ID: 975788221

View in Genome Browser
Species Human (GRCh38)
Location 4:77917675-77917697
Sequence GTATTTTTCTTGAGGAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 706
Summary {0: 1, 1: 0, 2: 5, 3: 58, 4: 642}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975788221_975788224 15 Left 975788221 4:77917675-77917697 CCTTTTTTCCTCAAGAAAAATAC 0: 1
1: 0
2: 5
3: 58
4: 642
Right 975788224 4:77917713-77917735 TAGATATGTAAATAAAGTACAGG 0: 1
1: 0
2: 1
3: 38
4: 444
975788221_975788225 24 Left 975788221 4:77917675-77917697 CCTTTTTTCCTCAAGAAAAATAC 0: 1
1: 0
2: 5
3: 58
4: 642
Right 975788225 4:77917722-77917744 AAATAAAGTACAGGAAAATGTGG 0: 1
1: 0
2: 6
3: 98
4: 1109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975788221 Original CRISPR GTATTTTTCTTGAGGAAAAA AGG (reversed) Intronic
900352828 1:2244403-2244425 GTATTTTTCTAGTAGAAACATGG - Intronic
901984388 1:13062823-13062845 TTGTTTATTTTGAGGAAAAAAGG - Intronic
901997422 1:13163947-13163969 TTGTTTATTTTGAGGAAAAAAGG + Intergenic
902344376 1:15805238-15805260 GTTTTTTTCTTAATTAAAAAGGG + Intergenic
902429329 1:16351221-16351243 GTCTCTTTCTTGAGGAATGATGG - Intronic
903003946 1:20286152-20286174 GTATTTTTCTTATGGCAACAGGG + Intergenic
903559187 1:24215285-24215307 TTATTTTTTTAAAGGAAAAAGGG + Intergenic
903639002 1:24844855-24844877 GTTTTTTTCTGGAGGAGAATTGG + Intergenic
904438545 1:30515055-30515077 GTGTTTTTCTTGAGAAGAGAAGG - Intergenic
904731813 1:32598405-32598427 GTATTTTTTTTTAGTAAAGATGG + Intronic
906078935 1:43071022-43071044 ATGTTTGTCTTGAGGAATAAAGG + Intergenic
906820041 1:48919775-48919797 AAATGTTTCTTGAGGAAAAAGGG + Intronic
907978518 1:59457435-59457457 GTATTTTTCTTGTAGAAATGGGG - Intronic
908185259 1:61646457-61646479 GTTTTTTCCTTGAGAAAATATGG + Intergenic
908280508 1:62529858-62529880 GGATTTTTCTTTCCGAAAAAGGG - Intronic
908397042 1:63735164-63735186 GTATTTTTTTTGTGGAGACAGGG + Intergenic
909350471 1:74647072-74647094 GAATATTTCATGAGGCAAAAAGG + Intronic
909533941 1:76712711-76712733 TTATTTTTTTTTAGGAAACAAGG - Intergenic
909648181 1:77940271-77940293 GTATTTTCCTTGAGATACAATGG - Intronic
909659593 1:78067390-78067412 GCATCTTTTTTGAGGAAAACAGG - Intronic
909745049 1:79084819-79084841 GTCTTATTCTGGAGGGAAAAAGG - Intergenic
909839990 1:80308502-80308524 GTATCTTTCTTGAGAACAAAAGG + Intergenic
909930722 1:81496357-81496379 CTTTTTTTCTTTAGCAAAAAAGG + Intronic
910127481 1:83860414-83860436 CTATTTTACATGAGGAATAAAGG - Intergenic
910347908 1:86262375-86262397 GTATTTTTTTTTAGGAGAGATGG + Intergenic
910875383 1:91873455-91873477 GTATTTTTTTTTAGTAAAGATGG + Intronic
910998807 1:93139819-93139841 GTATTTGTTTTGAATAAAAATGG - Intergenic
911387339 1:97193783-97193805 GCATTTTTTTTGAGGAAGAAAGG - Intronic
911863409 1:102985286-102985308 GTATTTTACTGGATGAAATAAGG + Intronic
912437457 1:109671794-109671816 GTATTTTTTTTTAGTAAAGATGG - Intronic
912686838 1:111774694-111774716 GCATTTTTCTTGAGGCACACAGG + Intronic
913231653 1:116745080-116745102 GTACTTCTCTTAAGGGAAAAAGG - Intergenic
913358586 1:117952634-117952656 CTCTTATTCTTGAGGAAGAAAGG + Exonic
