ID: 975756771

View in Genome Browser
Species Human (GRCh38)
Location 4:77579059-77579081
Sequence CAAGGGCTACACTCTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 161}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975756761_975756771 18 Left 975756761 4:77579018-77579040 CCCCAGCAAATGAGAACTTGAGG 0: 1
1: 0
2: 1
3: 19
4: 187
Right 975756771 4:77579059-77579081 CAAGGGCTACACTCTGAGGATGG 0: 1
1: 0
2: 0
3: 24
4: 161
975756760_975756771 22 Left 975756760 4:77579014-77579036 CCTGCCCCAGCAAATGAGAACTT 0: 1
1: 0
2: 0
3: 11
4: 203
Right 975756771 4:77579059-77579081 CAAGGGCTACACTCTGAGGATGG 0: 1
1: 0
2: 0
3: 24
4: 161
975756764_975756771 16 Left 975756764 4:77579020-77579042 CCAGCAAATGAGAACTTGAGGCT 0: 1
1: 0
2: 1
3: 9
4: 149
Right 975756771 4:77579059-77579081 CAAGGGCTACACTCTGAGGATGG 0: 1
1: 0
2: 0
3: 24
4: 161
975756763_975756771 17 Left 975756763 4:77579019-77579041 CCCAGCAAATGAGAACTTGAGGC 0: 1
1: 0
2: 0
3: 12
4: 187
Right 975756771 4:77579059-77579081 CAAGGGCTACACTCTGAGGATGG 0: 1
1: 0
2: 0
3: 24
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975756771 Original CRISPR CAAGGGCTACACTCTGAGGA TGG Intronic
901865248 1:12102344-12102366 CAAGGGGGACTCTCTGAAGAAGG - Intronic
902802589 1:18839604-18839626 CCAGGGCTACACCATGAGGAGGG - Exonic
904921570 1:34012211-34012233 CAAGGGCAAGGCTCTGAGGTGGG - Intronic
906546449 1:46622651-46622673 CAAGGGCTCCCCCCTGAGGAGGG - Intergenic
906815168 1:48871304-48871326 CAAAAGCTACAGTCTAAGGAAGG + Intronic
907728976 1:57047513-57047535 CCAGATCCACACTCTGAGGAAGG + Intronic
908348391 1:63259614-63259636 CAAGGGCCACACCCTAGGGATGG + Intergenic
915736867 1:158090603-158090625 CTTAGGCTCCACTCTGAGGAAGG + Intronic
918236235 1:182583059-182583081 CGTGGGCTACACTCTGCAGAAGG - Intronic
918886919 1:190205690-190205712 CCAGGCCTACACTCAGAAGAAGG + Intronic
919694907 1:200564367-200564389 CAGGGGCTACACTTTGGGCATGG + Intronic
919756409 1:201068911-201068933 CATGGGCTGTACTCTGTGGATGG + Intronic
920153414 1:203928308-203928330 CAACGGCTACAATGTGATGAGGG + Intergenic
920328523 1:205186582-205186604 CAAGAGCAAAACTCTGAGTATGG + Intronic
920685184 1:208103900-208103922 CAAGGGCTACACTCTCTGGGGGG - Intronic
921643593 1:217585754-217585776 CCAGGGATACATTCTGAGAAAGG + Intronic
922605810 1:226889177-226889199 CAAAGGCGACTCTCTCAGGAGGG - Intronic
924489861 1:244525964-244525986 TGAGGCCAACACTCTGAGGATGG - Intronic
1062879066 10:963848-963870 CAAGGGCTCCACCCTCACGAAGG - Intergenic
1064731287 10:18333313-18333335 AGAGGGATAAACTCTGAGGAAGG + Intronic
1065181804 10:23133732-23133754 TAAGGGTTACAGGCTGAGGAGGG + Intergenic
1067156584 10:43786080-43786102 CAGGAGCCTCACTCTGAGGACGG + Intergenic
1068917739 10:62451100-62451122 CAATGGCTACAGAATGAGGAAGG + Intronic
1069003022 10:63286596-63286618 AAAGAGCTACATACTGAGGATGG - Intronic
