGGACTGAGGAGGG - Intergenic
1177101362 21:16900724-16900746 GTGAGGGGAAAGAATGAGGTAGG - Intergenic
1179081882 21:38178977-38178999 CTGAAAGGAAAGATGGAGGATGG - Intronic
1180133833 21:45847385-45847407 GTGAGGGTAAGGATGGAGGTGGG - Intronic
1182127884 22:27829393-27829415 CTGAGGGAACAGCATGAGGAAGG + Intergenic
1182414078 22:30209883-30209905 CTGATGGAAAAGACTGAGGATGG + Intergenic
1183085279 22:35483339-35483361 GTGAGGGTAGTGATTGATGAGGG - Intergenic
1184783193 22:46659246-46659268 CTGAGGGTGGAGACTGAGGGGGG - Intronic
952462571 3:33544024-33544046 CTTAAGGTAAAGTCTGAGGAGGG - Intronic
952503910 3:33989896-33989918 CAGAGGGAAAAGAGTGGGGACGG - Intergenic
952598212 3:35044524-35044546 CAGAGGGCAAAGGTTGAGGCTGG - Intergenic
953135698 3:40179948-40179970 GAGAGGATAGAGATTGAGGATGG - Intronic
954034089 3:47841173-47841195 CTCAAGGTACAGATGGAGGATGG + Exonic
954562404 3:51568933-51568955 TTGAGTGCAAAGCTTGAGGATGG + Intronic
955624419 3:60902159-60902181 ATTAGGGTAAAGATTGACTATGG - Intronic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
957075314 3:75598052-75598074 TTAAGGGCCAAGATTGAGGAAGG + Intergenic
958707846 3:97678335-97678357 TTTAGGGAAAAGATTGATGATGG + Intronic
959080631 3:101797166-101797188 CTCAGAGTAAAGAATGGGGAGGG - Intronic
959246428 3:103875418-103875440 GTGTGGGTAAAGACTGAGGTGGG + Intergenic
959585762 3:108023691-108023713 CTGAGTATCCAGATTGAGGAGGG - Intergenic
959869502 3:111310388-111310410 ATGAGGGAAAAGAGTGAGTATGG + Intronic
960265041 3:115611611-115611633 CTGAGGGGAAATATTGCAGAGGG - Intergenic
960296685 3:115953526-115953548 ATGAGGGAAAAGTTTGGGGAAGG - Intronic
960406196 3:117262773-117262795 CTGAAGGGAAAGATTCATGATGG + Intergenic
962716506 3:138130775-138130797 CTGAGGGTAAGGACTCAGGTCGG - Intronic
962994534 3:140612305-140612327 CTAAGGGACAAGCTTGAGGAGGG - Intergenic
963382119 3:144543697-144543719 CTTTGGGTAAAGGCTGAGGAGGG - Intergenic
963526371 3:146419734-146419756 CTGATTGTGAAGATGGAGGAAGG - Intronic
963688165 3:148464052-148464074 CTGGGTGTAAATATTGGGGACGG + Intergenic
964136367 3:153349237-153349259 CTGAGGGTAAAGAGGCAGAAAGG - Intergenic
964719054 3:159753757-159753779 CTGATGGTGGAGAGTGAGGAGGG - Intronic
966479641 3:180392276-180392298 CTGAGTGTAAGGTTTGAGGCAGG - Intergenic
967217023 3:187219494-187219516 ATGAGGGTGAAGATTGATGTTGG + Intronic
969170847 4:5361824-5361846 AGGAGGGTAAAGATTTAGGTCGG + Intronic
970123806 4:12787147-12787169 CAGAGGGTAAGGAGGGAGGATGG - Intergenic
971029550 4:22621547-22621569 GGGAGGGTAAAGATGGAGGCAGG + Intergenic
971118198 4:23673055-23673077 CTGATGTTGAAGATGGAGGAAGG + Intergenic
973321074 4:48810823-48810845 CAGTGGGTAGTGATTGAGGATGG + Intronic
974339436 4:60596016-60596038 CTGAAGGAAAAGATTGGGGAAGG - Intergenic
974881083 4:67757875-67757897 CTGAAGGGAAAGAGTGATGATGG + Intergenic