914046202 1:144095062-144095084 TTAGTTTTCTAGAGAAAAAAAGG - Intergenic
914131908 1:144865623-144865645 TTAGTTTTCTAGAGAAAAAAAGG + Intergenic
915027609 1:152846088-152846110 GTATTTTTCCTAGGGAAATATGG - Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
918424941 1:184399164-184399186 GTTTATTTGTTGAGGAAACAGGG + Intronic
918526274 1:185468107-185468129 GAATTATTCTTAAGTAAAAATGG + Intergenic
919131394 1:193455417-193455439 GGAGTTTTGTTGAGGAAAGAAGG + Intergenic
919445261 1:197696843-197696865 GTATGTTTCTTGAAGGAAAAGGG - Intronic
919550530 1:198980097-198980119 GTATTTTTTTTGTAGAGAAAGGG + Intergenic
919682892 1:200453768-200453790 GAATTTTTATAGAGGAAACATGG + Intergenic
920698211 1:208198000-208198022 GTCTTTTTCTTGATAGAAAATGG - Intronic
921246415 1:213246881-213246903 GTATTTTTCTTTAAGAGACAAGG - Intronic
921452169 1:215322133-215322155 GTATTTTTTGTGAGGACACATGG + Intergenic
921453101 1:215333494-215333516 CTATTTTTCTTGATGATAACAGG + Intergenic
921462335 1:215444277-215444299 GAAGTTGTCTGGAGGAAAAAAGG + Intergenic
922141170 1:222888453-222888475 GTATTTTTATTGGGTAAAAAGGG + Intronic
922886738 1:229026131-229026153 GCATTTTTCTTATGGAGAAAGGG - Intergenic
923164805 1:231349835-231349857 GAATTTTTTTTGTGGAAACAAGG - Intronic
923505874 1:234606957-234606979 ATATTTTTTTTGACGACAAAAGG - Exonic
923926901 1:238639574-238639596 GTATTTGACTAGAGGAAGAACGG + Intergenic
924372288 1:243363686-243363708 TTATTTTTCTTTATGAAAATGGG + Intronic
924386761 1:243506336-243506358 TTATTTTGCTTGAAGAGAAAAGG - Intronic
1063176989 10:3560212-3560234 GAATTTTTCTTTAGTAAAACTGG - Intergenic
1063674987 10:8132955-8132977 GTAGATAGCTTGAGGAAAAAAGG + Intergenic
1064639286 10:17398955-17398977 GTAGTTTTCCTGAGGGAGAAAGG + Intronic
1065176654 10:23082636-23082658 GTGGTTCCCTTGAGGAAAAAAGG + Intergenic
1065399157 10:25276729-25276751 GCATTTTTCTTGATTAAAAATGG - Intronic
1066444036 10:35465523-35465545 GTACTTTTCCTGAGGACAGAGGG - Intronic
1068423434 10:56824007-56824029 GTATTTTCCTTGAACAACAAAGG + Intergenic
1068593148 10:58871574-58871596 GTATTTTTTTTGTAGAAACAGGG - Intergenic
1068736451 10:60418476-60418498 CTATATTTCTTGAGGAAAAGTGG + Intronic
1068898380 10:62234350-62234372 GTATTTTTCTTGTAGAGATAGGG - Intronic
1068943107 10:62700897-62700919 CTATTTTTCTTCACGAAAATGGG + Intergenic
1070511206 10:77162554-77162576 GTCTTTATCTTGATGAAAACTGG - Intronic
1070916952 10:80161125-80161147 GTATTTATCCTGAGCAAAAGAGG - Intronic
1071236258 10:83653049-83653071 ATAATTTTCTTGAAGGAAAAAGG + Intergenic
1072173685 10:92893945-92893967 GTATTTTTCTTAAAGAAAGTTGG + Intronic
1072447420 10:95511709-95511731 GTAGTTTTCTAGAGGAGAGACGG + Intronic
1073407735 10:103312562-103312584 ATATAATTCTTGGGGAAAAAAGG - Intronic
1074040824 10:109786554-109786576 GCATTTTTCTTAGGGAAAACAGG + Intergenic
1074607440 10:114987740-114987762 GTATTTTTTTAGTGGAAACAGGG + Intergenic
1075300343 10:121316704-121316726 GAATTTTTCTGTAGGAAAAATGG + Intergenic
1075749844 10:124757707-124757729 GTTTTTTTTTTGAAGAAATAAGG - Intronic
1077613225 11:3657971-3657993 ATTTTTTTTCTGAGGAAAAAAGG + Intronic
