ID: 975760509

View in Genome Browser
Species Human (GRCh38)
Location 4:77615045-77615067
Sequence TGTGATTCTCTTACACCAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975760509_975760512 -4 Left 975760509 4:77615045-77615067 CCAGTTGGTGTAAGAGAATCACA No data
Right 975760512 4:77615064-77615086 CACAGAATTGGAGATTTGGTTGG No data
975760509_975760513 15 Left 975760509 4:77615045-77615067 CCAGTTGGTGTAAGAGAATCACA No data
Right 975760513 4:77615083-77615105 TTGGTGTCAGTAAACACTTGAGG No data
975760509_975760511 -8 Left 975760509 4:77615045-77615067 CCAGTTGGTGTAAGAGAATCACA No data
Right 975760511 4:77615060-77615082 GAATCACAGAATTGGAGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975760509 Original CRISPR TGTGATTCTCTTACACCAAC TGG (reversed) Intergenic
No off target data available for this crispr