ID: 975787632

View in Genome Browser
Species Human (GRCh38)
Location 4:77908864-77908886
Sequence TCCTGTAGGCTGCTGGACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 209}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975787632 Original CRISPR TCCTGTAGGCTGCTGGACAC AGG Intronic
900430213 1:2597822-2597844 TCCTGTCCGCTGCTGACCACGGG + Intronic
900690206 1:3976325-3976347 TCCTGTCTGCTCCTGGAGACTGG - Intergenic
900951143 1:5858855-5858877 GCCTGTGGGCTGGAGGACACAGG - Intergenic
902259706 1:15215380-15215402 GCCTGTCGGGTGCTGGACATGGG - Exonic
902379082 1:16044219-16044241 CCCAGTCTGCTGCTGGACACAGG + Intronic
903086779 1:20868148-20868170 ACTTGTTGTCTGCTGGACACTGG + Intronic
903291378 1:22316289-22316311 TCCTGCAGGATGCTGGACAGTGG + Intergenic
904095558 1:27974403-27974425 TCCTGAAGGGAGCTGGAGACTGG - Exonic
904598826 1:31662749-31662771 TCCTGGTGACTGCTGGAAACAGG + Intronic
905873271 1:41416803-41416825 CCCTGAAGGCTGCAGGAGACAGG - Intergenic
906730233 1:48074599-48074621 TCCTGAGGGCTGCTGGAACCAGG - Intergenic
907577967 1:55545715-55545737 TCCAGTAGGCTGCTGATGACAGG + Intergenic
907662683 1:56407687-56407709 TCCTGTGGGCTGCTGCCCACAGG + Intergenic
910814317 1:91274159-91274181 TCCTGTAGGCATCAGGATACAGG + Intronic
910826251 1:91410770-91410792 TCCCTTAGGGTGCTGGGCACTGG - Intergenic
912727150 1:112068464-112068486 TCCTGTGGGCTGCCTGAGACAGG - Intergenic
913563920 1:120051753-120051775 TCCAGTAAGCTTCTGTACACTGG + Intronic
913634205 1:120741812-120741834 TCCAGTAAGCTTCTGTACACTGG - Intergenic
914224246 1:145707275-145707297 TCCTTGAGGGTGCTGGCCACCGG - Intronic
914284511 1:146211103-146211125 TCCAGTAAGCTTCTGTACACTGG + Intronic
914545542 1:148661842-148661864 TCCAGTAAGCTTCTGTACACTGG + Intronic
914621023 1:149408825-149408847 TCCAGTAAGCTTCTGTACACTGG - Intergenic
915093794 1:153444891-153444913 TCCTGCAGCTTACTGGACACGGG + Intergenic
916584403 1:166137927-166137949 CCCTGTAGGCAGCTGGTCTCAGG + Intronic
917971579 1:180211413-180211435 TCCTGTGGGCAGCGGGCCACTGG + Intergenic
920458371 1:206117596-206117618 TCCTGCCGGCTGCTGGGCGCTGG - Intronic
921262067 1:213393480-213393502 TCCTGCATGCTGCTGCTCACAGG + Intergenic
921741438 1:218690025-218690047 TCTTGTGGGCTGCTGGACTGAGG + Intergenic
1067474802 10:46557941-46557963 TACTGTTGGCTCCTGGGCACTGG - Intergenic
1068825671 10:61435885-61435907 TCCTGTAGGGTGGGGGACAGGGG + Intronic
1071600849 10:86958116-86958138 TCCTGGATGCCGCTGGACCCTGG - Intronic
1075116857 10:119634211-119634233 ATCTCTTGGCTGCTGGACACAGG - Intergenic
1075258757 10:120945277-120945299 TCCTGTTGGCTGCAGGGGACAGG - Intergenic
1076326128 10:129624357-129624379 TCCTGCAGCCTGTTGGACCCCGG + Intronic
1076427719 10:130379485-130379507 GCCTGCAGGCTGCGGGATACTGG + Intergenic
1076428838 10:130387678-130387700 GCCTGTAGGCATCTGTACACGGG + Intergenic
