ID: 975749151

View in Genome Browser
Species Human (GRCh38)
Location 4:77505152-77505174
Sequence CCAGATATACAGATAGACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975749151_975749153 20 Left 975749151 4:77505152-77505174 CCTTTGTCTATCTGTATATCTGG No data
Right 975749153 4:77505195-77505217 TCATAGTGTAAACTTAGATTTGG No data
975749151_975749154 25 Left 975749151 4:77505152-77505174 CCTTTGTCTATCTGTATATCTGG No data
Right 975749154 4:77505200-77505222 GTGTAAACTTAGATTTGGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975749151 Original CRISPR CCAGATATACAGATAGACAA AGG (reversed) Intergenic
No off target data available for this crispr