974925180 4:68289387-68289409 CTGAGGGTAAAGACAGAAGATGG + Intergenic
975734827 4:77371056-77371078 CTGAGGGAAAAGATGGAGTGTGG - Intronic
975736733 4:77388689-77388711 CTGAGGGTAAAGATTGAGGATGG - Intronic
976132224 4:81896768-81896790 TTGAGGGTAAAGGGTGAGAAGGG - Intronic
976680307 4:87747848-87747870 CTGAGAGTGAAGATCAAGGAGGG + Intergenic
978655557 4:111061676-111061698 CTGGGGACAAAGAATGAGGATGG + Intergenic
978672815 4:111271388-111271410 CTGATGGTAGAGATTGCGGGAGG + Intergenic
979032977 4:115675939-115675961 CAAAGGCTAAAGATTGAAGAAGG + Intergenic
981622089 4:146712810-146712832 TTCAGGGTAAAGAGAGAGGATGG + Intronic
982301674 4:153885090-153885112 CAGAGGTTGAATATTGAGGAAGG - Intergenic
985162583 4:187060113-187060135 CTGAGGCTACAGACTGAGGGAGG - Intergenic
985901291 5:2796729-2796751 CTGTGGGTCAGGATTTAGGATGG + Intergenic
986149224 5:5111635-5111657 CTAAGGCAAATGATTGAGGATGG + Intergenic
987204732 5:15613479-15613501 CTGAGGGTAGAGGCTGTGGAAGG + Intronic
987636040 5:20543711-20543733 CAGAGAGTAAAGTTTGTGGAAGG - Intronic
987641437 5:20616899-20616921 CTGAGGCAAAATATTGAGAATGG + Intergenic
988271996 5:29028969-29028991 CTGAAGGTAGAGAATGGGGAGGG + Intergenic
989062377 5:37422080-37422102 CTGAGGGTAAAGGATAAGGATGG + Intronic
991113465 5:62927603-62927625 CTGAGTCTAAAGCTTGAGGATGG + Intergenic
991509765 5:67363825-67363847 CTTGGGGGAAAGAGTGAGGAAGG + Intergenic
992234039 5:74690351-74690373 CTAAGTGTAAAGATAGAGGCTGG + Intronic
992718720 5:79537421-79537443 CAGAGGGTAAAGGTTGAGGGGGG - Intergenic
997671116 5:135672871-135672893 ATAAGGGTAAAGATGGAGGGAGG - Intergenic
998357446 5:141552456-141552478 CTGGCTTTAAAGATTGAGGAAGG + Intronic
999531751 5:152470671-152470693 CTTTGGTTAAAGATGGAGGAAGG + Intergenic
1000242489 5:159421531-159421553 CTGAGGATAAATAATGAGCAAGG + Intergenic
1000847631 5:166301184-166301206 CTGATGGGATAGATTGAGAAAGG - Intergenic
1002625599 5:180526304-180526326 CTGAAGGTAAAGATCCAGGAGGG + Intronic
1003550529 6:7098684-7098706 CTGAGGGTAAGGAGAGAAGAAGG - Intergenic
1003552651 6:7112735-7112757 CGGAGGTAAAAGAATGAGGAAGG + Intronic
1004915000 6:20323210-20323232 CTTAGGGAAAACACTGAGGAAGG + Intergenic
1005839052 6:29728506-29728528 GAGAGGGTAAAGATTGAGGGAGG + Intronic
1006061260 6:31421657-31421679 CAGAGGGTAGAGATTGAGGGAGG - Intergenic
1006318272 6:33303990-33304012 CTGTGGGGAAAGATTGAGAAGGG + Intronic
1006335123 6:33416362-33416384 CTGGGGGCAGAGACTGAGGAGGG + Exonic
1007471022 6:42090499-42090521 CTGAGGGAAAAAATTAAGCAGGG + Intergenic
1007567399 6:42863002-42863024 TTGAGGGTACAGATGGAGGCAGG - Intronic
1011547105 6:88493583-88493605 CTCAGGGAAAACATTGGGGAGGG - Intergenic
1012924874 6:105257357-105257379 ATGATGGTAAAAATTTAGGAGGG - Intergenic