1078376260 11:10795861-10795883 GTATTTTTCTAGAAGAAAATAGG + Intergenic
1078882042 11:15461329-15461351 GTATTTTTCTTTAGTAGAGATGG - Intergenic
1079307461 11:19336057-19336079 GTATTCTTCGTGGAGAAAAATGG - Intergenic
1079672018 11:23182871-23182893 ATATTTCTCTTGAGGACCAATGG + Intergenic
1079880191 11:25918097-25918119 GTATATGTCTTGACCAAAAATGG - Intergenic
1079994103 11:27277071-27277093 TTATTTGTTTTGGGGAAAAAAGG - Intergenic
1080181719 11:29433724-29433746 GTATTTTTTTTTAGTAAAGACGG - Intergenic
1080415843 11:32069186-32069208 GCATTTTTCTTAAAGATAAATGG + Intronic
1080568510 11:33534568-33534590 GTATTTTTTTTCTTGAAAAATGG + Intergenic
1081173325 11:39894305-39894327 TTATTTCTCTGGTGGAAAAAAGG - Intergenic
1081347749 11:42011131-42011153 GTTCTTTTATTGAGGAAAAAAGG - Intergenic
1081380134 11:42404607-42404629 TTATTTTTCTTTAGGAACAAGGG + Intergenic
1081720208 11:45283379-45283401 GGATGTTCCTTGAGGAAAGAAGG - Intronic
1082020415 11:47528240-47528262 GTATTTCTCTTGAGGAAATAAGG - Intronic
1082035043 11:47638571-47638593 GTGTTTTTCAAGAGGAAGAAAGG + Intronic
1082188123 11:49208907-49208929 ATAATATTCTTTAGGAAAAAGGG - Intergenic
1082256472 11:50038567-50038589 TGATCTTTCTTGAGAAAAAAAGG + Intergenic
1083111036 11:60407191-60407213 GTATTTTTTTTGTAGAAATAGGG + Intronic
1085008452 11:73116940-73116962 TGATTTTTTTTGGGGAAAAATGG - Intronic
1085087809 11:73683428-73683450 GTATTTTTTTTGTAGAAAAGAGG + Intronic
1085233793 11:74995410-74995432 GTATTTTTAGTGAGGAAAGAAGG + Intronic
1085974820 11:81639865-81639887 TTATTTGTCTTTAGTAAAAATGG + Intergenic
1086100588 11:83095200-83095222 GTTGTTTACTTGAGGCAAAATGG + Intergenic
1086138156 11:83463614-83463636 GTATTTTTTTTGTGGAGACAGGG - Intronic
1086267490 11:85018832-85018854 TTGTTTATTTTGAGGAAAAAAGG + Intronic
1086463218 11:87026393-87026415 TTGTTTATTTTGAGGAAAAAAGG - Intergenic
1086578546 11:88369272-88369294 ATATTTTTATTGAATAAAAATGG + Intergenic
1086665410 11:89475330-89475352 TTATTTTTCTTAAGAAAATAAGG + Intronic
1087089650 11:94255414-94255436 GTACTTTTCTGGAAGAAAAAAGG + Intergenic
1087257251 11:95969897-95969919 GTATTTTTTTTGTAGAAACAAGG + Intergenic
1087257395 11:95971672-95971694 GTATTTGTCTTGTGGAACAAGGG - Intergenic
1087491007 11:98827267-98827289 GTAATTCTTTTCAGGAAAAATGG + Intergenic
1087905561 11:103692897-103692919 GCTTTTTTATTGAAGAAAAATGG - Intergenic
1088806855 11:113360395-113360417 TTTTTTTTCTTATGGAAAAAAGG - Intronic
1089032999 11:115353139-115353161 GTGTTTTTGTTCAAGAAAAACGG + Intronic
1089170156 11:116506255-116506277 GTCTTTTCTTTGGGGAAAAATGG - Intergenic
1089488641 11:118867177-118867199 TGATTTTTCTTTAGTAAAAACGG + Intergenic
1090600327 11:128363258-128363280 GGATTTTGCTTGAGAAAAGATGG - Intergenic
1091211394 11:133864278-133864300 GTATTTTTCCAGAGGAATAGGGG - Intergenic
1091526918 12:1312000-1312022 ATCATGTTCTTGAGGAAAAATGG - Intronic
1091557877 12:1589213-1589235 GTATTTTTTTTGTAGAAACAGGG - Intronic
1092567262 12:9680507-9680529 GCATTGTTTTGGAGGAAAAAAGG - Intronic
1094163624 12:27419082-27419104 GTATTTCTATCTAGGAAAAAAGG + Intronic
1094448367 12:30558300-30558322 GTTTTTCTCTTGAAGAAAAGGGG - Intergenic
