ID: 975771321

View in Genome Browser
Species Human (GRCh38)
Location 4:77726041-77726063
Sequence TTTAGATTCTTAAAATGTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 538
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 495}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975771321 Original CRISPR TTTAGATTCTTAAAATGTCT AGG (reversed) Intronic
902428196 1:16341668-16341690 TTGATATTCTTAAAAGTTCTGGG + Intronic
902722065 1:18310373-18310395 TTTAGACTATTAGAATGTCAGGG + Intronic
903505196 1:23829009-23829031 TTAATATTGTTAAAATGTCAGGG + Intronic
903751935 1:25628601-25628623 TTAAAATTTTTAAAATGGCTGGG - Intronic
904838657 1:33356011-33356033 TTTAGGTTCTTAAAGTATCCAGG + Intronic
904916911 1:33976899-33976921 TTTAGGTTCTTCAAGTGTCGTGG + Intronic
905941889 1:41869916-41869938 TTTATATTTTTATAATGTCAGGG - Intronic
906373825 1:45277703-45277725 ATTAGTTTCTTAAATTGTGTAGG - Intronic
906382872 1:45343904-45343926 TTTTAAGTCTGAAAATGTCTTGG + Exonic
906444477 1:45882922-45882944 TTTAATTTCTTAAATTCTCTTGG + Intronic
907741518 1:57170724-57170746 TTTTTATTCCTGAAATGTCTAGG + Intronic
907900972 1:58741155-58741177 CTTACTTTCTTAAAATTTCTGGG + Intergenic
908785802 1:67733594-67733616 TTGAAATTCTTAAAATTTATAGG + Intronic
908787083 1:67745728-67745750 TTTAGATTTTTACACTGACTTGG - Intronic
909497064 1:76290336-76290358 TTTAAAATCATAATATGTCTTGG + Intronic
910957494 1:92722724-92722746 TGTAGATTCTGAAAGTTTCTTGG - Intronic
911924580 1:103813169-103813191 TCTAGATTTTTAAAATCTTTTGG - Intergenic
913295321 1:117313661-117313683 TTTGGCCTCTTAAGATGTCTGGG - Intergenic
914226700 1:145725628-145725650 TTAAGAGTTTTAAAATGTCAAGG - Intronic
914339498 1:146747041-146747063 ATTAGTTGCTTAAAATGTCTAGG - Intergenic
914873719 1:151496912-151496934 TTTTGCTTCTTAAAATATATGGG - Intergenic
915008728 1:152664647-152664669 TTCTGACTCTTTAAATGTCTTGG + Exonic
915620089 1:157076411-157076433 TTAGGATTCTTATACTGTCTGGG + Intergenic
916841116 1:168601965-168601987 TTTTGCTTTTGAAAATGTCTGGG - Intergenic
917520714 1:175746354-175746376 TTTCTATTTATAAAATGTCTAGG - Intergenic
917610898 1:176688068-176688090 TTTAGATACTTAAACTTTATAGG + Intronic
917779476 1:178377149-178377171 TTTAGAAACTTAAAATGTTTAGG - Intronic
917786095 1:178458845-178458867 ATTAGATACTTAAAATCTGTAGG + Intronic
918363911 1:183786452-183786474 TTCAGATTTTTAAAATATTTTGG + Intronic
918623366 1:186630570-186630592 TTTATATTTTTAAAAAGTTTTGG - Intergenic
919430349 1:197484609-197484631 TTTAGATTCTAATAGTGTTTAGG + Intergenic
919504556 1:198383142-198383164 TTTGGATTCTTAAAATCCTTTGG + Intergenic
919997600 1:202767615-202767637 TTTAGATTTTTAAAAATTGTAGG - Intronic
920591080 1:207219451-207219473 TGAAGAATCTTAAAATGTCAAGG + Intergenic
920814344 1:209317286-209317308 TTTAGGTTCTTAAGAAGCCTTGG - Intergenic
921336668 1:214093639-214093661 TTTAGATTCTTTAGATTCCTTGG - Intergenic
921426571 1:215008899-215008921 TTTAGATGCTTTAGATGTGTAGG + Intronic
921919408 1:220649547-220649569 CTAAGATTATTAAAATGTTTAGG - Intronic
922954843 1:229590419-229590441 TTTACATGTTTAAAATGTCTTGG - Intergenic
924117895 1:240765756-240765778 TTAAAATTCTTAAAGTGTTTAGG - Intergenic
924728145 1:246689031-246689053 TTTAGATGCTTAAAATCACAGGG - Intergenic
1063000643 10:1917026-1917048 TTTACATCTTTAAAATGGCTTGG - Intergenic
1064136533 10:12755408-12755430 TTTACATTCTTAACCTGGCTTGG - Intronic
1064417888 10:15166805-15166827 TTTAGCTTCTTGAAAGGTGTCGG + Intronic
1065019293 10:21490111-21490133 TTAAGAATTTTAAAATTTCTGGG - Intergenic
1065299344 10:24307166-24307188 TTTAGATTTTTCAAAGTTCTTGG + Intronic
1066487112 10:35857229-35857251 TGTAACTTCATAAAATGTCTTGG + Intergenic
1066511852 10:36108457-36108479 TTAATTTTTTTAAAATGTCTTGG + Intergenic
1066571961 10:36783470-36783492 TTTAAATTCTTCAAATGTATTGG - Intergenic
1067308061 10:45084436-45084458 TGTAACTTCATAAAATGTCTTGG + Intergenic
1067838932 10:49660685-49660707 TTAAATTTATTAAAATGTCTAGG + Intronic
1068042702 10:51846104-51846126 TTTAGATGTTAAAGATGTCTAGG + Intronic
1068241214 10:54302941-54302963 TTTAAATTTTTAATATGTGTGGG - Intronic
1068337950 10:55661725-55661747 TTTAGCTTCTTGAAATGGATTGG + Intergenic
1068439698 10:57035781-57035803 TTTTTATTTTTAAAATGTTTAGG + Intergenic
1068714600 10:60174605-60174627 TTTAGATTTTTAAAAAATATTGG - Intronic
1068749698 10:60577739-60577761 TTAAGTTTTATAAAATGTCTTGG + Intronic
1068815094 10:61300670-61300692 TTTACATTTTTAAAATGCTTTGG - Intergenic
1070384270 10:75910392-75910414 TTTTAGTTCTAAAAATGTCTAGG + Intronic
1070505483 10:77109265-77109287 TATACATTTTTAAAATGTATAGG + Intronic
1070664197 10:78332031-78332053 TTTAGATTTTTAACATGCCATGG + Intergenic
1072260307 10:93663786-93663808 TTTGGATTCTTAAAATGCTTAGG + Intronic
1072352583 10:94572087-94572109 TTTATATTGTAAAAGTGTCTTGG + Intronic
