ID: 975759161

View in Genome Browser
Species Human (GRCh38)
Location 4:77601090-77601112
Sequence AAAGCTATTACCTTGTAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 100}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975759161_975759165 -5 Left 975759161 4:77601090-77601112 CCACCCTACAAGGTAATAGCTTT 0: 1
1: 0
2: 0
3: 9
4: 100
Right 975759165 4:77601108-77601130 GCTTTCGGTACACACGTTTTAGG 0: 1
1: 0
2: 0
3: 0
4: 30
975759161_975759166 2 Left 975759161 4:77601090-77601112 CCACCCTACAAGGTAATAGCTTT 0: 1
1: 0
2: 0
3: 9
4: 100
Right 975759166 4:77601115-77601137 GTACACACGTTTTAGGTTTGTGG 0: 1
1: 0
2: 1
3: 1
4: 74
975759161_975759169 26 Left 975759161 4:77601090-77601112 CCACCCTACAAGGTAATAGCTTT 0: 1
1: 0
2: 0
3: 9
4: 100
Right 975759169 4:77601139-77601161 GGCTTCCCTGCATTTAAGTTGGG 0: 1
1: 0
2: 0
3: 13
4: 139
975759161_975759168 25 Left 975759161 4:77601090-77601112 CCACCCTACAAGGTAATAGCTTT 0: 1
1: 0
2: 0
3: 9
4: 100
Right 975759168 4:77601138-77601160 TGGCTTCCCTGCATTTAAGTTGG 0: 1
1: 0
2: 2
3: 13
4: 145
975759161_975759167 5 Left 975759161 4:77601090-77601112 CCACCCTACAAGGTAATAGCTTT 0: 1
1: 0
2: 0
3: 9
4: 100
Right 975759167 4:77601118-77601140 CACACGTTTTAGGTTTGTGGTGG 0: 1
1: 0
2: 0
3: 1
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975759161 Original CRISPR AAAGCTATTACCTTGTAGGG TGG (reversed) Intronic
908407335 1:63828062-63828084 AATGCTGTTACCTTTTGGGGTGG - Intronic
908610978 1:65860656-65860678 AAAGCTTTTACATTGTTGGAGGG - Intronic
909311293 1:74153264-74153286 AATGCTATTATCTTTTAGAGTGG - Intronic
910456879 1:87407116-87407138 CAAGCTATTTCCTCGTTGGGGGG + Intergenic
912782504 1:112564839-112564861 AGAGCTACTATCTTCTAGGGTGG + Intronic
915796195 1:158736283-158736305 TAAGCTATTAACTTTTGGGGTGG + Intergenic
919095687 1:193032908-193032930 AAAGCTTTTACATTGTTGGTGGG + Intronic
921678412 1:218003553-218003575 AAAGCTGTTACCTTCCAGGTAGG - Intergenic
923347813 1:233073582-233073604 AAAGATATTACCAGGTATGGTGG - Intronic
1065364290 10:24920004-24920026 AAAGCTTTTACCCTGTTGGTGGG + Intronic
1071265728 10:83963168-83963190 AAAGCTCTTACCTTCTAAGGAGG - Intergenic
1071911366 10:90238101-90238123 AAAGATATTTTCTTGTGGGGTGG + Intergenic
1078667140 11:13335132-13335154 AAAGATATTACCTTTCAGGGAGG - Intronic
1078852120 11:15173681-15173703 ATAGCTATTTCCATGAAGGGAGG + Intronic
1079751373 11:24203065-24203087 AAAGCTATAGCCCTGGAGGGAGG + Intergenic
1081524654 11:43918239-43918261 AAAGCAATTAACTGGTAGTGTGG - Intronic
1082877348 11:58001736-58001758 ATAGTTCTTACCTTGCAGGGTGG + Intergenic
1087553836 11:99689217-99689239 AATGCTTTTACCTTGTTGGCAGG - Intronic
1088881635 11:113977565-113977587 AAATGTATTACCTTGTAGAAAGG - Intronic
1090998815 11:131891141-131891163 CAAGCTAATCCCTTGTAGGGAGG + Intronic
1091272079 11:134323026-134323048 AAACCTAATACCTTGTTGGTGGG - Intergenic
1093053443 12:14531614-14531636 AAAGAGATTACATTCTAGGGAGG - Intronic
1094056795 12:26276196-26276218 AAAGCTGCTACCTCGTAGGGTGG + Intronic
1096797695 12:54088375-54088397 ATAATTTTTACCTTGTAGGGTGG + Intergenic