1013244644 6:108274940-108274962 CTGAGCCCAAAGCTTGAGGATGG - Intergenic
1013853940 6:114548942-114548964 CTGAGGGTGAAGGTTGAGAGAGG + Intergenic
1013998667 6:116340008-116340030 CTGAGAAAAAGGATTGAGGAAGG + Intronic
1014622825 6:123690720-123690742 CTGGGGGTAAAAGGTGAGGAAGG + Intergenic
1017723399 6:157259953-157259975 CTCACTGTAAACATTGAGGAAGG + Intergenic
1019272207 7:156638-156660 CAGAGGGTACAGATGGAGCAGGG - Intergenic
1021769275 7:23982685-23982707 CTGAATCTAAAGATTGAGAAAGG + Intergenic
1022797509 7:33743976-33743998 ATGAAGGGAAAGATTGAGGAAGG - Intergenic
1023332105 7:39129450-39129472 CTGAGGGCAAAGCTTTGGGAGGG - Intronic
1024812722 7:53232894-53232916 CTGAGTGTAAATAGTGAGCAGGG - Intergenic
1026671249 7:72392461-72392483 CTGATGGGAGAGACTGAGGAAGG + Intronic
1028237272 7:88377761-88377783 CTAAGGGAAAAGATTGAATATGG + Intergenic
1028466204 7:91155027-91155049 TTCAGGGTAAAGAACGAGGAAGG + Intronic
1028490873 7:91410234-91410256 GTGGGGGTAACGATTGAGGATGG - Intergenic
1029379538 7:100203998-100204020 CTGAGGGGAAAGAGTGGGGAAGG - Intronic
1032715236 7:134503520-134503542 CTGAGGGTGAAGAGGGAGGCAGG + Intergenic
1032913577 7:136461806-136461828 GTGAGGGTAGAGATTAAGAAGGG - Intergenic
1033669623 7:143478585-143478607 CAGAGCATAAAGAATGAGGAAGG - Exonic
1034128628 7:148696769-148696791 TGGGGGGTAAAGATGGAGGAAGG + Intergenic
1035675012 8:1450184-1450206 CTGAGGGTGAAGACCGAGGTGGG + Intergenic
1037055271 8:14432521-14432543 CTCAGGGTAAAGGGTGAGAAGGG + Intronic
1037217068 8:16467998-16468020 CAGAGGGTAAATATTGAGTCAGG - Intronic
1037580688 8:20244508-20244530 CTGAGGGTAAGGACTGTGGCAGG + Intergenic
1037779218 8:21856223-21856245 CTGAGGCAAAAGGTTGGGGAGGG - Intergenic
1038435403 8:27532197-27532219 CTGAGGGGAGAGGGTGAGGAGGG - Intronic
1039265836 8:35823011-35823033 CTGAGTGGACAGACTGAGGAGGG - Intergenic
1039360389 8:36870423-36870445 CTGAGAGTAAAAAGGGAGGAAGG - Intronic
1039379330 8:37070204-37070226 AGGAGGGAAAGGATTGAGGAAGG + Intergenic
1042924591 8:73954169-73954191 CTGAGGGTAGAGAATGGGAAGGG + Intronic
1043086158 8:75835988-75836010 CAGAGGGTAAAGAGAGAGCATGG + Intergenic
1045566818 8:103325669-103325691 CTGAAGCTAAAGCTTGAGGAAGG - Intronic
1046124298 8:109884885-109884907 CTGGTGTTAAAGATGGAGGAAGG - Intergenic
1046503081 8:115103844-115103866 CTGAAAGTAAATATTGAGGAAGG - Intergenic
1047197839 8:122737680-122737702 TGGAGGGAAATGATTGAGGAGGG + Intergenic
1048257838 8:132918709-132918731 CTGAGGTTCAAGGTTAAGGACGG - Intronic
1048715062 8:137259306-137259328 ATGAGGCTATAAATTGAGGATGG + Intergenic
1048732973 8:137464270-137464292 CTGAGAGTAAAGATGGTAGAAGG + Intergenic
1048971817 8:139649388-139649410 CTGAGGGTGTAGAATGAGGAAGG + Intronic
1049181680 8:141226189-141226211 CAGAGGGGAAAGATGGAGAAAGG - Intronic
1049641954 8:143719844-143719866 CTGAGGGAAGAGGTGGAGGAAGG + Intronic