1072491488 10:95910193-95910215 TCTAGTTTCTACAAATGTCTGGG + Intronic
1073519845 10:104117843-104117865 GTTAGATTCTTAAAAGGTAATGG - Intergenic
1073645821 10:105302600-105302622 TTTAGATTATTAAAATTTTTAGG + Intergenic
1073649695 10:105345087-105345109 ATTCAATTCCTAAAATGTCTGGG - Intergenic
1073696090 10:105869905-105869927 TTTAATTTCTGAAAATATCTAGG - Intergenic
1074251398 10:111753978-111754000 TTTATTTTCTTATAATTTCTTGG + Intergenic
1074260020 10:111844004-111844026 TTTAGATTCATAAACTGAGTTGG + Intergenic
1074946272 10:118283805-118283827 ATTAGATACTTTAAACGTCTAGG + Intergenic
1078521588 11:12068202-12068224 TTGAGATTCTTAGTAAGTCTTGG + Intergenic
1080926530 11:36762777-36762799 ATTATAGTCTTAGAATGTCTTGG + Intergenic
1080995726 11:37598392-37598414 ATTTCATTCTTAAAATGTCTAGG + Intergenic
1080999691 11:37653642-37653664 TTTAGATTGTTTTTATGTCTTGG - Intergenic
1081306151 11:41514643-41514665 TTTAGATTATATAAATGTTTGGG - Intergenic
1082276538 11:50228232-50228254 TTTTGATTCTCAAACTGTCTGGG - Intergenic
1084132014 11:67143389-67143411 TTCAGTTTCTGAAAATTTCTTGG + Intronic
1084526601 11:69702268-69702290 TTTAGAGTCTCAAAATTGCTCGG - Intronic
1085730964 11:78998355-78998377 TTTTGATTCTAACAACGTCTAGG - Intronic
1086095566 11:83046948-83046970 ATTAGAATGTTAAAATGTCAGGG - Intronic
1087602807 11:100338231-100338253 TTAAGGTTCTTAATATGTCGTGG + Intronic
1089920090 11:122201410-122201432 CTTAGTTCCTTGAAATGTCTTGG - Intergenic
1090999971 11:131902320-131902342 TTTATCTTCTTAAAATGTGTGGG + Intronic
1091346943 11:134861298-134861320 TTTAGGTTGTTTTAATGTCTTGG - Intergenic
1092799336 12:12148103-12148125 TTTACATTTTTAAAAGGTCATGG + Intronic
1093012133 12:14118530-14118552 CTTAAAATCTGAAAATGTCTTGG - Intergenic
1093098408 12:14998509-14998531 TTTACATTCATAAACTTTCTGGG - Intergenic
1093854846 12:24089115-24089137 TTTATCTTCTGAAAATGTATGGG - Intergenic
1094101875 12:26773288-26773310 TTTCTATTCTTAAATAGTCTTGG + Intronic
1095323814 12:40863115-40863137 TTTAAATTCATAAAATATCAAGG - Intronic
1095331023 12:40964349-40964371 TATAGAATTTTAAAATGTTTTGG + Intronic
1095914308 12:47460825-47460847 TTTTCATCCTCAAAATGTCTTGG - Intergenic
1097395423 12:59067442-59067464 GTTTAATGCTTAAAATGTCTCGG + Intergenic
1097535423 12:60863915-60863937 TAGAATTTCTTAAAATGTCTAGG - Intergenic
1097692904 12:62750215-62750237 TTCAGATTTTGAAAATGTCCTGG - Intronic
1098898295 12:76086687-76086709 TTTAGTTTCTTAGATTGGCTAGG - Intergenic
1099570280 12:84308819-84308841 TTTATATTCTTTAAGTTTCTTGG + Intergenic
1100296280 12:93265065-93265087 TTTAGTTACTTAAAAGGACTTGG - Intergenic
1100674483 12:96851117-96851139 TTTAGAATCTTGAACTCTCTGGG + Intronic
1101204499 12:102472197-102472219 TTTCATTTCATAAAATGTCTAGG + Intronic
1102064114 12:109958537-109958559 TTTAAAGTCTTAAAATGGCCTGG - Intronic
1102580912 12:113887025-113887047 TTTACATTTTTAAAATATTTTGG + Intronic
1102945626 12:116985430-116985452 TTTCTATTCTTAGAATCTCTGGG + Intronic
1104196579 12:126545368-126545390 AAAAGATTTTTAAAATGTCTAGG + Intergenic
1106536950 13:30654211-30654233 TTTAGCTTCTAAAAATGTGCAGG + Intronic
1107162003 13:37241231-37241253 TTTAGGTTGATTAAATGTCTTGG - Intergenic
1108492335 13:50994020-50994042 TTTACATTCAGAAAATCTCTGGG + Intergenic
1108650051 13:52469148-52469170 TTTAAATTTTTAAAATATGTAGG + Intronic
1108788756 13:53940623-53940645 TTTCCATTTATAAAATGTCTTGG - Intergenic
1109142952 13:58738393-58738415 TTTCTATTCTTAAAATTTCTTGG + Intergenic
1110830135 13:80021141-80021163 TTTTAATCCTTAAAATTTCTGGG - Intergenic
1111098475 13:83546818-83546840 TGTGGAGTCTTAAAATGTCAAGG - Intergenic
1111426757 13:88094731-88094753 TTTAGATTATAAAAATTTCTAGG - Intergenic
1111730711 13:92073092-92073114 TCTAGATTTTTAAAAGGTCATGG + Intronic
1112607062 13:100916870-100916892 TTTGGATGATGAAAATGTCTGGG + Intergenic
1112935917 13:104798175-104798197 TTTAACTTCTTATAATCTCTTGG + Intergenic
1114690543 14:24575966-24575988 GTTAGAGTATTTAAATGTCTTGG - Intronic
1114717950 14:24847953-24847975 TATAGATATTTCAAATGTCTGGG - Intronic
1114998784 14:28394616-28394638 TTTATTTTCTTATAATGTCTTGG + Intergenic
1115070079 14:29311299-29311321 TGTAGATTAGTAAAATCTCTGGG + Intergenic
1115969587 14:38930766-38930788 TTTAAATTTTTAAAACTTCTGGG - Intergenic
1116050646 14:39798729-39798751 TTTAAATTTTTAAAAATTCTAGG - Intergenic
1116535315 14:46020270-46020292 TTTTTATTTTTAAAATGTTTTGG + Intergenic
1116622117 14:47218861-47218883 TTTAGATATTCAAAATGTTTTGG - Intronic
1116823092 14:49644715-49644737 TATACATTTTTAAAATTTCTTGG + Intronic
1116826175 14:49675725-49675747 TTTAGATTTTTAAAATTGTTGGG - Intronic
1117150017 14:52876929-52876951 TCTAGATTCTAAAATGGTCTTGG + Intronic
1118542658 14:66845958-66845980 TTTAAATTCTTATAAGGTCTAGG - Intronic
1118628720 14:67683287-67683309 TTTTTTTTCTTAAAATCTCTAGG + Intronic