1076522526 10:131089992-131090014 TCTTGCAGGCTGCTGGGCTCAGG + Intergenic
1076591169 10:131584599-131584621 TCCTGTTGGAGGGTGGACACTGG - Intergenic
1076807972 10:132868913-132868935 GCCTGAAGGCTGCCGGAGACGGG + Intronic
1077181594 11:1219491-1219513 GCCTGGTGGCTGATGGACACTGG + Intergenic
1077192006 11:1259504-1259526 ACCTGCAGGCTGCTGGGGACAGG + Intronic
1077595154 11:3525607-3525629 CCTTGCAGGCTGCTGGACTCAGG - Intergenic
1077733059 11:4755703-4755725 ATCTGTAGGCTGCTAGAAACTGG + Intronic
1081462569 11:43285509-43285531 TCTTCTAGGCAGCTGGACTCGGG + Intergenic
1081539204 11:44017863-44017885 TCCTGGAAGCTACTGGGCACTGG + Intergenic
1081868917 11:46374515-46374537 TCCTGGGGCCTGGTGGACACAGG - Intronic
1081907846 11:46680555-46680577 TCCTGGAGGCTGCGGGAAAAAGG + Exonic
1083776749 11:64897820-64897842 TCAGGTAGGCTGCTGGACTGCGG - Exonic
1084821781 11:71696461-71696483 CCTTGCAGGCTGCTGGACTCAGG + Intergenic
1085007876 11:73111511-73111533 TCCTGTAGGCAACAGGTCACTGG + Intronic
1087252974 11:95924113-95924135 GCCTGTAGGCTGCTGGGCAGCGG + Exonic
1087472806 11:98599306-98599328 TCCTGTAGGCAACAGGACATTGG + Intergenic
1088759917 11:112919622-112919644 CCCTGTGGGCTGCTGGACTAAGG - Intergenic
1089087747 11:115837482-115837504 TCCTGGAGGCAGCTGAATACAGG - Intergenic
1089607232 11:119648529-119648551 TCCTGCTGGGTGCTGGACAGTGG - Intronic
1091237436 11:134031518-134031540 TCCTAAAGGCTGGTGGAAACAGG + Intergenic
1091287761 11:134417592-134417614 TTCTGAAGGCTGCTGCCCACAGG - Intergenic
1092421320 12:8334380-8334402 CCTTGCAGGCTGCTGGACTCAGG - Intergenic
1093647649 12:21606412-21606434 TCCTGTAGCCTGTGTGACACTGG - Intergenic
1096233273 12:49909451-49909473 TCCTGTAGGCAGTTGGCCAGAGG + Intergenic
1096528927 12:52231412-52231434 TCCTGTAGGGGGCTGGAGATGGG + Intergenic
1098475260 12:70893976-70893998 TCCTGTTTGCTACTGGCCACAGG + Intronic
1099601522 12:84745383-84745405 TCCTGGAGGATTCTGGACAGGGG + Intergenic
1101866648 12:108525157-108525179 GCCCGTATGCTGCTGGTCACAGG + Intronic
1104301343 12:127567875-127567897 ACCACTAGGCTGCTGGACAGAGG + Intergenic
1104326984 12:127808358-127808380 TCTTGTAGGCACCAGGACACAGG - Intergenic
1104725868 12:131075364-131075386 TCCTGGTGGCTGCAGGACACAGG + Intronic
1104944500 12:132409593-132409615 TCCTGCTGGGTCCTGGACACAGG + Intergenic
1105813561 13:24014092-24014114 TCCTGGAGGCTGGAGGCCACAGG + Intronic
1109428445 13:62199471-62199493 TTGTGTAGGCTGTTGGACATTGG - Intergenic
1111908220 13:94280511-94280533 TCCTGTGGAGTGCTGGAGACAGG - Intronic
1113743136 13:112724814-112724836 TCCTGAAGCATGCTGGGCACCGG + Intronic
1113952482 13:114079763-114079785 TCCTGTTCGCCTCTGGACACGGG + Intronic
1113967474 13:114162204-114162226 TCCTGGAGGTAGCTGGACGCAGG - Intergenic
1114905561 14:27121801-27121823 TTCTGCTGACTGCTGGACACTGG - Intergenic
1117517289 14:56514481-56514503 TCCTTTAGCCTCCTGGACAGTGG - Intronic
