ID: 975758784

View in Genome Browser
Species Human (GRCh38)
Location 4:77597718-77597740
Sequence GGAAGTGCACAAATGGCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 4, 3: 49, 4: 212}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975758784 Original CRISPR GGAAGTGCACAAATGGCTCT TGG Intronic
900477049 1:2880821-2880843 CCAAGTGCACAAATGACTGTGGG + Intergenic
900812571 1:4818275-4818297 GGAAGTGCACAGATGGGCCAAGG + Intergenic
900842944 1:5070461-5070483 GGAAGTGCACAGATGGGCCTAGG - Intergenic
900883859 1:5401814-5401836 GGAAGTGCACAGATGGGCCTAGG - Intergenic
901042552 1:6374232-6374254 GGAGGTGGCCAAATGGCCCTGGG + Intronic
901428794 1:9199815-9199837 GGAACTTCACAAATGGGTCCCGG - Intergenic
901510557 1:9716319-9716341 GGGAGTTCACAAATGACACTGGG - Intronic
902173143 1:14629300-14629322 TGATGTTCACAAAAGGCTCTTGG - Intronic
903707493 1:25297276-25297298 AGAAGGGCACACACGGCTCTTGG - Intronic
903719746 1:25396078-25396100 AGAAGGGCACACACGGCTCTTGG + Intronic
903753728 1:25646389-25646411 GGAACTGCATAGATGGCTGTGGG + Intronic
904401942 1:30262525-30262547 GGATTTGCAGAAATGCCTCTGGG + Intergenic
905670957 1:39789430-39789452 AGAAGTGCACAGGTGGCTCCCGG - Intergenic
905684690 1:39900516-39900538 GGCTTTGCACAAAAGGCTCTCGG + Intronic
908395856 1:63725161-63725183 GGAAGTGTACAGATGGGCCTAGG - Intergenic
909611026 1:77552001-77552023 GGAAGTGCACAGATGGGCCTAGG - Intronic
911161112 1:94683960-94683982 GGATCTGCAGAAAGGGCTCTGGG + Intergenic
911191701 1:94955122-94955144 GTAAGTGAATACATGGCTCTGGG - Intergenic
911556150 1:99347298-99347320 GGAACTTCACAAATGCTTCTCGG + Intergenic
912584497 1:110750102-110750124 GGAAGCCCAGAACTGGCTCTGGG + Intergenic
912648533 1:111417973-111417995 GAAGGTAAACAAATGGCTCTGGG + Intronic
916217506 1:162410027-162410049 GGAAGTACACAAATGGGCCTTGG - Intronic
917626856 1:176854898-176854920 GGAGGTGCAACTATGGCTCTGGG - Intergenic
918162309 1:181912764-181912786 GGAAGTGAAAACATGCCTCTTGG - Intergenic
918780165 1:188689827-188689849 GGATATGAGCAAATGGCTCTAGG + Intergenic
918983138 1:191589128-191589150 GGTAGTGCACAGATGAGTCTAGG + Intergenic
920055883 1:203191363-203191385 GGAAGTGCACAGATGGGCCTAGG - Intergenic
922222543 1:223619353-223619375 GGAGGTGCACAAATGGAACCTGG - Exonic
922232572 1:223699670-223699692 GGAAGTGCACAGATGGGCCTAGG - Intergenic
922767553 1:228163743-228163765 GCAAGTGCACAGATGGGCCTAGG - Intergenic
924455275 1:244214280-244214302 GGGAGAGCACAGATGGCTCAGGG - Intergenic
924809892 1:247391736-247391758 GGAAATGCACAGATGGGTCTAGG - Intergenic
924850309 1:247822470-247822492 GGACTTGCACCAAGGGCTCTTGG + Intergenic
1066515029 10:36149079-36149101 AAAAGTGCACATATGGCCCTGGG - Intergenic
1067250021 10:44578279-44578301 GGAAATGCACAGATGGGTCCAGG + Intergenic
