ID: 975752411

View in Genome Browser
Species Human (GRCh38)
Location 4:77537681-77537703
Sequence CTCAAATGGATGCTGGGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 158}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975752411 Original CRISPR CTCAAATGGATGCTGGGACA TGG (reversed) Intronic
902893954 1:19465949-19465971 CTCAAATCGATCCTATGACAAGG + Intronic
904516446 1:31059356-31059378 CTCCTATAGATCCTGGGACAGGG + Exonic
905010529 1:34743920-34743942 CTCACATGGTTGCTGGCAGAAGG - Intronic
910667893 1:89743854-89743876 CTATAATGGATGCTGAGAAATGG + Intronic
913344727 1:117796930-117796952 CTCAAATGCATGCAGGGGCCAGG - Intergenic
913991229 1:143614054-143614076 CTGAAATGGATGCAGGGATCAGG + Intergenic
917018557 1:170561680-170561702 CTCAAAGTCATGCTGAGACATGG - Intergenic
918716751 1:187798376-187798398 ATCCAATGGCTGCTGTGACATGG - Intergenic
920501552 1:206488479-206488501 CTCACAAGGATGCTGTGGCAGGG + Intronic
922003324 1:221503417-221503439 ATCAGCTGGATGCTGTGACAGGG - Intergenic
922068697 1:222169816-222169838 ATCAGATGGATGCTGTCACAGGG - Intergenic
924609051 1:245558655-245558677 CTCAGAAGGTTGCGGGGACAGGG + Intronic
1062917437 10:1252029-1252051 CACAAATGGATGCAGACACAGGG + Intronic
1064715930 10:18176716-18176738 CTCACATGGAAGCTGGTACGTGG - Intronic
1066054576 10:31668500-31668522 CTCACATGGAAGAAGGGACAGGG + Intergenic
1070448042 10:76527285-76527307 CAAAAATGGAAGCTGGCACATGG - Intronic
1070554678 10:77518428-77518450 TTTAAATGGATGCTGGGGGAGGG - Intronic
1074034136 10:109720751-109720773 CTCAAATGAAAGCTGATACAAGG + Intergenic
1075664070 10:124218461-124218483 CTCAAATGTGTGTTGGGACCTGG - Intergenic
1077218351 11:1404484-1404506 CTCCTCTGGGTGCTGGGACAGGG - Intronic
1077278610 11:1730616-1730638 CTCAGATGGATGGGGGCACAAGG - Intergenic
1079697350 11:23498358-23498380 CTCAAAAGAATGCTTGGAAAGGG - Intergenic
1080636286 11:34126592-34126614 CTCAAATGAATGCTGGCATGGGG - Intronic
1081777024 11:45682617-45682639 CTCAAAAGAATCCTGGGAGACGG - Intergenic
1083021494 11:59512184-59512206 CTCAATGGGATGCTGGGGTATGG + Intergenic
1083178202 11:60966277-60966299 CTCAAATGGAGCCTGGAACAAGG - Intergenic
1088991162 11:114954713-114954735 CTCAAAAGGATGCAGCAACAAGG - Intergenic
1089317244 11:117600510-117600532 CTCAAATGGCCCCTGGGACCTGG - Intronic
1090061381 11:123466987-123467009 CTCAAATGGGTTCTGAGAAAAGG - Intergenic
1091228423 11:133972172-133972194 CCCAAAGGGATGATGGGGCAGGG - Intergenic
1091827122 12:3521139-3521161 CTCAAACTGAGGATGGGACATGG + Intronic
1093178368 12:15939251-15939273 CTCAGATGGTGGCTGGGACTGGG - Intronic
1093862284 12:24180662-24180684 CTTAAATTGATGCTTGGATAGGG - Intergenic
1094798108 12:34000199-34000221 CCCAAATGGTTCCTGGGAAAGGG + Intergenic
1095110872 12:38294287-38294309 CCCAAATGGCTCCTGGGAAAGGG + Intergenic
1096633071 12:52941807-52941829 GTCAAATGAATGCTCAGACAGGG - Intronic
1098482961 12:70987057-70987079 CTCTAAGGGAGGTTGGGACATGG - Intergenic
1098871034 12:75817286-75817308 CTGAATTGGATGCTGGTTCAGGG + Intergenic
1099617277 12:84952370-84952392 CTCAATTTGATGTTGGGATATGG + Intergenic