1117837765 14:59825392-59825414 TCCTGCAGGCTGAGGTACACAGG + Intronic
1120945198 14:89988180-89988202 ACCTGCGGGCTGCTGGACAGTGG - Intronic
1121323496 14:93006515-93006537 TCCTGTGGCCTGCAGGTCACAGG + Intronic
1121352389 14:93184348-93184370 TCTTGCAGGCTGCTGGACCTCGG - Exonic
1122319986 14:100849312-100849334 TCCTGGAGCCTTCTGCACACTGG - Intergenic
1122943716 14:104995315-104995337 TCCTTGAGGCTGCTGGGCAGGGG - Exonic
1124159198 15:27253604-27253626 TCCTCTGGGAAGCTGGACACAGG + Intronic
1124230041 15:27936669-27936691 TGCTGTGTGCTGCAGGACACAGG + Intronic
1128511078 15:68314198-68314220 TCCTGCTGCCTGCTGGACTCAGG + Intronic
1128929896 15:71694905-71694927 TCCTGTGGGCTGCTGCACTTAGG - Intronic
1131801621 15:96075123-96075145 TCCAGTAGGCAGTTGGATACAGG - Intergenic
1132548277 16:543607-543629 TCCTGTCTGCTGCTGCAAACAGG + Intronic
1133377025 16:5295561-5295583 CCTTGCAGGCTGCTGGACTCAGG + Intergenic
1135678782 16:24439510-24439532 TCCTGGAGGATGCTGCACTCAGG + Intergenic
1136043209 16:27596450-27596472 CCCTGTAGGCAGCTGGAGATGGG + Intronic
1137669769 16:50272262-50272284 CCCTGGAGGCCGCTGGACCCAGG + Intronic
1139228498 16:65256909-65256931 TCCTTTAAGATGCTGGATACAGG - Intergenic
1141750468 16:85954842-85954864 TTCTATTGTCTGCTGGACACCGG + Intergenic
1142292301 16:89198750-89198772 CCCTGCTGGCTGCTGGCCACAGG - Exonic
1143870445 17:9954311-9954333 TCCTGAAGGCAGCAGGACAGCGG + Intronic
1143999029 17:11035357-11035379 TCCTGTAGGCTAGTAGACAGTGG + Intergenic
1144732666 17:17537494-17537516 CCCTGCAGGCTGCTGGGCACGGG - Intronic
1145280032 17:21460566-21460588 TGCTGAAGGCTGGTGGACACTGG + Intergenic
1145397849 17:22509918-22509940 TGCTGAAGGCTGGTGGACATTGG - Intergenic
1148683349 17:49486999-49487021 GCCTGGAGGCTGGTGGGCACTGG - Intergenic
1150062985 17:62084792-62084814 TCCTGCATGATGCTGAACACTGG + Intergenic
1150535085 17:66029976-66029998 TCCAGTCAGCTGCTGGACACGGG + Exonic
1151967599 17:77439538-77439560 TCCTGCAAGCTGCTGGCCACAGG - Intronic
1152665551 17:81566842-81566864 TCCTGGGGGCTGCTGCCCACTGG + Intronic
1153239203 18:3015372-3015394 TAGTGTAAGCTGGTGGACACGGG - Intergenic
1156379727 18:36547086-36547108 CCCTGAAGGCGGCAGGACACAGG - Intronic
1157528844 18:48405661-48405683 CCCTGCAGGATGCTGCACACAGG + Intronic
1157528855 18:48405706-48405728 CCCTGCAGGATGCTGCACACAGG + Intronic
1157528867 18:48405751-48405773 CCCTGCAGGATGCTGCACACAGG + Intronic
1157528878 18:48405796-48405818 CCCTGCAGGATGCTGCACACAGG + Intronic
1157528889 18:48405841-48405863 CCCTGCAGGATGCTGCACACAGG + Intronic
1157528900 18:48405886-48405908 CCCTGTAGGATGCTGCACACAGG + Intronic
1157528912 18:48405931-48405953 CCCTGTAGGATGCCGCACACAGG + Intronic
1160479405 18:79224932-79224954 TCCTGGGAGCTGCTGGAGACAGG - Intronic
1161492871 19:4571857-4571879 TCCAGTAGGATGGGGGACACGGG - Intergenic