1068751863 10:60603218-60603240 GTCAGTGCACTAATGGCTGTTGG - Intronic
1069825797 10:71254349-71254371 GGAGGAGCACAAATGGCTCTGGG + Intronic
1070325841 10:75388380-75388402 AGATGTGCACATATGGCTGTTGG + Intergenic
1070548539 10:77472969-77472991 GGAAGTGCACATTTGGGTTTTGG - Intronic
1071223111 10:83492987-83493009 GAAAGTGCACAGATGGGCCTAGG + Intergenic
1071425019 10:85540617-85540639 GGAAGTGCATAGATGGGCCTGGG + Intergenic
1074471950 10:113735411-113735433 GGAGGTGAACAAATCACTCTAGG + Intergenic
1075035387 10:119062477-119062499 AGAAGTTGACAAATGCCTCTTGG + Intronic
1075121668 10:119669147-119669169 GGAAGTGCACAGATGGGCCTAGG + Intronic
1075374402 10:121966525-121966547 GAACATACACAAATGGCTCTGGG + Intronic
1075397394 10:122137555-122137577 GGAAAAGCACAAGAGGCTCTTGG - Intronic
1082568176 11:54706561-54706583 TGAAATGTACAAATGGCTGTTGG + Intergenic
1083170483 11:60921451-60921473 GGAAGTGAACAACTGGCACGTGG - Intronic
1084607290 11:70179849-70179871 GGACCTGAACAAATGACTCTTGG + Intronic
1087357890 11:97117930-97117952 GGAAGTACACAGATGGTCCTAGG + Intergenic
1090286760 11:125506346-125506368 GGAAGTGCACAGATTGATCTAGG - Intergenic
1090418593 11:126557999-126558021 GGGAGAGCAGAAATGCCTCTGGG - Intronic
1091987974 12:4928564-4928586 CAAAGTGCACCAATGGCTGTTGG + Intronic
1096143856 12:49264781-49264803 GGAAGGGCAGGAAGGGCTCTGGG - Intronic
1096875926 12:54630543-54630565 GGAAATGCTCAAATGTCACTAGG + Intergenic
1097093463 12:56526072-56526094 GGAAGTGGGCAGATGGCTCAAGG + Intronic
1097387089 12:58962937-58962959 GGAGGTGCACAGATGGGCCTAGG - Intergenic
1099926752 12:89027917-89027939 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1100751366 12:97701934-97701956 GGAAATGCACAGATGGGCCTAGG - Intergenic
1100950377 12:99842427-99842449 GGAAGTACACAGATGGGCCTAGG - Intronic
1101153840 12:101908779-101908801 GGAAGTGCACAGATGGACCTAGG + Intronic
1101880136 12:108620797-108620819 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1102548115 12:113671246-113671268 TGAAGTTTACAAATGCCTCTGGG + Intergenic
1103099550 12:118161050-118161072 TGAAGTGCACACATGACTGTGGG - Intronic
1103373591 12:120438073-120438095 GGAAGTGGAAAATTGGCTCTGGG - Exonic
1105266241 13:18819749-18819771 CGAAGTCAATAAATGGCTCTAGG + Intergenic
1106036843 13:26051481-26051503 GGCAGTGCACGCAAGGCTCTGGG + Intergenic
1106090404 13:26587386-26587408 GAAACTACAGAAATGGCTCTTGG + Intronic
1106332668 13:28753966-28753988 GGAAGTGCATAGAAGGCCCTAGG - Intergenic
1107389681 13:39951167-39951189 ATAAGTGCACAAATAACTCTAGG + Intergenic
1107502341 13:40993374-40993396 GGCAGTGCACCGATGGGTCTGGG + Intronic
1107827655 13:44343789-44343811 GAAAGTGTATAAATGGCACTGGG + Intergenic
1107963355 13:45578044-45578066 GGAAGTGCACAGATGGACCTAGG - Intronic