1069557532 10:69407778-69407800 CAGGGGCCAGGCTCTGAGGAGGG - Intronic
1072617957 10:97062326-97062348 CAAGAGCCTCACACTGAGGAGGG + Intronic
1073069355 10:100783418-100783440 GAAGGGCTGCTCTTTGAGGAGGG + Intronic
1075923989 10:126235889-126235911 CAAGGGGAACACACGGAGGAGGG + Intronic
1076140147 10:128071767-128071789 CAAGGGCCAGAGTCTGAAGATGG - Intronic
1077885650 11:6385731-6385753 CAAGGCTTCCACTCTGAGGAGGG - Intergenic
1078848842 11:15145509-15145531 CAAGGGCTTCAGACTGAAGATGG + Intronic
1079485148 11:20928367-20928389 CCACGGCACCACTCTGAGGAAGG - Exonic
1080322169 11:31023050-31023072 CAAAGGCTCCACTCTAAGGAAGG + Intronic
1081725270 11:45323317-45323339 CCTGGGGGACACTCTGAGGAGGG + Intergenic
1083400257 11:62418590-62418612 CATAGGCTCCCCTCTGAGGAGGG - Intronic
1084483078 11:69433230-69433252 CAGGGGCTCCACCCTGAGGCTGG + Intergenic
1084653258 11:70501203-70501225 CTGGGGCTAGAGTCTGAGGATGG - Intronic
1085470336 11:76753533-76753555 CAAAGGCAACTCCCTGAGGAGGG + Intergenic
1090265472 11:125350695-125350717 CTGGGGCTACAGTCTGAGGACGG + Intronic
1091143523 11:133257330-133257352 AAAGGGCAATACTCTGAGAAAGG + Intronic
1091951095 12:4593673-4593695 CAAGGGCTACAGTCAGAAGAGGG - Intronic
1092307693 12:7318363-7318385 CAACTGCAACACTCTGAGGCAGG + Intronic
1092337246 12:7643891-7643913 GAAAGGCTACAGTCAGAGGATGG + Intergenic
1095353606 12:41244601-41244623 CATGGGCAACACTCTGAGGCGGG - Intronic
1095559613 12:43550844-43550866 CAAGGGCTACATTCAGCGAACGG - Intronic
1095996023 12:48085364-48085386 CAAGGACTCCACCCTGCGGAGGG + Intronic
1096337642 12:50768507-50768529 CAAGGGCTCCACCCTGAAGCCGG + Intronic
1096434097 12:51573576-51573598 CAGGAGCTTCACTCTGAGGCAGG + Intergenic
1098833524 12:75391749-75391771 CAAGTGCGACACTCTCAGGGTGG + Intronic
1106750536 13:32760970-32760992 CAATTGCTACACACTGAGGTTGG - Intronic
1106984120 13:35324130-35324152 CAGGGGCTACACTAACAGGAAGG + Intronic
1109778530 13:67076612-67076634 CAAGAGCTAAACTATGAGGAAGG + Intronic
1112638525 13:101245143-101245165 CAGGGGCTGCAGACTGAGGAGGG - Intronic
1117907717 14:60608008-60608030 CAAGGGATACAATCTGAGAATGG - Intergenic
1118778862 14:68992742-68992764 CCAGGGCTACACTTTGAAAACGG + Intergenic
1119092645 14:71799134-71799156 TAAGGGCAAAACTCTTAGGAAGG + Intergenic
1119123062 14:72097826-72097848 AAGGAGCTACAATCTGAGGAAGG - Intronic
1121708097 14:96015887-96015909 CATGGGGTACACTCTGGGGGTGG + Intergenic
1125919275 15:43515944-43515966 CAAGGGCCACACCCTGGGCATGG - Intronic
1126020342 15:44394306-44394328 CAGGGGATACATTCTGAGAAAGG + Intronic
1126479205 15:49099326-49099348 CAAGTGCAACAGCCTGAGGAGGG + Intergenic
1129151924 15:73694608-73694630 CAAAGGCAACACCCTGAGGACGG - Intronic
1133029931 16:3005596-3005618 CAAGAGCCATACACTGAGGATGG - Intergenic
1134141080 16:11719962-11719984 CAAAGGCCACAGTCTGAGGAAGG + Intronic
