ID: 975743672

View in Genome Browser
Species Human (GRCh38)
Location 4:77454799-77454821
Sequence ATCCCAGATGAATTTCAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975743670_975743672 20 Left 975743670 4:77454756-77454778 CCAAGTTATTGTTTTATATCACA No data
Right 975743672 4:77454799-77454821 ATCCCAGATGAATTTCAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975743672 Original CRISPR ATCCCAGATGAATTTCAGTT GGG Intergenic
No off target data available for this crispr