1107966194 13:45600313-45600335 GGAAGTGCACAGATGAATCTGGG - Intronic
1108481243 13:50874146-50874168 GGAAGTGCCCAGATGGGGCTAGG + Intergenic
1108722237 13:53144055-53144077 GGAGGAACAAAAATGGCTCTTGG + Intergenic
1109627595 13:64995733-64995755 GGAAGTGCAAAGATGGGCCTAGG + Intergenic
1110056056 13:70973867-70973889 GAATGTGAACAAATGGCTCCAGG - Intergenic
1114535329 14:23418869-23418891 GGGACTGCACAAATGGGTCCTGG - Intronic
1114967936 14:27986825-27986847 AGAAGTGCATTAATGGCTTTAGG + Intergenic
1116189794 14:41649537-41649559 TGAAGTGCACAGATGGGCCTAGG - Intronic
1116654755 14:47638353-47638375 TGAGGTGCACAAATTACTCTAGG - Intronic
1116917538 14:50539685-50539707 GGAAGTACACAGAATGCTCTTGG + Intronic
1117626727 14:57647692-57647714 GGAAGAACACAGATGGGTCTAGG - Intronic
1117631727 14:57700360-57700382 GGAAGTTTACAAATTGCTCTAGG + Intronic
1118523236 14:66611019-66611041 GAAAGTGCACAGATGGGCCTAGG + Intronic
1119962078 14:78870178-78870200 GGAAGTGCACAGATGAGCCTAGG + Intronic
1122717185 14:103702769-103702791 GGACGTGCACAGATGGGCCTAGG - Intronic
1127298512 15:57630641-57630663 GGAGGGGCACTAATGCCTCTAGG - Intronic
1128371345 15:67041700-67041722 GGATTTGCAAGAATGGCTCTTGG + Intergenic
1128820703 15:70650187-70650209 GGAAGTGCACAGATGGGCCTAGG + Intergenic
1129141941 15:73606845-73606867 GGAAGTTCACAGATGGGCCTAGG - Intronic
1130145723 15:81272460-81272482 GGAATTGTACAGGTGGCTCTGGG - Intronic
1131588061 15:93717506-93717528 AGAAGTGCACACATGGATCCAGG + Intergenic
1131920509 15:97322927-97322949 GGAAGTGCACAATGCGCTGTAGG + Intergenic
1132268337 15:100499776-100499798 GAGAGTACACAAATGTCTCTTGG - Intronic
1135586133 16:23672530-23672552 GCAAGTGAACAAATGAGTCTGGG + Exonic
1137783835 16:51121058-51121080 GGACGTGACCAAATGTCTCTTGG + Intergenic
1138786624 16:59854161-59854183 GGAGGTACACAAATGGCACAAGG - Intergenic
1144588201 17:16501747-16501769 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1144646525 17:16978388-16978410 GGCAGTGCACAGATGTTTCTCGG + Intergenic
1146659007 17:34652194-34652216 GGCAGTTCAGAAATGTCTCTGGG - Intergenic
1147685558 17:42284818-42284840 GTAAGTGCACAGATGGCACCAGG - Intergenic
1148023998 17:44573015-44573037 AGGAGTGCCCAAATGACTCTTGG + Intergenic
1148087411 17:45002626-45002648 AGAAGTGCACAAATAGTGCTCGG + Intergenic
1149523102 17:57333331-57333353 GGAAGAGCTCAAATGCCACTGGG - Intronic
1150282349 17:63936291-63936313 GGAAGACCACAAATGCCTCAAGG - Intergenic
1151759594 17:76093075-76093097 GGCAGTGCAAATAGGGCTCTGGG + Intronic
1153944233 18:10004630-10004652 GGAAATGCACATATGGGTCTAGG - Intergenic
1154126628 18:11697932-11697954 GCCAGTGCACTAATGACTCTGGG - Intronic
1155364404 18:25035916-25035938 GGAACTGCACACATGGCTGCGGG + Intergenic
