ID: 975766705

View in Genome Browser
Species Human (GRCh38)
Location 4:77676187-77676209
Sequence CCTAACCTGCACAGTCTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975766705_975766711 1 Left 975766705 4:77676187-77676209 CCCCCCAGACTGTGCAGGTTAGG No data
Right 975766711 4:77676211-77676233 TATGCATTTTTCCAAAATGATGG No data
975766705_975766713 24 Left 975766705 4:77676187-77676209 CCCCCCAGACTGTGCAGGTTAGG No data
Right 975766713 4:77676234-77676256 ATGATTTAACAGAAAAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975766705 Original CRISPR CCTAACCTGCACAGTCTGGG GGG (reversed) Intergenic
No off target data available for this crispr