1094556635 12:31506815-31506837 GCCTTCTTCTTGTGGAAAAAGGG + Intronic
1094778891 12:33766587-33766609 GTAGTTTTGTTGAAGACAAATGG + Intergenic
1096149495 12:49299695-49299717 GTATTTTTTTTTAGTAGAAACGG - Intergenic
1096367098 12:51037299-51037321 GTCTTTTTCTTGAAGAGAATGGG - Intergenic
1096417111 12:51424100-51424122 TTCTTTTTCTTGAGGAGAGAGGG + Intronic
1097831114 12:64224704-64224726 TTTTTTTTCTTCAGGAAACAAGG - Intergenic
1098441906 12:70528099-70528121 GAATTTTGTTTGAGAAAAAAGGG + Intronic
1098869750 12:75803313-75803335 GTGTCTGTCTTGAGGAAGAAAGG + Intergenic
1100113741 12:91277311-91277333 GTATTTTCATGGAGGAGAAAGGG - Intergenic
1100144181 12:91657110-91657132 CCATGTTACTTGAGGAAAAACGG + Intergenic
1100735851 12:97530018-97530040 GTATTCGTCTTCATGAAAAAGGG + Intergenic
1101321313 12:103675655-103675677 TTATTTCTCATGAGGAAAATGGG - Intronic
1101325747 12:103714152-103714174 GTATTTTTTTTTAACAAAAATGG + Intronic
1101394235 12:104330115-104330137 GTATTTTTTTTTAGAGAAAATGG + Intronic
1101556622 12:105816239-105816261 GTATTTTTCTTAAGAAAATTTGG - Intergenic
1102760236 12:115378797-115378819 CTATTTCTCTTGGGGAGAAATGG + Intergenic
1103502761 12:121416502-121416524 GTATTTTTCTAGATGGAAAATGG - Intronic
1103821681 12:123703660-123703682 TTATTTTTCTCGAGGAGACAGGG + Intronic
1104526480 12:129528215-129528237 GTGTTTTTCTTAAGGATAATTGG - Intronic
1105631074 13:22168995-22169017 CAATTTTGCTTGAGGAGAAACGG + Intergenic
1105644307 13:22300873-22300895 GTAAATTTCTTAATGAAAAAAGG - Intergenic
1106920171 13:34554698-34554720 CTATTTTGATAGAGGAAAAATGG - Intergenic
1107342006 13:39417552-39417574 GAATTTTGCTTAAGGAAAATTGG - Intronic
1107347739 13:39480656-39480678 AAGTTTTTCTTGAGTAAAAAAGG - Intronic
1107932705 13:45319475-45319497 GTATTTTTCTTTAGTAGAGATGG - Intergenic
1108591280 13:51914967-51914989 GTATTTTCCTTAAGAAAAGAAGG + Intergenic
1108789652 13:53952256-53952278 ATGTATTTCTAGAGGAAAAATGG - Intergenic
1108874389 13:55026405-55026427 GTATTTTTCTTAATGACAGAAGG - Intergenic
1108905269 13:55462595-55462617 GTGTTATTCTTGAAGCAAAAGGG + Intergenic
1108944856 13:56009376-56009398 TTATTTTTCTTATGGACAAAGGG + Intergenic
1109495588 13:63167576-63167598 TTATTTCTTTTGAGAAAAAATGG + Intergenic
1109585421 13:64395881-64395903 ATAGATTCCTTGAGGAAAAAAGG - Intergenic
1109661063 13:65461444-65461466 TTTTTTTTTTTCAGGAAAAATGG - Intergenic
1109802431 13:67398163-67398185 GTTTTTTTCTCAAGGAAACATGG + Intergenic
1110129926 13:71994938-71994960 GCATTTTTCTAAAGGAAACAAGG + Intergenic
1110156208 13:72320048-72320070 GTATTTATGTTTAGGAAAAGGGG - Intergenic
1110159792 13:72361767-72361789 GTTTTTTTCTTAAGAAGAAAAGG - Intergenic
1110702662 13:78567093-78567115 GTATTTTGAATAAGGAAAAATGG + Intergenic
1110893819 13:80723988-80724010 TTATTTTTCCGGATGAAAAAAGG + Intergenic
1110923442 13:81119161-81119183 TTATTTTTCTTTATGTAAAAAGG - Intergenic
1110948571 13:81455834-81455856 TTATGATTCTGGAGGAAAAAAGG + Intergenic
1111199176 13:84911672-84911694 GCATTTATCTTGAGGGGAAATGG - Intergenic
1111265037 13:85799161-85799183 GAATTTTAATTGAGGGAAAAAGG - Exonic