1156000785 18:32381835-32381857 TGAAGGTAACAAATGGCTCTGGG - Intronic
1158094853 18:53758746-53758768 GGAAGTGCAGAAATGGGCCTAGG + Intergenic
1159507452 18:69355785-69355807 GGAAATGCACAGATGGGCCTAGG - Intergenic
1161058023 19:2200358-2200380 GGCAGTGCAGAGATGGCTTTTGG - Intronic
1161340538 19:3739548-3739570 GGAGGTCCACAAAAGGCTCTGGG + Intronic
1162427450 19:10604910-10604932 GGAAATGGGGAAATGGCTCTGGG + Intronic
1163358709 19:16831457-16831479 GGAAGTGGGCAAAAGGGTCTTGG - Intronic
1163407302 19:17130881-17130903 AGAAGTGCACAGATGGGACTGGG - Intronic
1164710668 19:30354925-30354947 GAAAGTCCAGAAAAGGCTCTGGG - Intronic
1164772274 19:30818817-30818839 GGAAAAGCACAGCTGGCTCTTGG - Intergenic
1165593479 19:36990985-36991007 TGAAGTGCCCACATGGTTCTTGG - Intronic
1165722152 19:38087097-38087119 GGAGGTGCACAGATGGGCCTAGG + Intronic
1166125295 19:40711765-40711787 GTAAGTGCACAGAAGGCACTGGG - Intronic
926041393 2:9676144-9676166 GGCAGAGCACATAGGGCTCTGGG - Intergenic
926513974 2:13817748-13817770 GGAAGTGAAGAAGTGGCTCTGGG + Intergenic
928442488 2:31303783-31303805 GGAAGAGCAGAAAAGCCTCTAGG + Intergenic
929822340 2:45283491-45283513 GGAACTGCAAATTTGGCTCTGGG + Intergenic
930273824 2:49288241-49288263 GGAAGTGCACAGATGGGCTTGGG + Intergenic
930350327 2:50245218-50245240 GGAACTGCTTAAAAGGCTCTTGG + Intronic
931582327 2:63790441-63790463 GCAGGTGCACAAGTGGATCTTGG + Intronic
932601429 2:73129213-73129235 GGAAGTGCACAGGTGGGCCTAGG - Intronic
933293241 2:80461132-80461154 GGAAATGCACAAATGGGAGTAGG - Intronic
933373907 2:81454021-81454043 GAAAGTGCACAAATGTCCTTTGG + Intergenic
934935390 2:98461460-98461482 GGCTGTGCACTAATGTCTCTTGG + Intronic
935390168 2:102542664-102542686 GGAAGTACACAAACGGGCCTTGG + Intergenic
935736262 2:106108863-106108885 GGAAGTGCACAAATGGGCCTAGG - Intronic
937371085 2:121297727-121297749 GGAAGAGCACAAAAGATTCTAGG - Intergenic
938182874 2:129199543-129199565 GGAAGTACACAGATGGGCCTAGG - Intergenic
938213296 2:129486410-129486432 GGAAGGGCACAGATGGCACAAGG + Intergenic
943368349 2:186985602-186985624 GGAAGGGGACAAAGGCCTCTGGG - Intergenic
943404957 2:187470517-187470539 GGAAAGGCCCAAATGGTTCTAGG - Intronic
945578666 2:211564817-211564839 GGAACAGGACAAATAGCTCTGGG + Intronic
946098774 2:217300931-217300953 GGAAGTACACAAATGTGTTTTGG + Intronic
946494739 2:220184476-220184498 GGAAGTACACAGATGGGCCTGGG - Intergenic
946949004 2:224851907-224851929 GGAACTGGAAAAATGGCTCTGGG - Intronic
947960354 2:234231291-234231313 GGAGGGTCAGAAATGGCTCTTGG + Intergenic
1170788703 20:19490265-19490287 GGAATTGAAAAAATGGCTCCTGG + Intronic
1171081696 20:22193066-22193088 GTAAGTGTACCAATGGGTCTTGG - Intergenic
1175739738 20:61412289-61412311 GGGACTGCACAGACGGCTCTGGG - Intronic