1120708959 14:87773403-87773425 TTCAGATTTTTGAAATGACTTGG - Intergenic
1122734473 14:103829076-103829098 TTTAGAATCCTACTATGTCTGGG - Intronic
1123738691 15:23212398-23212420 TTTTCATTTTTTAAATGTCTTGG + Intergenic
1123856737 15:24419986-24420008 TTTACTTTCTTGAAATGTTTTGG + Intergenic
1124293326 15:28476277-28476299 TTTTCATTTTTTAAATGTCTTGG - Intergenic
1124359145 15:29022051-29022073 TTTAGATTATTCACATATCTTGG + Intronic
1124599583 15:31121850-31121872 TTTTTTTTCTTATAATGTCTTGG - Intronic
1125133957 15:36319560-36319582 AATAGATTCTCAAAATGTGTAGG - Intergenic
1125980299 15:43995168-43995190 TCTAGATATTTAAAATGTGTGGG - Intronic
1126226679 15:46278875-46278897 TTTATATTGTTAAAATCCCTTGG + Intergenic
1126296522 15:47143190-47143212 TTTTTATTATTAATATGTCTTGG - Intergenic
1126569529 15:50135542-50135564 TTTAGATTTACAGAATGTCTAGG - Intronic
1126881061 15:53098513-53098535 TCTGGATTCTTAAAGTGGCTTGG + Intergenic
1126908699 15:53396149-53396171 TATAGATTGTTCAAATCTCTTGG + Intergenic
1126987070 15:54324334-54324356 TTTGGAGTCTCAAAATGTGTGGG - Intronic
1127039152 15:54954163-54954185 TTTATTTGGTTAAAATGTCTGGG - Intergenic
1128167055 15:65475071-65475093 TTTTAAATCTGAAAATGTCTTGG - Intronic
1128483956 15:68066593-68066615 TTCAGAGTCTTACAATTTCTAGG - Intronic
1130192007 15:81746156-81746178 TTTATATACTTAAAATTTTTAGG + Intergenic
1131857625 15:96615648-96615670 TTTATATTTTTAAAATTTCTTGG + Intergenic
1131893612 15:97001812-97001834 TTTAAATTCTTACAATCTCCTGG + Intergenic
1133917630 16:10123549-10123571 TTTATATTCATAGAATTTCTGGG + Intronic
1134167537 16:11942481-11942503 TTTCGGATGTTAAAATGTCTAGG - Intronic
1134493161 16:14711231-14711253 TTTTGGATGTTAAAATGTCTAGG + Intronic
1134498542 16:14750355-14750377 TTTTGGATGTTAAAATGTCTAGG + Intronic
1134525096 16:14936985-14937007 TTTCGGATGTTAAAATGTCTAGG + Intronic
1134547798 16:15123934-15123956 TTTCGGATGTTAAAATGTCTAGG - Intronic
1134582032 16:15378730-15378752 TTTCGGATGTTAAAATGTCTAGG - Intronic
1134712684 16:16335472-16335494 TTTCGGATGTTAAAATGTCTAGG + Intergenic
1134720548 16:16378787-16378809 TTTCGGATGTTAAAATGTCTAGG + Intergenic
1134946879 16:18333098-18333120 TTTCGGATGTTAAAATGTCTAGG - Intronic
1134954143 16:18373221-18373243 TTTCGGATGTTAAAATGTCTAGG - Intergenic
1135090354 16:19509442-19509464 AAGAGATTCTGAAAATGTCTAGG - Intronic
1135312968 16:21420133-21420155 TTTCGGATGTTAAAATGTCTAGG - Intronic
1135365892 16:21852413-21852435 TTTCGGATGTTAAAATGTCTAGG - Intronic
1135445923 16:22518749-22518771 TTTCGGATGTTAAAATGTCTAGG + Intronic
1136152124 16:28357864-28357886 TTTCGGATGTTAAAATGTCTAGG - Intronic
1136210956 16:28757418-28757440 TTTCGGATGTTAAAATGTCTAGG + Intronic
1136255678 16:29037376-29037398 TTTCGGATGTTAAAATGTCTAGG + Intergenic
1136309636 16:29398860-29398882 TTTCGGATGTTAAAATGTCTAGG - Intronic
1136323081 16:29500641-29500663 TTTCGGATGTTAAAATGTCTAGG - Intronic
1136437765 16:30240609-30240631 TTTCGGATGTTAAAATGTCTAGG - Intronic
1137473791 16:48789034-48789056 TTTACATTATTAGAATTTCTTGG + Intergenic
1137589369 16:49684373-49684395 TTTAGATTCTCAAATTGCCCTGG + Intronic
1138200874 16:55087466-55087488 GTGAGATTTTTAAAATGTCATGG - Intergenic
1138314567 16:56058317-56058339 TTTAGGTCCTTAACATATCTGGG - Intergenic
1139312446 16:66039270-66039292 TTCAAATTCTTTAAATGTCTTGG - Intergenic
1139730537 16:68940954-68940976 TTTATAGTCTTAAAGTTTCTGGG + Intronic
1139994785 16:70970367-70970389 ATTAGTTGCTTAAAATGTCTAGG + Intronic
1140569267 16:76084249-76084271 TCTACATTTTTAAAAGGTCTAGG + Intergenic
1141380589 16:83573132-83573154 TTTTTATTCTTTAAATTTCTTGG - Intronic
1143685396 17:8510309-8510331 TTTTGATTCTCAAAATGCCAAGG + Intronic
1144319706 17:14102455-14102477 ATTAGATGCTTCAAATGACTAGG + Intronic
1145376355 17:22352343-22352365 TTGAGATTCTTTAATTGTATGGG - Intergenic
1146128782 17:30251793-30251815 TTTACATTCTTAAAATTATTAGG + Intronic
1147437021 17:40422733-40422755 TTTAGATTGTTAAAAATTATAGG - Intergenic
1149700667 17:58652810-58652832 TTCAGACTCTGAAACTGTCTTGG + Intronic
1150486862 17:65550092-65550114 TTTAGGTACTTAAGATGTCTTGG - Intronic
1150496852 17:65614363-65614385 TTTAGGCTCATAAAATCTCTAGG - Intronic
1151272309 17:73006421-73006443 TTTACATTTTTAAAGGGTCTTGG + Intronic
1152065072 17:78107887-78107909 AATAGATGCATAAAATGTCTAGG - Exonic
1153128244 18:1822498-1822520 TTTGCATTCTTCAAATGTTTTGG - Intergenic
1153137779 18:1936726-1936748 TCCAAATTCTTATAATGTCTTGG - Intergenic
1153404659 18:4723475-4723497 ATTAACTTCTTAAAATGTCCTGG - Intergenic
1153557538 18:6331584-6331606 TTTCTATTATAAAAATGTCTAGG - Intronic
1153777166 18:8464342-8464364 TTTGCATTCTTAGAATTTCTTGG + Intergenic
1154015830 18:10616250-10616272 TTTAGAAGCTGAAAATGTTTTGG + Intergenic
1154118765 18:11634488-11634510 TTTCGGATGTTAAAATGTCTAGG - Intergenic