1101042752 12:100773177-100773199 CTCACATGGTAGATGGGACAAGG + Intronic
1102116156 12:110404468-110404490 CTCAAATGTATACAGGGACCAGG + Intergenic
1102205164 12:111085353-111085375 CTCAGATGCATGCTGGTAAATGG - Intronic
1102386321 12:112513583-112513605 CTCACATGGCAGCTGAGACAAGG - Intergenic
1102601131 12:114031470-114031492 CTCAAAGGGATGCTTCAACAAGG + Intergenic
1102782923 12:115581075-115581097 CTCAAATGGTTGCAAGGAGAAGG + Intergenic
1103022227 12:117543803-117543825 CTCAGAGGGATCCTGAGACACGG - Intronic
1104723057 12:131056921-131056943 CACAACTGGCTCCTGGGACATGG - Intronic
1104743270 12:131194259-131194281 CTGCAAGGGATGCTGGGAAATGG - Intergenic
1109183423 13:59241920-59241942 CTGAAATGCAGGCTGGGACTAGG - Intergenic
1109358367 13:61263845-61263867 CTCAAATAGATGAGGTGACAAGG - Intergenic
1111381167 13:87454703-87454725 CTCATATGGAAGAAGGGACAAGG - Intergenic
1114485579 14:23059515-23059537 CACAAATGGAGGCTGTGACCAGG - Intronic
1114539805 14:23446515-23446537 CTCACATGCATCCAGGGACAGGG - Intergenic
1115220907 14:31057553-31057575 ATCATGTGGTTGCTGGGACATGG + Intronic
1116534605 14:46014854-46014876 AGCAAAGGGAGGCTGGGACAAGG + Intergenic
1118987799 14:70771685-70771707 CTCAGATGGATGGTGGGGCTTGG - Intronic
1119318603 14:73716006-73716028 TGCAGATGGATGCTGGGAGATGG + Exonic
1122844837 14:104487325-104487347 CTGAAATGGATGCTGGCTCCTGG + Intronic
1124494604 15:30178677-30178699 CTCAAATGTTTGCTGGGGCCGGG - Intergenic
1124748966 15:32359968-32359990 CTCAAATGTTTGCTGGGGCCGGG + Intergenic
1126017979 15:44371433-44371455 CTCATATGGCTCCTGAGACATGG - Intronic
1126143511 15:45456220-45456242 GACAGATGGATGCTGGGAGAGGG - Intergenic
1127914680 15:63445674-63445696 CACAAAAGGCTGCTGGGTCATGG - Intergenic
1131051001 15:89347805-89347827 CTCACATGGATTCAGAGACAAGG + Intergenic
1133421988 16:5653818-5653840 TTAGAATGGATGCTGGGTCAGGG + Intergenic
1134265181 16:12686357-12686379 CACAAATGGATTCGTGGACATGG - Intronic
1137027710 16:35495061-35495083 ATCATCTGAATGCTGGGACAGGG + Intergenic
1139005701 16:62569488-62569510 CTCAAATGGCTTCAGGGAAATGG - Intergenic
1140574933 16:76156719-76156741 GGGACATGGATGCTGGGACATGG - Intergenic
1140574936 16:76156733-76156755 CACACATGGATGTTGGGACATGG - Intergenic
1141478754 16:84292304-84292326 CTCAAATGGAACCTGGGCCAAGG + Intergenic
1143190287 17:5035365-5035387 CTCAAATGGACCCCGGGACAAGG + Exonic
1144752982 17:17662859-17662881 CTCCAGTGGGTGCTGGGAGAAGG - Intergenic
1146509180 17:33430995-33431017 CTCACATAGATGCTGAGACCAGG - Intronic
1148785833 17:50145823-50145845 CTCAAGTGGATGTTGGAGCAGGG + Intronic
1150274025 17:63884495-63884517 CTCCAATGTCAGCTGGGACAGGG + Intergenic
1150276185 17:63899300-63899322 CTCCAATGTCAGCTGGGACAGGG + Intergenic
1150278338 17:63914029-63914051 CTCCAATGTCAGCTGGGACAGGG + Intronic
1157330585 18:46701014-46701036 CCTAAATGGAAGCTGTGACAGGG + Intronic
1158461503 18:57649825-57649847 TTCATATGGATGCTGGAAGATGG - Intronic
1158733714 18:60055481-60055503 CTCAAAAGGATGGTGGGGCCGGG + Intergenic
1159015367 18:63098125-63098147 CCCAAATGGATGCTGCGTGAAGG - Intergenic