1181330340 22:22086164-22086186 GGGAATGCACAGCTGGCTCTGGG + Intergenic
1181438907 22:22925590-22925612 GGAAGAGCACATGGGGCTCTGGG + Intergenic
1181964352 22:26646199-26646221 TGCAGAGCACAAATGGCACTGGG - Intergenic
1184853802 22:47135744-47135766 GGAAGTGACCAAAAAGCTCTAGG + Intronic
1184910833 22:47532885-47532907 GGAAGTGCACAGATGGGGCTAGG + Intergenic
1184965142 22:47966038-47966060 GGAAGTGCACAGGTGGGTCTGGG - Intergenic
1185032885 22:48453972-48453994 GGCAGTGCAGGAATGGCTGTTGG - Intergenic
950190902 3:10975412-10975434 GAGACTGCACAAAGGGCTCTAGG + Intergenic
950924799 3:16729697-16729719 GGAAGTGCACAGATGGGCCCTGG + Intergenic
950936959 3:16848951-16848973 CGATGCGCATAAATGGCTCTTGG - Intronic
956680232 3:71772340-71772362 GGCAGGGCACAAATGGGGCTTGG + Exonic
957799054 3:85051022-85051044 GGAAGAGCAAAAAAGGCTCGAGG + Intronic
958082661 3:88766846-88766868 GGAAGTGAACAAAAGGAACTAGG + Intergenic
958927377 3:100173554-100173576 AGAAGTGCTCATTTGGCTCTTGG - Intronic
959980902 3:112516552-112516574 GGAGGTGCACAGATGGGCCTAGG - Intergenic
960744279 3:120869293-120869315 GGAAGTTCTCAATTGACTCTGGG - Intergenic
961350217 3:126295701-126295723 GGAAGTGCACAGATGGGTCAAGG - Intergenic
961803117 3:129468003-129468025 GGGAGGCCACATATGGCTCTGGG - Intronic
962924211 3:139976791-139976813 AGAAGTGCACAAATAACCCTAGG - Intronic
965463115 3:168993450-168993472 GGAAGTGCACAGATGGGCCTAGG - Intergenic
965681853 3:171259975-171259997 GGAAGTGCATAGATGGGCCTAGG - Intronic
968267639 3:197375029-197375051 GGAAGTACTCATATGTCTCTGGG - Intergenic
969264666 4:6056593-6056615 TGGAGTGCCCAAATGGCGCTGGG + Intronic
969527978 4:7713740-7713762 GGAAGTGCTCAGATGGGCCTAGG + Intronic
969850072 4:9948970-9948992 GGAAGTACACAGATGGGCCTAGG - Intronic
970921945 4:21404948-21404970 GGAAGTGCACAGATAGGCCTAGG - Intronic
975758784 4:77597718-77597740 GGAAGTGCACAAATGGCTCTTGG + Intronic
975952074 4:79786156-79786178 GGAAGTTCCAAAATGGCTCAAGG - Intergenic
976332979 4:83852960-83852982 GAAAGTGCACAGATGGGCCTAGG - Intergenic
977993679 4:103476422-103476444 GGAAGTGCACAGATGAACCTAGG + Intergenic
979129653 4:117026458-117026480 TGAAGTGCACAAATGGGCCCAGG + Intergenic
979689200 4:123542829-123542851 GGAAGTGCACAGATGGGCCTAGG - Intergenic
982022649 4:151219107-151219129 GGAAGTACACAGATGGGACTAGG - Intronic
983426401 4:167589205-167589227 GGAAGTGCACATATGGACTTAGG + Intergenic
983780777 4:171667619-171667641 GAAAGTACACAAAAGGCTCAGGG + Intergenic
984719882 4:182959638-182959660 GGAAGTACACAGATGGGCCTAGG + Intergenic
985091289 4:186364812-186364834 GGAAGTGCAGAAATGCCTCCTGG - Intergenic
986003345 5:3647642-3647664 GGCAGTGCAGACATGGCACTGGG - Intergenic
986065018 5:4226914-4226936 GGAAGTCCACGAATGGACCTAGG - Intergenic