1154189681 18:12219392-12219414 TTTAGAAGCTGAAAATGTTTTGG - Intergenic
1154320046 18:13342192-13342214 TTTCTTTTCTTATAATGTCTTGG + Intronic
1155253467 18:23973100-23973122 TTTGAATTATAAAAATGTCTTGG - Intergenic
1155514191 18:26607551-26607573 TATAGTTTCTTATAATGCCTAGG + Intronic
1155709729 18:28861356-28861378 TTTAGAGTTTGAAAATGGCTGGG - Intergenic
1156774776 18:40773594-40773616 TTTAGATTGTTAAAAAGGCCAGG - Intergenic
1157675690 18:49567030-49567052 TGCAGATTCTAAAATTGTCTGGG + Intronic
1158123200 18:54073084-54073106 GTTTGATACTTGAAATGTCTCGG - Intergenic
1159099968 18:63947247-63947269 TTTAGACACTTAACATTTCTTGG + Intergenic
1159170998 18:64766629-64766651 TTTATATTCTTAGAATTTTTAGG + Intergenic
1159446664 18:68549309-68549331 TTCTTATTCTGAAAATGTCTGGG - Intergenic
1159533173 18:69681640-69681662 TTTAAATTCTTAAAATTTCCAGG + Intronic
1159569192 18:70092594-70092616 TTTATATGCTTGAAATGTGTTGG + Intronic
1162253057 19:9462954-9462976 TGTAGATTTTTAAAAGGTCAAGG - Intergenic
1164612670 19:29643445-29643467 CTTAAAATCTTAACATGTCTCGG + Intergenic
1164858483 19:31543758-31543780 TTTAGATTTATCACATGTCTGGG - Intergenic
1165654669 19:37522880-37522902 TTTATAATCATTAAATGTCTTGG + Intronic
1166155063 19:40904881-40904903 CTTAGATTCTCAGAATTTCTAGG - Intergenic
1168057568 19:53871683-53871705 TTTAGAGGCTGCAAATGTCTAGG + Intronic
1168477028 19:56683717-56683739 TCTTGATTCTTACAATGTCTTGG - Intergenic
925798979 2:7577907-7577929 ATTTGATTCTTTAAAGGTCTTGG + Intergenic
927289111 2:21387677-21387699 TTTACATTCCTAAAATCTCTAGG - Intergenic
929767771 2:44863160-44863182 TTTCCCTTCTTATAATGTCTTGG - Intergenic
930420601 2:51148966-51148988 TTTAGATTTTTACCATATCTAGG - Intergenic
932248489 2:70218821-70218843 TCTAGATTTTTAAAAAGTGTTGG + Intronic
933296478 2:80496834-80496856 TTTCAAGTCTTAAAATGTCCAGG - Intronic
933929226 2:87131392-87131414 GTTAGATTCTTTATATGCCTTGG + Intergenic
934000556 2:87707188-87707210 GTTAGATTCTTTATATGCCTTGG + Intergenic
935304840 2:101727556-101727578 TTTAGACTCTTAAAATTTTGGGG + Intronic
935327496 2:101950359-101950381 TTTAGATTCTAAAAATAAATGGG - Intergenic
935646785 2:105343499-105343521 TTTAGTTCCTTTAACTGTCTTGG + Intronic
936477858 2:112855922-112855944 TCAAGATCCTTAAAATCTCTTGG + Intergenic
936635747 2:114255286-114255308 CTTTGATTTTTAAAATATCTGGG + Intergenic
936783975 2:116070361-116070383 TTTAACTTTTTAAAATGTTTTGG + Intergenic
936946574 2:117936328-117936350 TTTAGATTTTTTAAATCTCATGG - Intronic
937171829 2:119879797-119879819 TTTACATTCTTGAAATCTCAAGG - Intronic
937725130 2:125155064-125155086 TTAGGATTTTTCAAATGTCTTGG + Intergenic
939240863 2:139558547-139558569 TTTAGGTTCTTTAGATGTCTGGG + Intergenic
939278719 2:140035541-140035563 TTTAGATTCTTAATATAAGTAGG + Intergenic
939354287 2:141081154-141081176 TGTTGATGCTTAAAATGTTTGGG + Intronic
939908996 2:147956525-147956547 CTTAGGTTCTTATAATGTCCAGG + Intronic
940413566 2:153394379-153394401 TTTAAATTCTTAGAATGCCAAGG - Intergenic
940506148 2:154555937-154555959 TTTATGTTCTAAAGATGTCTTGG + Intergenic
940698888 2:157017031-157017053 TTCAGATTTTAAAAATTTCTAGG - Intergenic
941261014 2:163297197-163297219 AATATTTTCTTAAAATGTCTTGG - Intergenic
941317023 2:164006052-164006074 TTGAGGTACTTAAAATCTCTTGG - Intergenic
941357081 2:164507001-164507023 TTGAGGTGATTAAAATGTCTTGG + Intronic
941779534 2:169429054-169429076 TTGGGATTCTGAAAATGTTTTGG + Intergenic
942560663 2:177214971-177214993 TTTTGATTCTGGAATTGTCTTGG + Intronic
942939052 2:181595278-181595300 TTGAGATTTCTCAAATGTCTTGG - Intronic
943101300 2:183490168-183490190 TTGGGATCCTTCAAATGTCTTGG + Intergenic
943527409 2:189034286-189034308 TTTACATTATAAAAGTGTCTGGG - Intronic
944464987 2:199992084-199992106 TGTGGATTCTTGAGATGTCTGGG - Intronic
946269172 2:218575705-218575727 ATTTGATTCTTAAAGGGTCTGGG + Intronic
946498478 2:220220121-220220143 TTTATATACTTAGAAGGTCTGGG - Intergenic
946693706 2:222331316-222331338 TTTGAATTCTTATAATGTTTTGG - Intergenic
948374295 2:237511135-237511157 TTAATATTCCTAAAATGCCTGGG - Intronic
1169904837 20:10592167-10592189 TTTGGAATCTCTAAATGTCTTGG + Intronic
1170174646 20:13455000-13455022 TTTACATTCTACACATGTCTAGG + Intronic
1170376474 20:15705972-15705994 TTTATGTTTTTAAAATGACTTGG - Intronic
1170687915 20:18586130-18586152 TTTACATTCTTAAAAATTATTGG - Intronic
1170765307 20:19284901-19284923 TTTCTATTCTTGAAATTTCTTGG - Intronic
1171067141 20:22028483-22028505 TTTAGTTTTTCAAAATGTTTTGG + Intergenic
1173106259 20:40137820-40137842 TTTAACTTTTTAAAATCTCTAGG - Intergenic
1173426858 20:42950651-42950673 AGTAGATTTTTATAATGTCTAGG - Intronic
1173672255 20:44806905-44806927 TTAATATTTTTAAAATGCCTGGG + Intronic
1174499263 20:50972381-50972403 TTTAAATTTTTATAATTTCTTGG + Intergenic
1175007392 20:55699748-55699770 TATATATTCTTAAAATGTAAGGG - Intergenic