1165176191 19:33931629-33931651 TCCTGGAGGATGCTGGAAATGGG + Intergenic
1165275302 19:34745812-34745834 ACCTGTAGGCTTCTGGTCTCTGG - Intergenic
1165692585 19:37875101-37875123 ACCTGTAGGGTACTGGACATGGG + Intergenic
1168278300 19:55289230-55289252 TCCTAGAGGCTGGTGGAAACTGG + Intronic
925701857 2:6646875-6646897 TACTGGAGGATGCTAGACACTGG - Intergenic
925745676 2:7041711-7041733 TCCTGTGGGCCACTGGACACAGG - Exonic
926111313 2:10185939-10185961 AGCAGTAGGCTGCTGGACAGAGG + Intronic
926965949 2:18411101-18411123 TCCTCTAGGGTGCTGGGCAAAGG - Intergenic
929174305 2:38960828-38960850 AGCTGTAGGCTGCTGGGCCCTGG + Intronic
929221141 2:39466138-39466160 TCCTCGTGGCTGCTGGCCACAGG - Intergenic
931903942 2:66822080-66822102 CCCTGTACACTGCTGGCCACCGG + Intergenic
933864991 2:86508223-86508245 TCCTGCAGGCTGCCAGGCACAGG - Intronic
935354562 2:102187075-102187097 TCCTGCAGGCAGGTAGACACCGG + Exonic
937140357 2:119595027-119595049 TCCTGTGTGCTGCTGTACAGTGG + Intronic
939599676 2:144173615-144173637 TCCAGTAGGCTGGTGGGAACAGG + Intronic
942331624 2:174830712-174830734 TCCTGTCTGCTGCTGGCCAGTGG - Intronic
945465912 2:210170986-210171008 TCCTCTGGGCTGCTGGACTCTGG - Intronic
946450618 2:219775889-219775911 TCCTTTAGACTGCTAGACCCAGG + Intergenic
947286737 2:228525097-228525119 TCCTGTAGAATTCTAGACACTGG + Intergenic
948830443 2:240596028-240596050 ACCTGGGGGCTGCTGGACAGTGG - Intronic
1169212320 20:3773777-3773799 TCCTGTAGGGTTGTGAACACTGG + Intergenic
1172013669 20:31860979-31861001 TTCTGCAGGCTGCTGGCCCCTGG + Intronic
1172134855 20:32680052-32680074 TTCTGCAGGGGGCTGGACACTGG - Intergenic
1173549205 20:43920750-43920772 CCCTCTAGGCTGATGGTCACCGG - Intronic
1181508865 22:23379924-23379946 TCCCTGAGGCTGCTGGTCACAGG - Intergenic
1182511215 22:30821920-30821942 GCCTGTGGGCAGCTGGACAGTGG + Intronic
1183567415 22:38625542-38625564 TGCTGTGGGCTGCTGCACCCAGG - Intronic
1184455227 22:44606443-44606465 TTCTGGAGGCAGCTGGACACAGG - Intergenic
1184743455 22:46442510-46442532 TCCTGAAGGCTCCTGGACACCGG + Intronic
1184810021 22:46824914-46824936 TCAAGTGGGCAGCTGGACACAGG + Intronic
1185210974 22:49570299-49570321 TCCTGGTGGCTGCTGAAAACTGG + Intronic
953472218 3:43177192-43177214 TCCAGCAGGCTGGTGGACACTGG + Intergenic
954013731 3:47666637-47666659 ACATGTAGGCTGCAGGCCACAGG - Intronic
956520272 3:70096162-70096184 TCCTGCTGGCTGCTGGACAGAGG + Intergenic
957046711 3:75381263-75381285 TCCTCAATGCTGCTGGAGACAGG - Intergenic
957065278 3:75516953-75516975 CCTTGCAGGCTGCTGGACACAGG - Intergenic
957449893 3:80366286-80366308 TCCAGGAGGCTGTTGGGCACTGG + Intergenic
960355814 3:116652039-116652061 ACCTGTAGGCTCCTGGATTCAGG - Intronic
961465142 3:127076846-127076868 GCCTGGAGGCTGCTGGAGAATGG - Intergenic
961899002 3:130193590-130193612 CCTTGCAGGCTGCTGGACTCAGG - Intergenic
962078497 3:132111994-132112016 TCTTGTAGGCTACAGGACATTGG + Intronic