1165133989 19:33653801-33653823 TTAAAATGGATACTGGCACATGG + Intronic
926421149 2:12700786-12700808 CTCACATGGATCCTGAGGCAGGG + Intergenic
927332759 2:21885313-21885335 CTAAAAGGGATGCTGAGACTGGG + Intergenic
930446333 2:51477772-51477794 CTGAATTGGATCCTGGGACAGGG - Intergenic
933234463 2:79850034-79850056 CTCAAATGCATGCATGCACAGGG + Intronic
934533134 2:95108618-95108640 GGCATATGGATGCTTGGACAAGG + Intronic
934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG + Intergenic
935049011 2:99508056-99508078 CTCAGATGGATTATGGGACATGG - Intergenic
937190876 2:120096886-120096908 CTGAAAAGGAGGCTGGGATATGG + Intronic
937277011 2:120691411-120691433 CTGGAATGGTTGCTAGGACAAGG - Intergenic
939801277 2:146712596-146712618 CTGAATTGGGGGCTGGGACAGGG - Intergenic
940760826 2:157737402-157737424 CCCAAATGGCTGCTTTGACAAGG - Exonic
940901528 2:159130643-159130665 CACAAAAGGATACTGGCACAAGG - Intronic
942619914 2:177835306-177835328 CTCAAATGCATCCTGAGGCAGGG + Intronic
942650692 2:178164348-178164370 CTCAAATGGTTGAAGGGGCAAGG + Intergenic
947055112 2:226091564-226091586 CCCAAATGGCTCCTGGGAAAGGG + Intergenic
947883296 2:233540979-233541001 TTCAAATGGAAGATGGCACATGG - Intronic
948201646 2:236133636-236133658 CTGCAAGGGATGCTGGGAAATGG + Intergenic
1168875190 20:1166555-1166577 CTCAGATGGAAGCTGGGCCTGGG + Exonic
1169595299 20:7191670-7191692 CTCAAATTGGTCCTGGGTCAGGG + Intergenic
1170472994 20:16686844-16686866 CTCTAATGGATGCTGCCAAATGG + Intergenic
1173202253 20:40962702-40962724 TTCATATGGAGCCTGGGACATGG + Intergenic
1179272277 21:39860768-39860790 CAGAAATGGATGCTGAGTCATGG - Intergenic
1179345179 21:40549489-40549511 GTCATATGGATGCTGAGAGAAGG - Intronic
1181200412 22:21213892-21213914 CTCGAATGGGTGCTGGGATGGGG + Intronic
1181701325 22:24623067-24623089 CTCAAATGGGTGCTGGGATGGGG - Intronic
1182558473 22:31141531-31141553 CTCAGATGGAGCCTGGGGCAGGG - Intergenic
1182998016 22:34832205-34832227 CTCAATGGGATGCTGGGACGTGG - Intergenic
1183964232 22:41431779-41431801 CACACAGGGATGCAGGGACAAGG + Intergenic
1184001869 22:41680658-41680680 CTCAAATGGATGCGGAGCCATGG - Intronic
1184240646 22:43209790-43209812 CGAGAGTGGATGCTGGGACATGG - Intronic
1184385566 22:44172447-44172469 CCCAAGTGGACGCTCGGACAAGG + Intronic
950353572 3:12382177-12382199 CTCACATTGATGCTGGAATAAGG - Intronic
951704321 3:25528399-25528421 CAAAAAAGGGTGCTGGGACAGGG + Intronic
952195721 3:31073691-31073713 ATCAAATGGAAGCTGGGAAAGGG - Intergenic
955793725 3:62613703-62613725 CTCAAAGGGATGTTGAGACCAGG + Intronic
956585081 3:70855606-70855628 CTCAAGTGGAGGCTTGGCCAGGG - Intergenic
956639200 3:71399417-71399439 CTAAAATGTATGGTGGGAGATGG - Intronic
957072026 3:75574952-75574974 ATGAATTGGAGGCTGGGACAGGG - Intergenic
959468329 3:106718011-106718033 TTCAAAGGCATGCAGGGACATGG + Intergenic
965511470 3:169572662-169572684 TTAAAAAGGATGCAGGGACATGG + Intronic
966923459 3:184629509-184629531 CTCAAGGGGCTGCTGGGACTAGG - Intronic
967185835 3:186943871-186943893 CTGAAGTGGAGGCTGAGACATGG - Intronic
967685930 3:192416250-192416272 ATCAAATGGAAGTTTGGACAAGG + Intronic
969273421 4:6118415-6118437 ATGACATGGAGGCTGGGACAAGG + Intronic