1176948126 21:15009008-15009030 TTTATATTCTTAAATTATCAAGG - Intronic
1177538179 21:22456991-22457013 CTGAGATTCTCAGAATGTCTTGG - Intergenic
1177538374 21:22459431-22459453 CTGAGATTCTCAGAATGTCTTGG + Intergenic
1177576959 21:22970342-22970364 GTAAGATTCTTGAAATGTTTTGG - Intergenic
1177759857 21:25391276-25391298 TTTACATTTTTTAACTGTCTTGG + Intergenic
1178105807 21:29317954-29317976 TTTACAATCTTACACTGTCTGGG - Intronic
1178331074 21:31691936-31691958 TTTATAATATTAAAATGTTTTGG - Intronic
1179222653 21:39422937-39422959 TTTGGAATCTTAAACTGTCTGGG + Intronic
1180939741 22:19651600-19651622 TTTAAATTCTTAAAAGATATTGG - Intergenic
1181232356 22:21428958-21428980 TTTACATTCTTAAATAGTCAGGG - Intronic
1181246295 22:21505899-21505921 TTTACATTCTTAAATAGTCAGGG + Intergenic
1182507470 22:30794649-30794671 GTTAGCTTCTTAAATTGTCTGGG - Intronic
1184102924 22:42350810-42350832 TGGAGATTATTAAAATGTTTTGG + Intergenic
949194538 3:1289500-1289522 TATACATTCATAAAACGTCTGGG - Intronic
949223708 3:1667999-1668021 TTTAGGTTCTAAAAATATGTGGG + Intergenic
949372017 3:3345402-3345424 TTTAGATTGTTAGAATGGATGGG + Intergenic
949419708 3:3852969-3852991 TTTATATTATTAAACTATCTTGG + Intronic
949432990 3:3998652-3998674 TTCAGATTCTTGTAATGTCAGGG + Intronic
949603419 3:5627328-5627350 TTCATATTATTAAAATGTGTAGG - Intergenic
949794402 3:7831725-7831747 TTTAGTGTCTCAAAATTTCTAGG - Intergenic
951050428 3:18087494-18087516 TTTAGATTTTTAAGATTTTTAGG + Intronic
951907384 3:27718704-27718726 TAGAGATTCTTGAGATGTCTGGG + Intronic
952633023 3:35492918-35492940 TTTAGCTTTTTAAAAAGACTAGG - Intergenic
952876949 3:37954069-37954091 TTTTCTTTCTAAAAATGTCTCGG - Intronic
952944283 3:38467036-38467058 TAAAGATTCTTACAATGTCCAGG + Intronic
955570982 3:60305607-60305629 TTAAGATCTTTAAACTGTCTAGG + Intronic
957257501 3:77857029-77857051 TTTAGATTGTTTACATATCTTGG - Intergenic
957618138 3:82559272-82559294 TTTATATTCTTCCAATGCCTAGG + Intergenic
957677358 3:83385201-83385223 TTTTCATTTTTAAAATGTCCTGG + Intergenic
957680142 3:83423361-83423383 TTTTAATTCGTAAAATTTCTTGG - Intergenic
957690784 3:83564303-83564325 ATTAGATTGTTAGAATTTCTAGG + Intergenic
958687355 3:97416296-97416318 TTTAGATTGCCAAAAAGTCTTGG - Intronic
959549010 3:107632416-107632438 TTTAGTTTTTGAAAGTGTCTAGG + Intronic
960716502 3:120580384-120580406 TGTACATTCTTAAAATATTTTGG - Intergenic
961741751 3:129037297-129037319 ATTAGCTTCTTAAAATGACCTGG - Intronic
962039672 3:131693255-131693277 TTTACATTCTTAAAAGTTATTGG + Intronic
962451827 3:135525595-135525617 TTTAGATTCTTAAAAATCATTGG + Intergenic
963440142 3:145330607-145330629 TTTATTTTCTGAAAATATCTTGG + Intergenic
963631746 3:147741127-147741149 TATAAATTGGTAAAATGTCTAGG - Intergenic
963914730 3:150848505-150848527 GAGAGATTCATAAAATGTCTGGG - Intergenic
963952037 3:151213338-151213360 TTTTGATTCTGGAAATGTCTAGG + Exonic
963961232 3:151311592-151311614 TTTAGGTTTTTAAAATGCTTAGG + Intronic
964068627 3:152605377-152605399 TTTAGTTTCCCAAGATGTCTAGG + Intergenic
964115259 3:153130172-153130194 TTAAGTTTATTAAAGTGTCTTGG + Intergenic
964141006 3:153399202-153399224 TTTACATTTTGATAATGTCTTGG - Intergenic
964156413 3:153589962-153589984 TATAGAATGTTAAAATGTGTAGG + Intergenic
964849049 3:161074494-161074516 TTTAGTTTTTTAAAATATTTTGG - Exonic
965046777 3:163588263-163588285 TTTAGATTTTAAAATTGTATAGG - Intergenic
965067941 3:163876338-163876360 TTTAGATTTTTAAAATATACTGG + Intergenic
965211283 3:165792358-165792380 TTTTTATTCTTAAATTGTTTCGG - Intronic
965512712 3:169586319-169586341 TTTAGATGCTTAAAATATAAAGG - Intronic
965514343 3:169604715-169604737 TTGAGTTTCTTAAGATGTTTTGG - Intronic
965641702 3:170835790-170835812 TATAGATTCTAAAAATATTTTGG - Intronic
965949564 3:174290427-174290449 TTTATATTTTTAATTTGTCTGGG - Intergenic
965957233 3:174385994-174386016 TTTGTATACTTAAAATGTATTGG + Intergenic
966017778 3:175164118-175164140 TGGACATTTTTAAAATGTCTTGG - Intronic
966673396 3:182556724-182556746 TTTCTTTTCTTATAATGTCTTGG + Intergenic
966782039 3:183592388-183592410 TTTAGATGTTTAAAATATTTTGG - Intergenic
967449288 3:189604824-189604846 ATTTGATTCTTTAAAAGTCTTGG + Intergenic
967454244 3:189664007-189664029 TTTAGATATTTAAAATGTTTTGG - Intronic
967903367 3:194480417-194480439 TTTAGATACTTTAAATTTCATGG + Intronic
969018882 4:4125248-4125270 TAAATATTTTTAAAATGTCTCGG + Intergenic
970516492 4:16836238-16836260 TTGAGATTCTTCAAATGTTGAGG - Intronic
971716348 4:30182270-30182292 TTGAGAGTCTTAAAATTGCTTGG + Intergenic
972028592 4:34420654-34420676 CTTAGATTTGTAAAATGTATTGG - Intergenic
974168294 4:58232139-58232161 TTTAGTGTCTTAAAATTTTTTGG + Intergenic
974283645 4:59834675-59834697 TTTAGATTCTTAATTTCTTTTGG - Intergenic
975420566 4:74158831-74158853 CTTAGATTCATTACATGTCTTGG + Intronic
