ID: 975767497

View in Genome Browser
Species Human (GRCh38)
Location 4:77684279-77684301
Sequence AACAAGCTCAATGGTGTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975767497_975767504 21 Left 975767497 4:77684279-77684301 CCTTTGACACCATTGAGCTTGTT No data
Right 975767504 4:77684323-77684345 AAAATTTCAGGCAGTTCTCATGG No data
975767497_975767502 9 Left 975767497 4:77684279-77684301 CCTTTGACACCATTGAGCTTGTT No data
Right 975767502 4:77684311-77684333 CCATCCATGAATAAAATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975767497 Original CRISPR AACAAGCTCAATGGTGTCAA AGG (reversed) Intergenic
No off target data available for this crispr