986613679 5:9594720-9594742 GGAAGTGCACAGATGGGCCCAGG + Intergenic
987027523 5:13942500-13942522 GGAAGTGTACAGATGGGCCTAGG - Intronic
987259786 5:16191804-16191826 GGAAGTGCACAGATGGGCATAGG - Intergenic
988034578 5:25809552-25809574 GGAAGTGAACAAAGGTGTCTGGG + Intergenic
990276366 5:54201409-54201431 AGAAGTGCACAGATGGGTTTAGG - Intronic
991006704 5:61835070-61835092 GGAGCTGCAGAAATGGCTGTTGG + Intergenic
991257811 5:64634351-64634373 GGAAGTACACAGATGGGCCTAGG + Intergenic
991936751 5:71809853-71809875 AGAAATTCACAAATGACTCTTGG - Intergenic
992639371 5:78755590-78755612 TGAAGAGCACAAATGGCTTTCGG - Intronic
993856982 5:93088354-93088376 GGAAGTACACTTCTGGCTCTTGG - Intergenic
993953365 5:94202098-94202120 GGAAGTGCACAGATGGACCTAGG + Intronic
994495836 5:100512327-100512349 GGAAGAGCAGAAATGGCACATGG - Intergenic
998128268 5:139638346-139638368 GGAAGTGCTGACGTGGCTCTGGG + Intergenic
998170097 5:139867658-139867680 GGAAGTTGCCAAATGACTCTTGG + Intronic
998940652 5:147279455-147279477 GGAGGTCCCCAAATGCCTCTGGG + Intronic
1001201712 5:169723657-169723679 GGGAGTTAACAAATGGATCTGGG - Intronic
1002130168 5:177076365-177076387 GGAAGTGCACAGATGGACCTAGG - Intronic
1002272521 5:178082022-178082044 GGAAGCACACAGATGGGTCTAGG - Intergenic
1005214960 6:23515145-23515167 GGAAGTGCACAGATGGACCTAGG - Intergenic
1006302058 6:33199086-33199108 GGAAGTTCACACAAGGATCTGGG + Intronic
1006387646 6:33740287-33740309 GGAAGTGGACAGATGGCCCCAGG + Intronic
1007201956 6:40116963-40116985 GTACTTGAACAAATGGCTCTTGG + Intergenic
1007247434 6:40472591-40472613 GGAAGTGCACAAATCCAGCTCGG - Intronic
1009622895 6:66098277-66098299 GGAAGTGCACAGATGGGACGAGG + Intergenic
1010004816 6:70984102-70984124 GGAAGTGCACAGATGGGCCTAGG + Intergenic
1010508829 6:76692154-76692176 GGAAGTGCACAGATGGGCCTAGG + Intergenic
1011309059 6:85961239-85961261 GGAAATGTAGAACTGGCTCTGGG + Intergenic
1012556910 6:100524718-100524740 GGAACTGGACAGATGGCTCCAGG + Intronic
1012945987 6:105466264-105466286 GGCAGTGAAGAAATTGCTCTTGG - Intergenic
1015592572 6:134836597-134836619 GGAATTTCAGAAATGGCTCTGGG - Intergenic
1015996402 6:138999260-138999282 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1016295048 6:142564936-142564958 GTAAGAGCACACATGGCTCTAGG + Intergenic
1016443541 6:144109343-144109365 GGAAGTGCACAGATGGGCCCAGG + Intergenic
1016844094 6:148554089-148554111 AGATGTGTACAAATGGCTGTGGG + Intergenic
1021650621 7:22829472-22829494 GGAAGTGCTCAATTTGCTCTAGG - Intergenic
1022378841 7:29841029-29841051 GGGAGTGCACAGATGGGCCTGGG + Intronic
1025963449 7:66245569-66245591 AGAAGTGCACAGATGGTCCTAGG + Intronic
1026323477 7:69287625-69287647 GGAAATGCACGCATGGCTGTTGG - Intergenic
1028137017 7:87232618-87232640 GGAAGTGCACAGATGAGCCTAGG + Intergenic