1136254402 16:29028738-29028760 CAGGGACCACCCTCTGAGGAAGG - Intergenic
1138528528 16:57622428-57622450 CAGGAGCCACACTCGGAGGAGGG + Intronic
1143165157 17:4893849-4893871 CAGGGGCTACACCGTGAGGGTGG + Intronic
1146677967 17:34786288-34786310 CAGGGGCTTGGCTCTGAGGAAGG + Intergenic
1146679439 17:34796430-34796452 CAGGGACTACCCTCTGAGGCTGG + Intergenic
1147244968 17:39114101-39114123 CAAGAGCCACACCCTAAGGATGG + Intronic
1151372793 17:73659517-73659539 CATGGGCAATTCTCTGAGGAAGG - Intergenic
1155513921 18:26605002-26605024 TAAAGGCTATACTCTGAGGATGG - Intronic
1156545398 18:37958878-37958900 AAAGGGCCACACTCAGAGGAAGG + Intergenic
1157560110 18:48639784-48639806 CAAGGGCAACACTCTAGAGAGGG - Intronic
1160529230 18:79553803-79553825 GAAGGGCTGCACTGTGAAGAAGG + Intergenic
1160990021 19:1856688-1856710 CAAGGGCCTCAGTCTGGGGACGG + Intronic
1164280711 19:23766312-23766334 TAAAGGGTACACTCTGAGGCTGG - Intronic
1165561770 19:36686602-36686624 CAAGGGAGAGCCTCTGAGGAAGG + Intergenic
1166288023 19:41844459-41844481 AAAGGGGTGCAATCTGAGGAAGG + Exonic
1166310762 19:41961150-41961172 CAAGGGCCCCACACTGAAGATGG + Intergenic
1166756513 19:45195609-45195631 CAAGAGAGAAACTCTGAGGAAGG - Intronic
1167048194 19:47063778-47063800 CCAGGGGTATCCTCTGAGGAGGG - Intergenic
930013120 2:46952802-46952824 CCAGTGCTCAACTCTGAGGATGG - Intronic
931121833 2:59228299-59228321 CAATGGTAACACTCTGAGAAAGG + Intergenic
932781361 2:74560592-74560614 CAAGGGATCCACTGTGAGCATGG + Intronic
933934775 2:87193467-87193489 CAAGGGCTGCCCGCTGAGGTAGG - Intergenic
934854881 2:97723617-97723639 CGAAGGCAACACTCTAAGGAGGG - Intronic
936093924 2:109517548-109517570 CAATGGCTGCACTCTGACGTTGG + Intergenic
936358366 2:111772429-111772451 CAAGGGCTGCCCGCTGAGGTAGG + Exonic
938680711 2:133687148-133687170 CAAGTTCTACATTTTGAGGAAGG + Intergenic
938729386 2:134134494-134134516 CAAGGGCAGAACTCTGAGTAAGG + Intronic
940941964 2:159571898-159571920 CAAGGGCTCCACCCTTATGAAGG - Intronic
942864728 2:180659597-180659619 TAAGGGATACAGTGTGAGGAGGG + Intergenic
943346954 2:186749840-186749862 AAAGGCCTCCTCTCTGAGGAGGG - Intronic
945920435 2:215749786-215749808 CAAGGGCTCCAGGCTGATGACGG - Intergenic
947844403 2:233232415-233232437 CAAGGGCTATCCTCTGGAGAGGG + Intronic
948744142 2:240073766-240073788 GAAAGTCAACACTCTGAGGAGGG - Intergenic
1168860874 20:1045236-1045258 CAAGGGCAGCAAGCTGAGGATGG - Intergenic
1172240356 20:33408820-33408842 CAAGGGCTTCACACTGTGGGCGG - Exonic
1173014036 20:39208945-39208967 CAAGGGCAACCCTCTGAAGAGGG - Intergenic
1175788901 20:61729373-61729395 GAAGGGCCACATTCTGAGGCAGG - Intronic
1177381984 21:20355893-20355915 CAGGGGCTACATTGAGAGGATGG + Intergenic
1181114620 22:20623569-20623591 TAAGGGCTTCACTCTGGGAAGGG - Intergenic
1184642811 22:45881153-45881175 CAAGGGCTCCGCTCTGAATAGGG - Intergenic
1184837790 22:47034230-47034252 CAAGAGCTCCACACTGAGGGAGG - Intronic