970677626 4:18469921-18469943 CTGAAAAGGGTTCTGGGACATGG - Intergenic
972524936 4:39899890-39899912 GACACATGGATGCTGGAACAGGG - Intronic
975302783 4:72810768-72810790 CTAACATGGATGCTGGCAGAGGG - Intergenic
975752411 4:77537681-77537703 CTCAAATGGATGCTGGGACATGG - Intronic
977514350 4:98001644-98001666 TTCAAATGCCTGCTAGGACAAGG + Intronic
978414386 4:108459902-108459924 CTCATTTGGCTGCTGAGACAGGG - Intergenic
984705390 4:182843993-182844015 CTCAAAGGCAGGCAGGGACATGG + Intergenic
986001094 5:3631449-3631471 CAAAAATGGGTGCTGGAACAAGG - Intergenic
986067355 5:4247695-4247717 ATCAAAAGGATGCTGGAGCAAGG - Intergenic
990559256 5:56967153-56967175 CTCAAATGGTAGAAGGGACAAGG - Intronic
992381346 5:76240735-76240757 CCCAAATGGAGCCTGAGACAGGG - Intronic
992883466 5:81133435-81133457 TTCAAATGGCTGCTGATACAGGG + Intronic
994211576 5:97092713-97092735 CTTAATTAGATGCAGGGACAGGG - Exonic
994213669 5:97113162-97113184 CTCAGATGGCTGCTGGCAGAAGG - Intronic
997783338 5:136682503-136682525 CTGAAATGGATGATGGGATGTGG - Intergenic
1001117276 5:168950201-168950223 CTCACATGGAGGAAGGGACAAGG - Intronic
1002579932 5:180201816-180201838 CTCACATGGAGGAAGGGACAAGG - Intronic
1013389690 6:109671409-109671431 CTCAAATGGATGCTGAGCAAGGG - Intronic
1014965863 6:127749591-127749613 CTGAAATAGATGCTATGACAGGG + Intronic
1019991432 7:4694588-4694610 CACAAATGGATTCTGGGGCTTGG + Intronic
1022501808 7:30886549-30886571 CTCAAAGTGTGGCTGGGACACGG - Intronic
1023477414 7:40595516-40595538 CTCACATTGTTTCTGGGACAGGG + Intronic
1026595078 7:71727550-71727572 AGCACTTGGATGCTGGGACAGGG - Intergenic
1026846288 7:73700682-73700704 CCCTAATGGGTGCTGGGGCATGG + Intronic
1028860304 7:95641641-95641663 CACAGAGAGATGCTGGGACAAGG - Intergenic
1030456543 7:109781772-109781794 CTCCACAGGATGCTGGGAAATGG - Intergenic
1031027110 7:116691764-116691786 TTAATATGGATGCTGGGAGAGGG - Intronic
1031141617 7:117949132-117949154 CTCAAATGGGTGCTGGGGAGCGG - Intergenic
1043170714 8:76962454-76962476 CTGCAATGGAAGCTGGGTCAAGG - Intergenic
1043760922 8:84067162-84067184 CTCAAATGCACTCTAGGACATGG + Intergenic
1043857630 8:85279557-85279579 CTGAAAGTGCTGCTGGGACAGGG + Intronic
1044247180 8:89962306-89962328 CCCAAATGGGTGCTGAGACAAGG + Intronic
1049935018 9:493307-493329 CTCACATGGTTGCTGGCAAAAGG - Intronic
1055237306 9:74139231-74139253 CTCAAATGGCTGTTGGCAAAAGG - Intergenic
1057724026 9:97555694-97555716 CTCACATAGAACCTGGGACATGG - Intronic
1187572145 X:20515610-20515632 CTCTACTGGGTGCTGGTACAGGG - Intergenic
1194100258 X:89694470-89694492 CCCAAATGGCTTCTGGGAAAGGG - Intergenic
1194341345 X:92710046-92710068 CTAAAGTGGATCCTGGTACAAGG + Intergenic
1196604270 X:117638087-117638109 CCCAAATAGATGCTCTGACATGG - Intergenic
1198891900 X:141405841-141405863 CTAATAAGGAAGCTGGGACAAGG + Intergenic
1199944621 X:152655317-152655339 CACAGATGGATGGAGGGACAGGG - Exonic
1200453258 Y:3355829-3355851 CCCAAATGGCTTCTGGGAAAGGG - Intergenic
1200649697 Y:5826759-5826781 CTAAAGTGGATCCTGGTACAAGG + Intergenic
1202150998 Y:21843699-21843721 CTCAACTGAATTCTGGGCCATGG + Intergenic