975695248 4:77006380-77006402 TTTCAATTCTTAAAATTTCGTGG + Intronic
975771321 4:77726041-77726063 TTTAGATTCTTAAAATGTCTAGG - Intronic
975775241 4:77779384-77779406 TTTAGATTTTAAAAATATCTGGG - Intronic
976021257 4:80629974-80629996 TTGAAATTTTTAAAATGTTTAGG + Intronic
976420350 4:84835617-84835639 TTTACTTTCTAAAACTGTCTTGG + Intronic
976469228 4:85407910-85407932 CTTTGATTCTTAGAATTTCTGGG + Intergenic
976526400 4:86096168-86096190 TAGAGATTATTTAAATGTCTAGG + Intronic
976828455 4:89285578-89285600 TTTTAATTCTGAAAATGTGTTGG + Intronic
978034978 4:103981526-103981548 TTCAGATTCTTAAAATAGCTAGG + Intergenic
978191215 4:105914815-105914837 TTGAGATTCTTAACAGTTCTCGG - Intronic
978271063 4:106891790-106891812 TTTAGGTTTCTAAAATTTCTGGG - Intergenic
978549471 4:109909952-109909974 TTTAGTTTCTAAAAATGTAAAGG - Intergenic
978883309 4:113735016-113735038 TTTACTTTTTTAAAATGTCTTGG - Intronic
979081043 4:116342094-116342116 TATACATTCCTAAAATGTATTGG - Intergenic
979121363 4:116906036-116906058 TTAAGCTTCTTACAATGTGTTGG - Intergenic
979388177 4:120094796-120094818 TTTAGATTTTTTAAATATATGGG + Intergenic
980546235 4:134266761-134266783 TTTACAATGTTAAAATGTTTTGG - Intergenic
980802190 4:137766273-137766295 TGTGGTTTCTTAAAATCTCTTGG + Intergenic
980853564 4:138412420-138412442 TTTACAATCTTAAAATCTTTTGG + Intergenic
981100872 4:140828013-140828035 TTCAGATTCATGAAAGGTCTTGG + Intergenic
981394234 4:144228183-144228205 TTTACATATTTAAAATGTGTTGG - Intergenic
981533546 4:145776093-145776115 TTTAGATACTTACAATTCCTAGG - Intronic
982503021 4:156183047-156183069 TTTAACTTCTTAAAACGTTTCGG + Intergenic
982616796 4:157648060-157648082 TTTAAATAAATAAAATGTCTTGG - Intergenic
983075942 4:163327002-163327024 TTCATATTCTTATAATGTTTAGG - Intronic
983411555 4:167404613-167404635 TTTAGATTGTTAAATTGTGTAGG - Intergenic
984451257 4:179905822-179905844 TTTTGTTTCTTAAAATTCCTAGG + Intergenic
984530678 4:180912342-180912364 TTTATTTTCTTAAAAAGACTTGG + Intergenic
984602161 4:181740729-181740751 TTTAGTTTCAGAAAATATCTAGG + Intergenic
984959011 4:185076018-185076040 TTCAGATTTTTAAAAAGTTTTGG + Intergenic
986146893 5:5086659-5086681 TTTAGTTTCTTCCAATATCTGGG + Intergenic
986156166 5:5178387-5178409 TTTGGAAACTCAAAATGTCTAGG - Intronic
986377788 5:7150208-7150230 TTTGGATTTTTCAAATGTTTAGG - Intergenic
986433996 5:7709998-7710020 TTTAGATTTTAAAACTATCTGGG + Intronic
986616445 5:9622300-9622322 TTTGGATTCTAAAAGTATCTGGG + Intergenic
987541748 5:19264182-19264204 CTTAGATTCTCAAAATGATTTGG - Intergenic
988377166 5:30451714-30451736 TTTTTATCCTTAAAATATCTAGG - Intergenic
988820967 5:34885177-34885199 TTGACATTTTTAAAAGGTCTAGG - Intronic
989266151 5:39476353-39476375 TCTAGATTGGTGAAATGTCTGGG - Intergenic
989335052 5:40306107-40306129 TTTTAAGTCTTAAAATGTCTGGG + Intergenic
989994783 5:50816523-50816545 TTTAGTTAATTAAAATGACTAGG - Intronic
990793878 5:59517944-59517966 TTTAGATATTTAAATTGTCAAGG - Intronic
991482545 5:67097299-67097321 TCTAAATTCTTAAAATGCATTGG + Intronic
992398895 5:76393616-76393638 TTTAGACTCTCAAAGTCTCTAGG + Intergenic
993143421 5:84063536-84063558 CTTTAATTCTTAAAATGTATTGG + Intronic
993287973 5:86024735-86024757 TATACATTCTAAAAATGTGTTGG + Intergenic
993297916 5:86167300-86167322 TTTACATTATTAAAATTTCAGGG - Intergenic
993584000 5:89700588-89700610 TGTATATTTTTAAAATGTATCGG - Intergenic
994491836 5:100457591-100457613 TTTAGCTTATCAAAATGTATTGG - Intergenic
994726180 5:103438445-103438467 TTTAATTTCTTAAAATTTGTTGG + Intergenic
995380311 5:111524379-111524401 TTTAGTATCTTAAAATCTTTAGG + Intergenic
995636456 5:114198065-114198087 TTTAGAATCTTAAAAAGTGGGGG - Intergenic
996995957 5:129696923-129696945 TTCAGATCCTTAAAATGTGCTGG + Intronic
997030915 5:130126767-130126789 CTTTTATTCTTAAAGTGTCTTGG - Intronic
997204458 5:132036263-132036285 TTTACACTCTTAAAGTGCCTGGG - Intergenic
998281733 5:140816001-140816023 TCTAAATTCTTAACATTTCTTGG + Intronic
998562442 5:143184039-143184061 TTTAGATTCTGAAAGTTTCATGG + Intronic
999390892 5:151188982-151189004 TTTAGATATTTTAAATGTCCAGG + Intronic
1000001199 5:157140835-157140857 TTAAAAGTTTTAAAATGTCTGGG - Intronic
1000030117 5:157394325-157394347 TTTATGTTCTTAAAATCTCAGGG - Intronic
1000585009 5:163086629-163086651 TTTACATTCTTTAAATGTAGGGG + Intergenic
1000853275 5:166367119-166367141 TTTATACTTTTAAAATGTCAAGG - Intergenic
1002117824 5:176978043-176978065 TTCATATTCTTATAGTGTCTTGG - Intronic
1004581032 6:16952399-16952421 TTTAGTTTTTTAAAATATATTGG - Intergenic
1005961896 6:30699776-30699798 TGTAGTTTTTTAAAATGTCTAGG - Intergenic
1006685814 6:35832595-35832617 GATAGATTCTTGAACTGTCTGGG - Intronic
1007051954 6:38840329-38840351 TTTAGAAATTTAAAATTTCTTGG - Intronic
1007502627 6:42310268-42310290 TTGAGCATCTTAAAATGTGTAGG - Intronic
