ID: 975767498

View in Genome Browser
Species Human (GRCh38)
Location 4:77684288-77684310
Sequence GGAAGACTGAACAAGCTCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975767498_975767504 12 Left 975767498 4:77684288-77684310 CCATTGAGCTTGTTCAGTCTTCC No data
Right 975767504 4:77684323-77684345 AAAATTTCAGGCAGTTCTCATGG No data
975767498_975767502 0 Left 975767498 4:77684288-77684310 CCATTGAGCTTGTTCAGTCTTCC No data
Right 975767502 4:77684311-77684333 CCATCCATGAATAAAATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975767498 Original CRISPR GGAAGACTGAACAAGCTCAA TGG (reversed) Intergenic
No off target data available for this crispr