1112068955 13:95826672-95826694 TTATGATTCTTGAGGAAAACTGG + Intronic
1112894793 13:104285840-104285862 GAATTTTTCTTTGGGACAAATGG + Intergenic
1112933795 13:104774528-104774550 GAAATTCTCTTGAGGAAAAAAGG - Intergenic
1113231406 13:108217343-108217365 GTATTTTTCTTCAGTAGAGACGG - Intronic
1113519595 13:110930264-110930286 GTATTTTTCCAGAAGCAAAAAGG + Intergenic
1113736614 13:112683405-112683427 GTTTTTTTCTGGAAGAAAACTGG + Exonic
1114066580 14:19064319-19064341 ATATTTTTCTAGAGCAAGAAGGG - Intergenic
1114095686 14:19335704-19335726 ATATTTTTCTAGAGCAAGAAGGG + Intergenic
1114221072 14:20697357-20697379 GCATTGTTCTTGGGGCAAAAAGG + Intronic
1114282864 14:21210582-21210604 TTGTTTATTTTGAGGAAAAAAGG + Exonic
1114707257 14:24739558-24739580 TTATTTTTCTATAGGATAAAAGG - Intergenic
1115152155 14:30297972-30297994 GAATATTTCTTGAGAATAAATGG - Intergenic
1115681064 14:35738642-35738664 ATATTTTGCTTCAGGAAAATGGG - Exonic
1115857842 14:37650184-37650206 ATCTTTTTCTTGAGGACGAAGGG + Intronic
1116047181 14:39758159-39758181 GCATTATTTTTGAGGAATAATGG + Intergenic
1116139438 14:40971848-40971870 GTATATTACATGAGGGAAAATGG - Intergenic
1116765196 14:49062012-49062034 CAATTTTTCTTGATGAAAGATGG + Intergenic
1117048731 14:51839410-51839432 GGAATTTCCTTGAGGACAAAGGG - Intronic
1117051818 14:51867801-51867823 GTTTTTTTATTGGGGAAAAAAGG - Intronic
1117400794 14:55356984-55357006 CTAGCTTTTTTGAGGAAAAACGG - Intronic
1117572548 14:57062241-57062263 GTTTTTTTCTTCTGGAAAATGGG + Intergenic
1117581386 14:57155027-57155049 TTATTATTATTGAGGAAAAAAGG - Intergenic
1117631667 14:57699634-57699656 GTAGTTTTCTTAAGGTAAGATGG - Intronic
1117710400 14:58522605-58522627 TTGTTTATTTTGAGGAAAAAAGG - Intronic
1117759459 14:59011770-59011792 GTATTTTTCTTTAGTAGAGATGG - Intergenic
1118233784 14:63980379-63980401 GTTTTCCTCTTGTGGAAAAAAGG - Intronic
1118246942 14:64120337-64120359 GTATTTGTTTTTAAGAAAAAAGG + Intronic
1118299265 14:64600952-64600974 GTAATTTTGTTGAGCTAAAAAGG + Intergenic
1118690340 14:68332712-68332734 GTTTTTTTCTTCAGGGAAAGAGG - Intronic
1119515663 14:75246318-75246340 GTAATTTCCTAGAGGAAAATGGG + Intronic
1119588813 14:75865073-75865095 TTATTTTTCTCCAGTAAAAATGG - Intronic
1120510522 14:85408231-85408253 ATGTTATTCTAGAGGAAAAATGG + Intergenic
1120657739 14:87215247-87215269 GGAATTTTGTTGAAGAAAAATGG - Intergenic
1120998884 14:90437227-90437249 GTATTTTTTTTTAGTAAAGACGG + Intergenic
1121031086 14:90659293-90659315 GTGTTTTTTTTTAGGAGAAAGGG + Intronic
1121072587 14:91037988-91038010 CTATTGTTCTGGAGGAAATAGGG + Intronic
1121458043 14:94051671-94051693 GGATTTTTATGGAGTAAAAAAGG - Intronic
1121590764 14:95106390-95106412 GTATTTTTATCAAGTAAAAATGG + Intronic
1121901870 14:97700199-97700221 GGATTTTCCTTCAGGATAAAGGG + Intergenic
1121912075 14:97800705-97800727 CTATTTTTCCTGAGGACAACTGG + Intergenic
1123192815 14:106587149-106587171 GTAATTTTATTGAGGTACAATGG + Intergenic
1123832182 15:24151416-24151438 TGATTTTTCTTTAGTAAAAATGG + Intergenic
1123838163 15:24217863-24217885 TGATTTTTCTTTAGTAAAAATGG - Intergenic
1123847716 15:24320158-24320180 TGATTTTTCTTTAGTAAAAACGG - Intergenic