1049910535 9:262671-262693 CGGAGGGTAAAAATTAAGAAGGG + Intronic
1051034936 9:12733196-12733218 CTTAGGGAAAAGATTGTGCAAGG - Intergenic
1051422883 9:16905919-16905941 GTGAGGGTAAAGAATTAGGCCGG - Intergenic
1051798889 9:20908628-20908650 CTGAAGATAAAAATTGAGTAAGG - Intronic
1053417054 9:37953475-37953497 CTGATGGTAATGATGGAGGAAGG + Intronic
1053594810 9:39548973-39548995 CTGACTGTGAAGATGGAGGAAGG + Intergenic
1053852595 9:42304006-42304028 CTGACTGTGAAGATGGAGGAAGG + Intergenic
1054571443 9:66815994-66816016 CTGACTGTGAAGATGGAGGAAGG - Intergenic
1055161821 9:73139077-73139099 CTGAGGGTACAGAATGGGAAGGG + Intergenic
1055453997 9:76456329-76456351 CTGAAGGTAAATATTGAGGCTGG - Intronic
1057826350 9:98375179-98375201 GTGAGGGGAAAGACTGAGCAGGG - Intronic
1057987025 9:99727345-99727367 CTGGGGGTAAGGATGGGGGATGG + Intergenic
1058371990 9:104279890-104279912 TTAAGGGTAAAGTTTCAGGAAGG + Intergenic
1058833169 9:108837507-108837529 CTGAGGGTAGAGAGGGAGGCTGG - Intergenic
1059342056 9:113602856-113602878 CTGGGGGTAAAAAGTGGGGATGG - Intergenic
1060116416 9:120944909-120944931 CTGAGGGCAAAGGAAGAGGAAGG - Intergenic
1060566417 9:124596574-124596596 CTGAGGGTAAGGATTGGGGGTGG - Intronic
1061260618 9:129478889-129478911 CTGAGGGGATAAATTAAGGAAGG - Intergenic
1061506758 9:131036042-131036064 GTGAGGGCCAAGATTGAGGGTGG + Intronic
1185568864 X:1117237-1117259 CTGTGGGTAAACAGTCAGGAAGG + Intergenic
1186821030 X:13288176-13288198 TTGAGTGCAAAGCTTGAGGATGG - Intergenic
1187040995 X:15595598-15595620 CTGATGTTCAAGATTCAGGAGGG - Intronic
1187811059 X:23177378-23177400 CTGAGGATTAGGATTGGGGATGG + Intergenic
1188486043 X:30683554-30683576 ATGAAGGTAAAGACTGAGAAGGG + Intronic
1189027077 X:37406931-37406953 TTGAGTGCAAAGGTTGAGGACGG + Intronic
1189898617 X:45682607-45682629 CTGAGGATAGAGGTGGAGGATGG - Intergenic
1190074047 X:47302678-47302700 CGGAGGGGAAAGAGGGAGGAGGG - Intergenic
1190789045 X:53682856-53682878 CTGAGGGGGAGGAATGAGGAAGG + Intronic
1190833505 X:54080047-54080069 CTGTGGGAAAAGCTTGAGGCAGG + Intronic
1192672766 X:73163664-73163686 CTCAGGGGAAAGAGTGAGGGGGG - Intergenic
1193765055 X:85518014-85518036 CTTAGGGTAAATATTCAGGTAGG - Intergenic
1195770403 X:108345190-108345212 GGGATGGGAAAGATTGAGGAGGG - Intronic
1197397882 X:125949886-125949908 CAGAGGGTAATGATAAAGGAAGG + Intergenic
1198928695 X:141828050-141828072 CTAAGGGTAGAGAATGAAGAAGG - Intergenic
1198945076 X:142002617-142002639 TTGACTGTAAAGATTGTGGAAGG - Intergenic
1199200194 X:145078290-145078312 TTGAGGGTTAAAATTGAGAAAGG - Intergenic
1200419824 Y:2952861-2952883 CTGAGGGGAGAGAATGGGGAGGG + Intronic
1200915048 Y:8564211-8564233 GTGAGGCTAAGGATTAAGGAAGG + Intergenic
1201509591 Y:14744245-14744267 CAGAAGATAAAGAGTGAGGATGG + Intronic