1109503039 13:63263131-63263153 AAAGCTATTACAGTATAGTGTGG - Intergenic
1112777413 13:102860421-102860443 AAAGCCATTACATTTTGGGGTGG + Intronic
1113139106 13:107127450-107127472 AAAGCTATGAACGTGTAGGAGGG + Intergenic
1114869618 14:26640431-26640453 AAAGCTATTACACTGTTGGTGGG - Intergenic
1117393547 14:55285643-55285665 AAAACTAATACCTTTTAAGGAGG - Intronic
1117712440 14:58545341-58545363 AGAGCTATAACTTTTTAGGGTGG - Intronic
1118085497 14:62411133-62411155 AAAGCTATTATATTTTAGGATGG + Intergenic
1122840326 14:104458939-104458961 AAAAGTATTAACTTGTAGGTGGG + Intergenic
1124286072 15:28401315-28401337 ATAGGTATTACTTTTTAGGGTGG - Intergenic
1124296629 15:28510345-28510367 ATAGGTATTACTTTTTAGGGTGG + Intergenic
1125217481 15:37292143-37292165 TAAGCTACTACCGTGTAGGCAGG - Intergenic
1128472508 15:67967247-67967269 AGGTCTATTACTTTGTAGGGGGG - Intergenic
1132214993 15:100055912-100055934 AAAGCTATTCAGTTGTAGAGTGG + Intronic
1135340213 16:21638945-21638967 AAAGCTATTTCCTTTTGGTGTGG + Intronic
1140616456 16:76670502-76670524 AAAGCTATATCCCTGTAGGAGGG - Intergenic
1144167030 17:12623002-12623024 AAAGCTGTGACCTTGTGGGCTGG + Intergenic
1146261356 17:31423956-31423978 ACAGGTTTTACCTTGTAGGGAGG + Intronic
1148538920 17:48464172-48464194 AAATATATTACCTTACAGGGTGG + Intergenic
1153120743 18:1723302-1723324 AAAGCTTTTACCCTGTTGGTGGG - Intergenic
1153184362 18:2470504-2470526 AAAGCTGCTACTTTTTAGGGTGG + Intergenic
1155694126 18:28663890-28663912 AAAGCTATCAACTTGTATGAAGG + Intergenic
1157024100 18:43822328-43822350 TAAGCTATTAACTTTTGGGGTGG - Intergenic
1159992695 18:74928742-74928764 AAAGGGAGGACCTTGTAGGGAGG + Intronic
1161314617 19:3612038-3612060 AAAGCGATGTCCTCGTAGGGCGG + Exonic
1168421556 19:56207459-56207481 AGAGCTTTTAGCATGTAGGGTGG + Intronic
1168426807 19:56245619-56245641 AGAGCTTTTAGCATGTAGGGTGG + Intronic
939690796 2:145258054-145258076 ACAGCACTTACCTTGTTGGGTGG - Intergenic
944358998 2:198829452-198829474 AATGCTATTACATTGTTGGTGGG + Intergenic
1171849539 20:30298232-30298254 ATAATTTTTACCTTGTAGGGTGG + Intergenic
1175432207 20:58913308-58913330 AAAGCCCTGACCTGGTAGGGAGG - Intergenic
951375369 3:21908477-21908499 AAAGAGATCACCTTGTAGAGGGG + Intronic
953209739 3:40865134-40865156 AGAGCTGTGACCTTGTTGGGAGG + Intergenic
954116583 3:48469953-48469975 ATAGCTACTTCCTTGTCGGGTGG + Intronic
964817925 3:160736875-160736897 AAAGCAATTAGCTTGTAGAATGG - Intergenic
966785554 3:183619798-183619820 AAGGCAATTACCCTGTAGGAGGG + Intergenic
969405420 4:6988164-6988186 AAAGCAATTGTCTTGGAGGGGGG - Intronic
971136478 4:23873940-23873962 AAAGCTAGTGCTTTGGAGGGAGG + Intronic
971656116 4:29347373-29347395 AAAGCTTTTACACTGTTGGGGGG + Intergenic
974742513 4:66024592-66024614 AAAGCTTTTACCCTGTTGGCAGG + Intergenic
975759161 4:77601090-77601112 AAAGCTATTACCTTGTAGGGTGG - Intronic
978155608 4:105486443-105486465 AAAGCTTTTACATTGTTGGTGGG + Intergenic
978828077 4:113048567-113048589 AAAAATATTAACTTGTAGGCTGG - Intronic
983515699 4:168654234-168654256 AAAGCTATTACATGGTGTGGTGG - Intronic