962365147 3:134773981-134774003 CCCTGTTGCCTGCTGGACACTGG - Intronic
963843926 3:150135518-150135540 TTCTGTAGCCTGCTGGACATAGG - Intergenic
965734099 3:171802855-171802877 TCATCTGGGCTGCTGGACCCTGG - Intronic
965762707 3:172096514-172096536 TCCTCTAGGGTCCTGGACTCTGG - Intronic
969009857 4:4053038-4053060 CCTTGCAGGCTGCTGGACTCAGG - Intergenic
969119406 4:4896886-4896908 CCTTGTAGGCTGCTGGACTGAGG + Intergenic
969232564 4:5841811-5841833 GCCTGGTGTCTGCTGGACACAGG - Intronic
969744374 4:9058220-9058242 CCTTGCAGGCTGCTGGACTCAGG + Intergenic
969803779 4:9590331-9590353 CCTTGCAGGCTGTTGGACACAGG + Intergenic
970102228 4:12537685-12537707 TTGTGTAGGCTGCTGAATACAGG + Intergenic
970231080 4:13911870-13911892 TGGTGTAGGGTGCTAGACACTGG - Intergenic
975787632 4:77908864-77908886 TCCTGTAGGCTGCTGGACACAGG + Intronic
984950530 4:185004512-185004534 TCCCGTCAGCTGCAGGACACGGG + Intergenic
985042909 4:185910165-185910187 TCCTTTATTCTGCAGGACACAGG - Intronic
985711436 5:1431815-1431837 CCCAGGAGGCTGCTGGACATGGG + Intronic
985763212 5:1762491-1762513 CCCTGTCGGAGGCTGGACACAGG + Intergenic
986728473 5:10617713-10617735 TCCTGTTGCCTCCTGGACCCGGG + Intronic
990540104 5:56764037-56764059 TCCTGTAAAGTGCTGGTCACAGG + Intergenic
993500479 5:88660919-88660941 CCTTGGAGGCTGCTGGACACCGG - Intergenic
994685144 5:102941462-102941484 TCCTGGAGGCTGCTGAAAGCTGG - Intronic
996431578 5:123385406-123385428 TACTGTAGGCAGTTGGACAAAGG - Intronic
998566874 5:143223591-143223613 TACTCTGGGCTGCTGAACACTGG + Exonic
1000448102 5:161349744-161349766 TCCTGCAGGCTGTTGGAAAAGGG - Intronic
1002001501 5:176198944-176198966 TCCTGTTTGCTTCAGGACACCGG + Intergenic
1002564235 5:180100931-180100953 TCCTGGATGCTGCTGGCCCCAGG - Exonic
1005870214 6:29969906-29969928 ACCAGTAGGCTCCTGGACACTGG - Intergenic
1006467052 6:34202096-34202118 TCCTGGACGCACCTGGACACAGG - Intergenic
1006621943 6:35371454-35371476 TCCAGCAGGCAGGTGGACACAGG - Intronic
1008981130 6:57485331-57485353 TCCTGTAAGCTGCTGCAACCTGG + Intronic
1010007358 6:71010498-71010520 TCCTGTGGCCTCCTGAACACGGG - Intergenic
1010489188 6:76453284-76453306 TGCTGAGGGCAGCTGGACACGGG - Intergenic
1011345141 6:86361213-86361235 TTCTGTAGGCAGTTGGACAGTGG + Intergenic
1015748750 6:136538884-136538906 TCCAGGAGGTTGCTGTACACTGG - Intronic
1016322695 6:142864243-142864265 TCCTGTAGGCTGCTGGTGATGGG - Intronic
1019036131 6:169061188-169061210 TCCTGTAGGCTTCTTGAGCCTGG + Intergenic
1019639944 7:2097917-2097939 TGCTGTAGGCTTCTGCACTCAGG + Intronic
1020055030 7:5111862-5111884 TCCGGTAGTTTGCTGGACATTGG + Intergenic
1020899848 7:13990741-13990763 TCCCGTCCGCTGTTGGACACTGG - Intronic
1021843466 7:24742086-24742108 TCCTGGAGGTGCCTGGACACAGG - Intronic
1023813021 7:43926809-43926831 ACCTGCAGGCTTCTGGACAGCGG + Intronic