1123866758 15:24527538-24527560 TGATTTTTCTTTAGTAAAAATGG - Intergenic
1124069312 15:26376808-26376830 GTTTTTTTCTTGAATAAACATGG - Intergenic
1125217131 15:37288000-37288022 GACTTTTTCTGGAGGCAAAAAGG - Intergenic
1127248856 15:57208555-57208577 GTATTTTTTTTGTAGAAACAGGG + Intronic
1128197208 15:65769327-65769349 TTATGTTTGTGGAGGAAAAAAGG - Intronic
1128405505 15:67333445-67333467 TAATTTTACATGAGGAAAAAAGG - Intronic
1128691194 15:69726109-69726131 TTGTTTTGCTTGAGCAAAAAGGG - Intergenic
1130294656 15:82636969-82636991 GTTTTTTTATTGATGAAGAATGG - Intronic
1130439346 15:83935666-83935688 TTATTTCTCATGAGGAAAAATGG - Intronic
1131798574 15:96046205-96046227 GTATTTTTTTTTAGTAAAGACGG - Intergenic
1133009338 16:2901784-2901806 GTATTTTTTTTTAGTAAAGACGG - Intergenic
1133289339 16:4708626-4708648 GTATTTAACTTAAGAAAAAAAGG + Intronic
1133521351 16:6560632-6560654 GGATTTTACTTGAGTAAAATAGG + Intronic
1133644398 16:7750290-7750312 GCTTTCTTGTTGAGGAAAAACGG - Intergenic
1133718270 16:8470054-8470076 GTATTTTTAGTGAGTATAAATGG + Intergenic
1135777091 16:25266330-25266352 AAATTTTTCTTTAGGAAAAATGG - Intergenic
1136024390 16:27460668-27460690 TTTTTTTTAATGAGGAAAAAAGG + Exonic
1136143511 16:28301998-28302020 GTATTTGTGTTGAGGACCAAGGG + Intronic
1137041832 16:35620348-35620370 TGTTTTTTCTTGAGGAAACATGG - Intergenic
1137759322 16:50927749-50927771 GTATTTTTTTTTAGTAGAAACGG + Intergenic
1138713467 16:58995414-58995436 GTATCTATCTAGAGGAAAAGAGG + Intergenic
1138777218 16:59737726-59737748 GTATTTTTCTTCAACATAAAGGG - Intronic
1138963132 16:62051329-62051351 GTATTTTTTTTTAGTAAAGACGG - Intergenic
1139841018 16:69880599-69880621 TTATATTACGTGAGGAAAAAAGG - Intronic
1140791581 16:78396989-78397011 ATATTTCTCATGATGAAAAAGGG - Intronic
1142404280 16:89878447-89878469 TTTTTTTTTTTTAGGAAAAATGG + Intronic
1142960900 17:3552055-3552077 GTATTTTTTTTTAGTAGAAATGG + Intronic
1143060875 17:4199895-4199917 GTATGTTTCTTAAGAAAACAAGG + Intronic
1143267424 17:5650353-5650375 GTATTTTTCTGGACTAGAAATGG - Intergenic
1144962761 17:19055252-19055274 GTATTTTTTTTTAGTAGAAATGG - Intergenic
1144972400 17:19119269-19119291 GTATTTTTTTTTAGTAGAAATGG + Intergenic
1145113027 17:20181972-20181994 GAATTTTTCATTAGGAAAAAAGG + Intronic
1145180100 17:20741850-20741872 GTATTTACCTGGAGAAAAAAAGG + Intergenic
1147843102 17:43386551-43386573 CGATTTTTCCTGGGGAAAAAAGG + Intergenic
1148802575 17:50240679-50240701 GTATTTTTTTTTAGTAGAAATGG + Intergenic
1149132637 17:53323657-53323679 GTTTGTATCTTGAGGAAATAGGG + Intergenic
1149186927 17:54009096-54009118 GTGTTTTTCTGGGGGAAAGAAGG - Intergenic
1149453823 17:56771116-56771138 TTGTATTTCTTGTGGAAAAATGG - Intergenic
1149545184 17:57498209-57498231 GTATTTTTCTTGCTGCAACAAGG + Intronic
1150102501 17:62436374-62436396 GTATTTTTCTTTAGTAGAGATGG - Intronic
1150587295 17:66530662-66530684 GCATGTTTCCTGAGGGAAAAGGG + Intronic
1152670989 17:81606130-81606152 GTAGTTTTCAAGAAGAAAAAAGG + Intronic
1203183735 17_KI270729v1_random:91708-91730 GTAATCTCCTTGTGGAAAAACGG - Intergenic
