ID: 975767502

View in Genome Browser
Species Human (GRCh38)
Location 4:77684311-77684333
Sequence CCATCCATGAATAAAATTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975767498_975767502 0 Left 975767498 4:77684288-77684310 CCATTGAGCTTGTTCAGTCTTCC No data
Right 975767502 4:77684311-77684333 CCATCCATGAATAAAATTTCAGG No data
975767497_975767502 9 Left 975767497 4:77684279-77684301 CCTTTGACACCATTGAGCTTGTT No data
Right 975767502 4:77684311-77684333 CCATCCATGAATAAAATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975767502 Original CRISPR CCATCCATGAATAAAATTTC AGG Intergenic
No off target data available for this crispr