1024103359 7:46056602-46056624 TCCAGAAGGCTCCTGGGCACAGG - Intergenic
1024161265 7:46678970-46678992 TTCTGGAAGCTTCTGGACACTGG + Intronic
1026012529 7:66647934-66647956 TCCTGCAGGCAACTGGACAGGGG - Intronic
1027237090 7:76304404-76304426 TGGTGTAGGTTGCTGGACACAGG + Intergenic
1028207502 7:88033812-88033834 GCCTGTGGGGTGGTGGACACAGG - Intronic
1030368573 7:108672682-108672704 TTCTGGGGGCTACTGGACACTGG + Intergenic
1030983480 7:116212474-116212496 TCCGGGAGGCTGCTGGAGACAGG + Intronic
1032592227 7:133202230-133202252 TTCTGTGGGCTGTAGGACACAGG - Intergenic
1034284478 7:149875466-149875488 TCCTGATGCCTCCTGGACACAGG - Intronic
1034828493 7:154288399-154288421 TCCTGGAGTCCTCTGGACACTGG - Intronic
1036251259 8:7164775-7164797 CCTTGCAGGCTGCTGGACTCAGG - Intergenic
1036366228 8:8122685-8122707 CCTTGCAGGCTGCTGGACTCAGG + Intergenic
1036407024 8:8464143-8464165 TCCTCTAGGCTGCAGGCCACTGG + Intergenic
1036884670 8:12542974-12542996 CCTTGCAGGCTGCTGGACTCAGG - Intergenic
1038168989 8:25111460-25111482 CCCAGTAGGCAGCTGGGCACGGG - Intergenic
1038443730 8:27588850-27588872 ACATGGAGGCTCCTGGACACAGG + Intergenic
1038466869 8:27772471-27772493 TCCTGGACCCTGCTGGACAGCGG - Intronic
1038881032 8:31611722-31611744 TCTTGTAGGCTACTGGACTGAGG - Intergenic
1039236720 8:35510042-35510064 GCCTCCAGGTTGCTGGACACTGG - Intronic
1041755983 8:61313592-61313614 TCCTGGAAGCTCCTGGAGACAGG + Intronic
1042739212 8:72024719-72024741 TCAAGTAGGCAGCTGGATACAGG + Intronic
1043253145 8:78101265-78101287 TCCTGTAGGATACAGGACAGTGG + Intergenic
1044424134 8:92031755-92031777 AACTTTAGGCTGCTGGGCACTGG - Intronic
1051349394 9:16184905-16184927 TCCTGCTGGCTGCTGGTCACTGG - Intergenic
1052832981 9:33230557-33230579 TCCTGATGGCTCCTGGACACAGG - Intronic
1052892413 9:33715511-33715533 TCATGTAGGCTGGAGGACAGTGG - Intergenic
1056062468 9:82897879-82897901 GCCTGTAGACAGCTGGATACTGG + Intergenic
1056956880 9:91089706-91089728 TCCTGCAGAGTGCTGGAGACAGG - Intergenic
1059326767 9:113508465-113508487 CCCAGGAGGCTGCTGGACACGGG - Intronic
1061441798 9:130609729-130609751 TCCTGTGTTCAGCTGGACACTGG + Intronic
1185705630 X:2264331-2264353 TCCCTGAGTCTGCTGGACACAGG - Intronic
1185705644 X:2264411-2264433 TCCCTGAGTCTGCTGGACACAGG - Intronic
1185705654 X:2264491-2264513 TCCCTGAGTCTGCTGGACACAGG - Intronic
1186227707 X:7419318-7419340 TCCAGTAGGCTGGAGGACAATGG + Intergenic
1188216094 X:27479186-27479208 TCTTGTTGGCTGCTGGCCAGAGG - Intergenic
1195929579 X:110061022-110061044 CTCTGTAGGCAGCTGGACAAGGG + Intronic
1197854834 X:130903255-130903277 TCCTATTGGCTACTGGTCACCGG + Exonic
1198256956 X:134932331-134932353 TCCTGGAGGGTGCTGCACCCAGG - Intergenic
1198682784 X:139200535-139200557 TCATGCTGGCTGCTGGACAATGG - Intronic
1200744298 Y:6890028-6890050 TCCTGTTGGCTGCAGGACTCAGG + Intergenic
1201569583 Y:15399728-15399750 CCCTCAAGGCTGCTGGTCACTGG - Intergenic