1153182770 18:2454405-2454427 GTATTTTCTTTGAAGATAAATGG + Intergenic
1154989932 18:21591079-21591101 GTATCTTATTTGGGGAAAAAAGG + Intronic
1155370915 18:25099494-25099516 ATATTTTTCTTCTGGAAATAAGG - Intronic
1155826192 18:30446351-30446373 TTATTGTTTTTGAGGATAAAGGG + Intergenic
1155826530 18:30450970-30450992 CTATTTTTCTTGGGGAAAATGGG + Intergenic
1156196516 18:34780048-34780070 GTCATTTTCTGAAGGAAAAAGGG + Intronic
1157371410 18:47115928-47115950 ATCTTTTTCTTCAGGAAAGATGG - Intronic
1157952097 18:52050674-52050696 GTATTTTTCTCAAGGAAATTTGG - Intergenic
1158066154 18:53411252-53411274 TTATTTTTCTGGGGGACAAATGG + Intronic
1158789345 18:60757835-60757857 CTAGTTGTCATGAGGAAAAAGGG + Intergenic
1158815661 18:61092961-61092983 TGATTTTTGTTGAGGAAAATAGG - Intergenic
1159667707 18:71183174-71183196 GGATTTTTCTTGGTTAAAAAGGG + Intergenic
1160308443 18:77764190-77764212 GTATTTTTCTGCAACAAAAAGGG - Intergenic
1160457549 18:79013813-79013835 ATATTTATCTTCAGCAAAAAGGG + Intergenic
1164715795 19:30389428-30389450 GCATGTATCTTGAGCAAAAAGGG - Intronic
1165986648 19:39775184-39775206 GTATTCTTCTCCAGGACAAAGGG + Intergenic
1166528724 19:43529560-43529582 GTATTTTTTTTGAGTAGAGACGG - Intronic
1167014395 19:46830974-46830996 GTATCTTTTTTCAGGAAGAAGGG - Intergenic
1167165401 19:47796127-47796149 GTATTTTTTTTAAGTAAAGACGG + Intergenic
1167325614 19:48823187-48823209 GTATTTTTGTTATGTAAAAAAGG + Intronic
1167747283 19:51359356-51359378 GTTTTTTTTTTTAAGAAAAAAGG - Intronic
1168081382 19:54012729-54012751 GTATGTTTCTGGAGGGAATATGG - Intergenic
1202685755 1_KI270712v1_random:48477-48499 TTAGTTTTCTAGAGAAAAAAAGG - Intergenic
925641001 2:5985787-5985809 TTATTTTCCTTGTGGACAAATGG - Intergenic
925792959 2:7511476-7511498 GTATTTTTCTCCAGCAAAAATGG + Intergenic
926056061 2:9774736-9774758 GTTTTCTCCTTCAGGAAAAATGG + Intergenic
926586432 2:14691014-14691036 GTATTTTTTTTAAATAAAAATGG - Intergenic
926915020 2:17882957-17882979 GTATTTTTCTTGTGGGCAAGAGG + Intronic
926960437 2:18352577-18352599 GGATTTTCCTTGAGGACTAATGG + Intronic
927137745 2:20109530-20109552 GTATTATTCTTAAAAAAAAAAGG - Intergenic
928588620 2:32789745-32789767 GTATTTTTTTTGTAGAGAAAGGG - Intronic
928624695 2:33127784-33127806 GTATTTTAGTTGAGTCAAAAGGG + Intronic
929160586 2:38828157-38828179 ATATTTTTCTTTAATAAAAAGGG + Intronic
929329137 2:40658504-40658526 GCAGTTTACTTGAGGAAAACAGG - Intergenic
929487095 2:42364369-42364391 GTAGTTTCCCTGAGGGAAAATGG + Intronic
930169756 2:48239119-48239141 GTATTTTCCATGAGAAAAAAGGG - Intergenic
930223640 2:48770065-48770087 GTATGTTTTTTGAGAAAAAAAGG + Intronic
930947285 2:57090715-57090737 TTGTCTTACTTGAGGAAAAATGG - Intergenic
931314636 2:61116880-61116902 GTATTTTTTTTTAGTAGAAATGG - Intronic
931472638 2:62554484-62554506 TTATATTTCTTGGGGAAAATGGG - Intergenic
931686530 2:64798809-64798831 GTACTTTTTTTGGGGAAAAAAGG + Intergenic
932015241 2:68019296-68019318 GTATTTTTTTTTAGTAAAGACGG + Intergenic
933209461 2:79550257-79550279 TTATTCTTTTTGAGGTAAAAGGG + Intronic
933733633 2:85477480-85477502 GTATTTTTTTTTAGTAGAAACGG - Intergenic
933914610 2:86976590-86976612 TTCTTGTTCTTCAGGAAAAACGG - Exonic