1008762625 6:54871411-54871433 TCTAGAGTTTTAAAATGTATGGG + Intronic
1009050684 6:58272352-58272374 TTCACATTCTTAAGATTTCTAGG + Intergenic
1009239737 6:61170035-61170057 TTCACATTCTTAAGATTTCTAGG - Intergenic
1009295997 6:61948466-61948488 TTTTGATTCTTAAATTATCAGGG - Intronic
1009891058 6:69683300-69683322 TTTATAGTCATACAATGTCTAGG - Intronic
1010501876 6:76610882-76610904 TTTAAATTTTTAAAATTTTTAGG + Intergenic
1010561210 6:77353039-77353061 TTTAGATACTTGAAATCACTAGG + Intergenic
1010683454 6:78823276-78823298 TTTCAATTTTTAAAATTTCTCGG - Intergenic
1010685301 6:78847328-78847350 GTTATATTCTTTAAATGTCATGG - Intergenic
1011854003 6:91665739-91665761 TCTATATTTTTAAAATGTCTTGG - Intergenic
1012297318 6:97541137-97541159 TTTAGAATCTTTAAAAGGCTTGG - Intergenic
1013264884 6:108486482-108486504 TTTTGTTTTTTAAAATGGCTTGG + Intronic
1013867660 6:114718455-114718477 CTTAAATTCTTAAGATGTTTTGG + Intergenic
1013974591 6:116062545-116062567 TTTAGATTTTTGAATTGTCGGGG + Intergenic
1014030604 6:116698168-116698190 TTGAGAATCATAAAATATCTAGG - Intronic
1014904785 6:127012586-127012608 TTTATATTCTTAATATGTGAGGG + Intergenic
1015344288 6:132137437-132137459 TTTAGATTGATTACATGTCTTGG - Intergenic
1016240818 6:141927735-141927757 TGTACATTCTTAAAATATTTTGG - Intergenic
1016399495 6:143663698-143663720 TTCAGTTTCTAAAAATGTGTGGG + Intronic
1016643211 6:146374630-146374652 TCTAGATTTTTAAAATTTATTGG + Intronic
1017436047 6:154416772-154416794 TTTATATTCTGAAAATATCCTGG + Intronic
1017788549 6:157775628-157775650 TTTACTTTCAGAAAATGTCTTGG - Intronic
1017897659 6:158694702-158694724 TTGAGATACAAAAAATGTCTAGG - Intronic
1018723708 6:166594170-166594192 GTAAAATTCTGAAAATGTCTTGG + Intronic
1020436655 7:8170483-8170505 ATTGGATTTTTAAATTGTCTTGG + Intronic
1020869946 7:13615660-13615682 TTTAGATTCTGCAAATAACTGGG - Intergenic
1020918939 7:14236851-14236873 GTTAAATTCTGAAAATGTTTAGG - Intronic
1020945296 7:14597885-14597907 ATTAGAATATTAAAATTTCTTGG + Intronic
1021032680 7:15757452-15757474 TTAAGAGTCTTAAAATGTGGTGG - Intergenic
1021076518 7:16311015-16311037 TTTAAAGTCTTAAAAAGTGTAGG - Intronic
1021203195 7:17749721-17749743 GTAAGATTCTGAAACTGTCTGGG - Intergenic
1021566595 7:22022731-22022753 TTTGGATTCTCATAACGTCTGGG + Intergenic
1021935541 7:25627485-25627507 ATTTCATTCTTAAAATGTCTTGG - Intergenic
1022976290 7:35559467-35559489 CTTAGATTTTTGAAATGTTTAGG - Intergenic
1023335286 7:39162784-39162806 TTTTATTTATTAAAATGTCTGGG - Intronic
1026414848 7:70168716-70168738 ATTAGAGTCTTTAAAAGTCTTGG + Intronic
1026462000 7:70622500-70622522 TTTTGATTCTAAGAAAGTCTGGG - Intronic
1027557705 7:79686820-79686842 TCTAGATACTGAAAATGTCGGGG - Intergenic
1027787030 7:82592850-82592872 TTTAAATTCTTCTAAAGTCTAGG + Intergenic
1027915500 7:84314165-84314187 ATCAGACTATTAAAATGTCTAGG - Intronic
1029375119 7:100172421-100172443 TTTAAATTTTAAAAAAGTCTGGG - Intronic
1030099733 7:105934841-105934863 TTGAGTTTCATAAAATGTGTTGG - Intronic
1030389632 7:108910539-108910561 TTTAAATATTTAAAATTTCTGGG + Intergenic
1030537806 7:110790813-110790835 CTTTGATTCTCAGAATGTCTGGG + Intronic
1030780099 7:113590051-113590073 TTTTGATTCTTTAAATGTTCAGG - Intergenic
1031071960 7:117171617-117171639 ATTAGAGTTTTAAAATATCTAGG - Intronic
1031391159 7:121216645-121216667 TTCAGAGTCTTAAGATTTCTGGG + Intronic
1031616310 7:123885488-123885510 TTTATATTCATAAAATATATTGG - Intergenic
1032270452 7:130399932-130399954 TTTAGATTCTTAAAATACTAGGG - Intronic
1032953705 7:136946413-136946435 TTTAGATTGTAAAAATGTTGAGG - Intronic
1032963137 7:137063759-137063781 CTTAGGTTCTTACAATATCTTGG - Intergenic
1033669353 7:143476338-143476360 TTTAGATTGTTTCCATGTCTTGG - Intergenic
1033926815 7:146471947-146471969 TTCAGATTCTTAAGAAATCTGGG - Intronic
1033956062 7:146850043-146850065 ACTAGAATGTTAAAATGTCTTGG + Intronic
1034001745 7:147421531-147421553 TTAATATTATTAAAATATCTAGG + Intronic
1035102315 7:156411069-156411091 TCTAGTTTCTTCACATGTCTAGG + Intergenic
1035826484 8:2649900-2649922 TTTAACTTGTGAAAATGTCTAGG + Intergenic
1036227884 8:6975235-6975257 TTCACATTTTTAAAAGGTCTTGG - Intergenic
1036230337 8:6994352-6994374 TTCACATTTTTAAAAGGTCTTGG - Intergenic
1036232789 8:7013455-7013477 TTCACATTTTTAAAAGGTCTTGG - Intronic
1037046086 8:14305395-14305417 TTGAGATTTTTGAAAAGTCTTGG - Intronic
1038171652 8:25140030-25140052 TTTTGATTGTTAATATGGCTTGG - Intergenic
1038891307 8:31727556-31727578 TTTCAATTCTTCAAATGTATAGG + Intronic
1039111248 8:34042740-34042762 ATTAAATTCTTAATATATCTGGG + Intergenic
1039517450 8:38145731-38145753 TTAAGGTTCTTAAACTTTCTGGG + Intronic
1042038209 8:64561607-64561629 TTTTGATTCTTTAAGTCTCTAGG - Intergenic
1043136625 8:76535279-76535301 GGTAGATTCTTAAAAGGTCTGGG + Intergenic
1043188015 8:77179776-77179798 TTTAGATTGTTACATGGTCTGGG + Intergenic