1185069966 22:48650812-48650834 CCAGGGCTGCCCTCTGAGGCAGG + Intronic
1185359962 22:50400200-50400222 CAAGGGAAACACTGGGAGGAAGG + Intronic
949373762 3:3364262-3364284 CAAGTGCTACAGTGTGAAGAGGG + Intergenic
953205308 3:40822571-40822593 CAAGGGCAATTCTCTGAAGAAGG - Intergenic
953210402 3:40870162-40870184 CAATGGCGATTCTCTGAGGAGGG + Intergenic
954277503 3:49552233-49552255 CCAGGAATCCACTCTGAGGAGGG + Intergenic
954684358 3:52362314-52362336 CAAGGGGCCCACTCAGAGGAGGG + Intronic
955043460 3:55338100-55338122 CTAGGGCTACACAATGAGTAAGG + Intergenic
956573225 3:70720314-70720336 AAAGGGCTACACACTGAGAAAGG - Intergenic
958179932 3:90047141-90047163 AAATGGGTACACTCTGAGGTAGG + Intergenic
961810354 3:129518462-129518484 CAGGGGCCACACTGGGAGGAGGG + Intronic
962069317 3:132016921-132016943 GATGGACTTCACTCTGAGGAAGG - Intronic
962407860 3:135115690-135115712 CCAAGGCCACACTGTGAGGAAGG - Intronic
966679420 3:182625690-182625712 AAAGGGCAACATACTGAGGAAGG + Intergenic
968992175 4:3921869-3921891 CCAGGGCTGCACCCTGAGAAGGG + Intergenic
969619436 4:8271666-8271688 TGAGGGCTGCACTCTGCGGAAGG + Intronic
972370036 4:38414555-38414577 CAAGAGCAACCTTCTGAGGATGG - Intergenic
973318016 4:48781156-48781178 GAAGTCCTACACTTTGAGGATGG - Intergenic
975756771 4:77579059-77579081 CAAGGGCTACACTCTGAGGATGG + Intronic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
977161091 4:93636840-93636862 CAAGGGTTATACTCTGGGCAGGG - Intronic
980160225 4:129151997-129152019 AAAGGGTCACACTCTGAAGAAGG - Intergenic
980567760 4:134567463-134567485 TAAGGGCACCACTCTGAGGAAGG - Intergenic
984863850 4:184263868-184263890 CTAGAGCTAGACTCTGAGAATGG + Intergenic
985578751 5:685707-685729 CAAGGACCACACTCTGCAGATGG - Intronic
985660999 5:1156377-1156399 CAAGGGCTGGAGTCTGGGGATGG - Intergenic
988506083 5:31824511-31824533 TAGGGGCTACACTGGGAGGAAGG + Intronic
989301585 5:39901250-39901272 CAAGGGATGCAGTCTGATGAGGG + Intergenic
990819190 5:59818021-59818043 TTAGGGAGACACTCTGAGGAGGG + Intronic
994775112 5:104030207-104030229 GAATGGCTACAATCAGAGGATGG + Intergenic
999512997 5:152272185-152272207 CAAGGGCCACAATCTTAGGATGG + Intergenic
999893192 5:156000917-156000939 CAGGGACCACACTTTGAGGATGG + Intronic
1000393130 5:160746246-160746268 CCAGGGCTCCACTCTGAGTGAGG - Intronic
1003120730 6:3317270-3317292 CAAGGGCTCCCAGCTGAGGAAGG + Intronic
1003928672 6:10901892-10901914 CAAAGACTAGACTCTGAGAAAGG - Intronic
1004251035 6:14023354-14023376 CTGGGGCCACACCCTGAGGACGG - Intergenic
1004512880 6:16297007-16297029 CAAGGGCTGCACTTTGGAGACGG + Intergenic
1005061855 6:21783946-21783968 TAAGGCTTACCCTCTGAGGAGGG + Intergenic
1006852589 6:37109759-37109781 CATGGGCTTCACTCCCAGGATGG - Intergenic
1006922632 6:37636664-37636686 CAAAGGGTGCACACTGAGGAGGG + Exonic
1007746778 6:44047954-44047976 CCTGGGCTGCACTCTGAGGCAGG + Intergenic