1030785057 7:113650030-113650052 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1032909149 7:136409092-136409114 TGAAGTGCATAAGTGGTTCTTGG - Intergenic
1033991048 7:147287422-147287444 GGAATTGCACAGATGGGCCTTGG + Intronic
1035205821 7:157293180-157293202 AAAAGTGCACACAGGGCTCTGGG + Intergenic
1036151690 8:6305074-6305096 GGAAGTGCACAGATGGGCCTAGG + Intergenic
1037887224 8:22601492-22601514 GGCCGTGCACAAATGGAACTGGG - Intronic
1039733920 8:40309549-40309571 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1039734246 8:40313877-40313899 GAAAGTGCACAGATGGGCCTAGG - Intergenic
1041322331 8:56626168-56626190 GGAAGTGCAAAGATGGGCCTAGG - Intergenic
1041511746 8:58660404-58660426 GGAAGTGCACACAAGGACCTGGG + Intergenic
1042206798 8:66337724-66337746 GGAAGTGCACAGTTGGGCCTAGG - Intergenic
1042375490 8:68046438-68046460 TGAATTGCACAGATGGTTCTTGG + Intronic
1044256559 8:90070127-90070149 TGAAGTCCAGAAATGGCTCGGGG - Intronic
1044510323 8:93069947-93069969 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1047441799 8:124885239-124885261 GGAAGTGCACAGATGGGCCTAGG + Intergenic
1047757241 8:127928084-127928106 GGAAGTACACAGATGGGCCTAGG - Intergenic
1050023294 9:1307459-1307481 GGAAATGCAAAAATGTCTGTGGG - Intergenic
1051464397 9:17360610-17360632 GGAAGTGCACAGATGGGCTTAGG + Intronic
1051775991 9:20634621-20634643 GGAAGTGCACAAATGGGCCTAGG + Intergenic
1053537185 9:38937619-38937641 GGAAGTGCACAGATGGGCCTTGG + Intergenic
1054628950 9:67426311-67426333 GGAAGTGCACAGATGGGCCTTGG - Intergenic
1055249267 9:74282559-74282581 GGAAATGCAGAAAAGGCACTGGG + Intergenic
1055804271 9:80075553-80075575 GGAAGTGAACTAATGGGCCTAGG - Intergenic
1059306912 9:113360907-113360929 TGAAGTGCACAGATGGGCCTGGG - Intronic
1059423832 9:114208750-114208772 CGAGGTGCAAAAATGGCACTGGG + Intronic
1060029416 9:120201566-120201588 GTGTGTGCTCAAATGGCTCTGGG - Intergenic
1061494459 9:130963756-130963778 GGAAGTGCACAGATGGGCCTAGG + Intergenic
1187049789 X:15684538-15684560 GGAATTGCACTAATGGCTTCAGG + Intergenic
1187964295 X:24595480-24595502 GGCAGTGCAAAAATAGCCCTGGG + Intronic
1188421914 X:30000606-30000628 GGAAATGCACAAATGAATTTCGG + Intergenic
1190110204 X:47584427-47584449 GGAAGTGCACAGATGGGCCTAGG + Intronic
1190379748 X:49828418-49828440 GGAAATGCACAGATGGGCCTAGG + Intergenic
1190443336 X:50497381-50497403 GGCAGTCAACAAATGGCTCCTGG + Intergenic
1192614242 X:72601628-72601650 GGAAGTGCACAAATGGGCCTAGG + Intronic
1196927493 X:120647862-120647884 GGAAGGGGACCAATAGCTCTAGG - Intergenic
1197434036 X:126402780-126402802 GGCAGTGGACAATGGGCTCTAGG - Intergenic
1199983925 X:152936942-152936964 GGATGGGCAAAAATGGCTCCTGG + Intronic
1201589648 Y:15601036-15601058 GGAAGTGCACAGATGGGCCTGGG - Intergenic