1043408587 8:79967366-79967388 ATTAGTCTCTTAACATGTCTGGG - Intronic
1045314488 8:101031265-101031287 GTTAGAATGTTAGAATGTCTCGG - Intergenic
1045512777 8:102825967-102825989 TTTAGTTTCCTAACCTGTCTTGG - Intergenic
1046056757 8:109087489-109087511 TTTAGAAGCTTAAAGTTTCTCGG - Exonic
1046832159 8:118758299-118758321 TTTTGATTCTTAAGACATCTTGG - Intergenic
1048896233 8:138994898-138994920 TTTTCATTCCTAAAAGGTCTGGG + Intergenic
1049989833 9:980277-980299 TTTAGATTCTTTAAAGGAATGGG + Intronic
1050246969 9:3700740-3700762 TTTAGATCCTTAGAAAGTATGGG + Intergenic
1050523091 9:6521973-6521995 TTTAGAAAGTTAAATTGTCTGGG + Intergenic
1051210335 9:14735361-14735383 TTTATCTTCTTAAAATGACTTGG + Exonic
1051740796 9:20249983-20250005 TTTACATTTATAAATTGTCTTGG + Intergenic
1051816184 9:21107874-21107896 TGGAGCCTCTTAAAATGTCTTGG - Intergenic
1052015697 9:23463293-23463315 TTAGGATTCTCAAAATATCTGGG - Intergenic
1052139885 9:24967617-24967639 TTTTGTATGTTAAAATGTCTAGG + Intergenic
1053441843 9:38123069-38123091 TTTAGATTCTTTCAACTTCTTGG + Intergenic
1054785434 9:69205616-69205638 TCTATATTCTTATTATGTCTAGG + Intronic
1054806318 9:69399078-69399100 ATTAGATTCATAAAATGAATTGG + Intergenic
1055291461 9:74786430-74786452 TATTGAGTTTTAAAATGTCTTGG - Intronic
1055837217 9:80457689-80457711 TTAAAATTCTTTATATGTCTTGG + Intergenic
1055993938 9:82137058-82137080 TTTATCTTGTTAAAATGTGTTGG - Intergenic
1056006831 9:82281445-82281467 TTTTGATTCTCAAAAAGTCTGGG - Intergenic
1056199973 9:84265982-84266004 TTTAGATACTTTATTTGTCTAGG + Intergenic
1056248809 9:84726979-84727001 TTTAGATCTTTTAAATGTTTGGG - Intronic
1057166459 9:92931022-92931044 TTAAGAATCTTAAAATGGCCAGG + Intergenic
1057282843 9:93725397-93725419 TTTAGTTAGTAAAAATGTCTTGG - Intergenic
1057987031 9:99727466-99727488 TTTCTACTCTTAATATGTCTTGG + Intergenic
1058304503 9:103421564-103421586 TTTTGAATCTTAAAATATATCGG + Intergenic
1058379228 9:104360279-104360301 TTAATATTGTTAAAATGTATAGG + Intergenic
1058502312 9:105633226-105633248 TTTATATATTTAAAATGTTTTGG + Intronic
1059162056 9:112043752-112043774 TCTAGCTTCTTAAAGTGTCAAGG - Intronic
1059221746 9:112628055-112628077 TTTATACTCTTAAAATGAGTGGG + Intronic
1059908417 9:119014830-119014852 TTGAGCTTCTTTACATGTCTAGG - Intergenic
1059966052 9:119615074-119615096 TTCACATTCTTAATGTGTCTTGG + Intergenic
1060120122 9:120981028-120981050 TTTAGATCCTAAGAATGCCTGGG + Intronic
1060608351 9:124938269-124938291 TTTCATTTCTGAAAATGTCTGGG - Intronic
1060712124 9:125877672-125877694 TTCAGATTCTGAAAATGTTATGG - Intronic
1060780844 9:126411351-126411373 TTTGGTTTCTTAAACTGTCTCGG + Intronic
1186916342 X:14226189-14226211 TCTAGATTCTTTAAATGTGCAGG - Intergenic
1187326007 X:18289158-18289180 TTGAGACTATTAAAATGTCTTGG - Intronic
1188637884 X:32458404-32458426 TTTAGATTGTTTCCATGTCTTGG + Intronic
1188742853 X:33808200-33808222 TTTAGATATTTAAAATGACTTGG + Intergenic
1189709215 X:43792020-43792042 TTGAGATTCTGAAAATGTCTTGG - Intronic
1190381358 X:49842265-49842287 CTTTCATGCTTAAAATGTCTTGG + Intergenic
1190901166 X:54674358-54674380 TTTACATTCTTAATATGCCCAGG + Intergenic
1191232133 X:58104283-58104305 TCTTTATTATTAAAATGTCTAGG - Intergenic
1191234849 X:58126064-58126086 TTTATATCATTAGAATGTCTGGG - Intergenic
1191244214 X:58213161-58213183 TTTCTATTCTTAGAATGCCTGGG - Intergenic
1191244469 X:58215001-58215023 TCTCTATGCTTAAAATGTCTGGG - Intergenic
1191245478 X:58225027-58225049 TTTTTATTATTAGAATGTCTGGG - Intergenic
1191833163 X:65436686-65436708 TTTTGATTTTTAAACTGTGTGGG + Intronic
1192306993 X:69971691-69971713 TTAAGATACTTATAATTTCTAGG + Intronic
1192531526 X:71891499-71891521 TTTAGATTATGAAAAAGTTTTGG + Intergenic
1192704944 X:73519404-73519426 TTTTTATTCTTTAAATGGCTAGG + Intergenic
1194853946 X:98905154-98905176 TTTAAACACTCAAAATGTCTGGG - Intergenic
1194931489 X:99893186-99893208 TTTAGATTCTTTCCATATCTTGG - Intergenic
1196221836 X:113120354-113120376 TTTAGGTTCTTAAAATAGCTTGG - Intergenic
1196420580 X:115516739-115516761 TTTAGTCTTTTAAAATGTATGGG - Intergenic
1196470746 X:116022929-116022951 TTTATATTCTTAAATTTTCGAGG - Intergenic
1196562742 X:117170004-117170026 TTTGGATTTTTAAAATTTCATGG - Intergenic
1197159894 X:123311171-123311193 TTTACCTTCTAAAAAAGTCTTGG - Intronic
1197267875 X:124395485-124395507 GTTAGATGCTTAAATTATCTGGG + Intronic
1197296170 X:124721705-124721727 ATTAAATTATTAAAATTTCTTGG - Intronic
1197541698 X:127771002-127771024 AATAGATTATTAAAATGACTTGG - Intergenic
1197734260 X:129839114-129839136 TTTTCATTCTTACATTGTCTAGG - Intronic
1198676080 X:139132354-139132376 TTTTGCTTTTTAAAATGTCTAGG + Intronic
1198918737 X:141701407-141701429 TTTAAATTTAAAAAATGTCTTGG - Intergenic
1199638509 X:149836552-149836574 TTTATTTTTTTAACATGTCTTGG - Intergenic
1200667733 Y:6048288-6048310 TTTAGAATCATAAAATATGTGGG - Intergenic