ID: 975768806

View in Genome Browser
Species Human (GRCh38)
Location 4:77698826-77698848
Sequence ATTCGATTTCTGGCATAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975768806_975768810 16 Left 975768806 4:77698826-77698848 CCCATTTATGCCAGAAATCGAAT No data
Right 975768810 4:77698865-77698887 TTATTCCATAAAGAAATTTCAGG No data
975768806_975768813 26 Left 975768806 4:77698826-77698848 CCCATTTATGCCAGAAATCGAAT No data
Right 975768813 4:77698875-77698897 AAGAAATTTCAGGTTAGGCTTGG No data
975768806_975768812 21 Left 975768806 4:77698826-77698848 CCCATTTATGCCAGAAATCGAAT No data
Right 975768812 4:77698870-77698892 CCATAAAGAAATTTCAGGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975768806 Original CRISPR ATTCGATTTCTGGCATAAAT GGG (reversed) Intergenic
No off target data available for this crispr