984259486 4:177427625-177427647 AAAGGTACTACTTTGTAGGAAGG - Intergenic
987735329 5:21834119-21834141 AAAGCTATGACCTTGTATTCAGG - Intronic
988814030 5:34814658-34814680 AAAGGAAATACCTTGAAGGGTGG - Exonic
989308974 5:39991243-39991265 AAACCTATTCTCTTGTAGTGTGG - Intergenic
990111864 5:52336228-52336250 AATGCTATTACACTGTTGGGAGG - Intergenic
991100666 5:62789078-62789100 CAAGCTAATACCTTGTAAAGAGG + Intergenic
992019227 5:72605904-72605926 AAATCTAATCCCTTGTATGGAGG - Intergenic
1001323825 5:170704821-170704843 AAGGCTGTTTCCTTGTAGGTGGG + Intronic
1001494254 5:172176800-172176822 AATGCTATCACCTTGGAGGTTGG - Intronic
1002848596 6:970847-970869 AAAGCTATATGCTTGTAGTGGGG - Intergenic
1005064166 6:21802097-21802119 AGAGATATTACTGTGTAGGGTGG + Intergenic
1007032140 6:38638553-38638575 AAAGCTATTACAGTGGAGGGAGG + Intronic
1010858637 6:80876607-80876629 AAAGCTTTTACATTGTTGGTGGG - Intergenic
1015552902 6:134430871-134430893 AAAGCTATTAAATTGTAGGTTGG - Intergenic
1015583090 6:134747732-134747754 AATGCTGTTACCTTGTTGAGAGG - Intergenic
1018715734 6:166531221-166531243 GAAGCTCTTACCTTTTAGGGTGG + Exonic
1021079895 7:16351794-16351816 AAAGCTTTTACATTGTTGGAGGG + Intronic
1023122572 7:36924668-36924690 AAACTTATTACGTTATAGGGGGG + Intronic
1023530391 7:41147604-41147626 AAAGATAGTACCTTGTGGGTGGG - Intergenic
1026099468 7:67372636-67372658 AAAGCTATTAGGTTGCAGGCCGG + Intergenic
1026442816 7:70458748-70458770 AAAGCCATTTCCTTGTCTGGTGG + Intronic
1030903212 7:115149811-115149833 AAAGTTGTTATCTAGTAGGGAGG - Intergenic
1032275104 7:130447418-130447440 AAAGCTATTTGCTTCTGGGGTGG + Intergenic
1037105927 8:15108057-15108079 AAACCTATTTCCTTGAGGGGAGG - Intronic
1039904473 8:41775972-41775994 ATAGCTGTTAACTCGTAGGGTGG - Intronic
1040753479 8:50740520-50740542 AAAGCTTTTACCTGGTTGGTGGG + Intronic
1041564233 8:59258428-59258450 AAAGCTTTTACATTGTTGGTGGG - Intergenic
1043382082 8:79713562-79713584 AAAGCTTTTACATTGTTGGTGGG + Intergenic
1045915291 8:107462705-107462727 AAAGTTTTTACTTTGTAGTGAGG - Intronic
1047703238 8:127471533-127471555 AATTCTATTACCTTGTGGGTTGG + Intergenic
1051354432 9:16228844-16228866 AAAGCTTTTACATTGTCGGTGGG + Intronic
1051655631 9:19379322-19379344 AGAGGTATTACCTTGGAGGGGGG - Intronic
1051817640 9:21128489-21128511 AATGCTTTTACCTTGTTGGTGGG + Intergenic
1053787318 9:41661526-41661548 ATAATTTTTACCTTGTAGGGTGG + Intergenic
1054175596 9:61872865-61872887 ATAATTTTTACCTTGTAGGGTGG + Intergenic
1054661943 9:67707945-67707967 ATAATTTTTACCTTGTAGGGTGG - Intergenic
1057836039 9:98446106-98446128 AAATCTATTAACTTGTAAGAAGG - Intronic
1058391063 9:104496327-104496349 AAGGCTAGTACCTTGGATGGGGG - Intergenic
1186297672 X:8168778-8168800 AAATATATTAGGTTGTAGGGAGG + Intergenic
1192935484 X:75854644-75854666 AATGCTTTTACATTGTAGGTGGG - Intergenic
1197155077 X:123261828-123261850 ACAGCTAATGCATTGTAGGGGGG - Intronic
1197931129 X:131697472-131697494 AAAGCTTTTACATTGTTGGTGGG - Intergenic
1199378148 X:147136799-147136821 AAAGCTTTTACCCTGTTGGTGGG + Intergenic