1009461976 6:63924412-63924434 CAAGTGATACACTCTGTGCAAGG + Intronic
1010767584 6:79793953-79793975 CAAGGGCTTCACTGCGAAGAAGG - Intergenic
1011811691 6:91139609-91139631 TCAGGGCTACACTCTGGGCAAGG + Intergenic
1012921416 6:105224236-105224258 CAAGGGCTGGGCTCTGAGCATGG - Intergenic
1016376131 6:143422359-143422381 CATGGGCCACACTTTGAGTAAGG - Intergenic
1018051867 6:160016276-160016298 CCAGGGCAACATTCTGGGGAGGG - Intronic
1018668505 6:166161374-166161396 CAGAGGCTAGACTCTGAGGCAGG - Intronic
1021093473 7:16509726-16509748 CCATCGCTACACTCTGAGGGTGG - Intronic
1021663883 7:22952835-22952857 AAAGGGCTGCACTCTGAGCAAGG + Intronic
1022532774 7:31077127-31077149 CAAGGCCTACAGTCTGAGGGAGG - Intronic
1022941710 7:35248499-35248521 CATGGGCTAGGCTCTGAGAAAGG - Intronic
1023839109 7:44085954-44085976 CAAGGGCCACCCTCTGGGAAGGG - Intergenic
1024968603 7:55048309-55048331 TAAGGCCTACATTCTGAGCAGGG - Intronic
1032584867 7:133136920-133136942 CACGGGCTACAATCTGAGTGTGG - Intergenic
1034231494 7:149532141-149532163 TAAGGGCTTCACCCTGAGGCTGG + Intergenic
1037685922 8:21139350-21139372 CAAGGGCCAGACACTGAGCAAGG + Intergenic
1038604980 8:28992116-28992138 CAAGGGCACGACTTTGAGGATGG + Intronic
1040573424 8:48629113-48629135 CACGGGCAGCACTCTCAGGATGG + Intergenic
1042201266 8:66281269-66281291 CAAAGGCTGTACTCTAAGGATGG - Intergenic
1043934762 8:86130721-86130743 GGAGGGCTTCACTCTGGGGAGGG - Intronic
1046720780 8:117616604-117616626 CAAGGACAAGCCTCTGAGGAAGG + Intergenic
1046789566 8:118306544-118306566 CAAGGACTTCATTCTAAGGAGGG + Intronic
1047992026 8:130296432-130296454 CCAGGGCAAAACTCTGTGGAGGG + Intronic
1048962611 8:139593305-139593327 CAAGGGCCAGACCCTGAGCAAGG + Intergenic
1049118649 8:140713598-140713620 CAAGGACTACACTTTGAGAATGG + Intronic
1049291236 8:141803416-141803438 CAAGGGCTCCACCCTCAGTACGG + Intergenic
1050756802 9:9014665-9014687 CATGGGAGACAATCTGAGGAAGG + Intronic
1051534044 9:18136964-18136986 CAAGGCCTGAACTCTGAGGCAGG + Intergenic
1052615943 9:30842243-30842265 CAAGGAAGACACTCTGAGAAAGG - Intergenic
1056271735 9:84954179-84954201 CAAGGGCTTCTCTCTGGGAAAGG - Intronic
1056733191 9:89183231-89183253 CAGGGGATACTCTCTGTGGATGG - Intergenic
1059551595 9:115234535-115234557 CAAGGGCGAGACTCTGTGGAAGG - Intronic
1060442800 9:123657057-123657079 AAAGGGCTCAAATCTGAGGAAGG + Intronic
1186441930 X:9593912-9593934 GAAGGGCTGCACTGTGTGGAGGG + Intronic
1187433366 X:19244767-19244789 CAATGCCTACAGGCTGAGGATGG + Intergenic
1188460723 X:30424017-30424039 AATTGGCTAGACTCTGAGGATGG - Intergenic
1195622719 X:106973352-106973374 TAAGGGCAATACTCTGAGTATGG - Intronic
1195951299 X:110276726-110276748 CAAGGGCAACACTGTGAGGCTGG - Intronic
1199612288 X:149628783-149628805 CAATGGCTGCACTCTGAAGGTGG + Intronic
1199730545 X:150628060-150628082 CAAGTGCTACACTCAGGGGAAGG - Intronic