934008383 2:87793309-87793331 TTCTTGTTCTTCAGGAAAAACGG + Exonic
934245969 2:90306347-90306369 TTAGTTTTCTAGAGAAAAAAAGG + Intergenic
934262777 2:91490688-91490710 TTAGTTTTCTAGAGAAAAAAAGG - Intergenic
935317097 2:101845843-101845865 CCATTTTTCTGGGGGAAAAAAGG - Intronic
936393938 2:112104127-112104149 TTATTCTTCTAGAAGAAAAAAGG + Intronic
936652949 2:114450694-114450716 CTATTTCTCTTGAGGATAAGTGG + Intronic
937756336 2:125543199-125543221 GTAGTTTGCTTTAGGAAATAAGG - Intergenic
938198281 2:129352069-129352091 GTATTTTTATAGAGTTAAAAGGG - Intergenic
938483970 2:131684447-131684469 ATATTTTTCTAGAGTAAGAAGGG - Intergenic
938681499 2:133696387-133696409 CTGTTTTTCTCAAGGAAAAAGGG + Intergenic
938885484 2:135643583-135643605 GTATTTTTCTTTACTAAAATTGG - Intronic
939354359 2:141082014-141082036 ATATTTTTATTGAGACAAAAAGG - Intronic
939557013 2:143687164-143687186 CTATTTTTCTTAAAGAAAAGAGG + Intronic
939811036 2:146832503-146832525 GTATTTTTTTTGTAGAAACAGGG + Intergenic
939937186 2:148307497-148307519 GTGTTTTCACTGAGGAAAAAGGG - Intronic
940053599 2:149490157-149490179 TTTTTTTTTATGAGGAAAAATGG + Intergenic
940203261 2:151174764-151174786 GTAGTTTTCTTGAGAATAGAGGG - Intergenic
940377952 2:152978568-152978590 GTACTTCTAGTGAGGAAAAAAGG - Intergenic
940963879 2:159816285-159816307 ATAATTTTCTAGAGGAAAAGTGG + Intronic
941040391 2:160615257-160615279 GTATTTTTTTTGTGGAGACAGGG - Intergenic
941107016 2:161365517-161365539 ATATTTTTTTTTAGAAAAAAAGG - Intronic
941135371 2:161711011-161711033 GAAATTTACATGAGGAAAAAAGG - Intronic
941369458 2:164646237-164646259 GTAACTTTCTTGAGGAAAAAGGG + Intergenic
941643760 2:168017725-168017747 GTATTTTTCAAGAAAAAAAATGG - Intronic
941710636 2:168708918-168708940 GTATTATTTTTAATGAAAAATGG + Intronic
942059318 2:172213554-172213576 GTATTGTTCTCGGGGCAAAAGGG + Intergenic
942136761 2:172934029-172934051 TTAATTTACTCGAGGAAAAAGGG - Intronic
943332994 2:186582926-186582948 GTAGTTTTCTTGATGATACAAGG - Intergenic
943601371 2:189924839-189924861 TTGTTTATTTTGAGGAAAAAAGG - Intronic
943781991 2:191835026-191835048 GTATTTTTCTTAATAAATAAAGG - Exonic
943843587 2:192611558-192611580 ATATTTTTCTCAAAGAAAAAAGG - Intergenic
944000013 2:194822495-194822517 AGAGTTTTCTTTAGGAAAAAGGG - Intergenic
944398517 2:199298120-199298142 GTATTAATCTTAAGGATAAAGGG - Intronic
944691712 2:202164618-202164640 GTCTTTATCTTGAGAACAAATGG - Intronic
944750363 2:202703171-202703193 GTATTAATAGTGAGGAAAAAAGG - Intronic
944987336 2:205192511-205192533 TTATTTTGCTTGAGGATAGAGGG - Intronic
945024952 2:205611416-205611438 GTATTTTTCATTAAGCAAAAGGG - Intronic
945175027 2:207035450-207035472 TTATTTTTCTTGTAGAAACAAGG - Intergenic
945808991 2:214525160-214525182 GGATTTTTCCTGAAGAAAAATGG - Intronic
946579987 2:221118000-221118022 ATATTTTTATTGAAAAAAAAAGG + Intergenic
947287869 2:228537673-228537695 TGATTTTTCTTTAGTAAAAATGG + Intergenic
947379759 2:229533699-229533721 TCATTTTTTTTGAGGAGAAAGGG - Intronic
947763008 2:232617475-232617497 GTATTTTTTTTTAGTAAAGACGG - Intronic
947805184 2:232961666-232961688 GTATTTTTTTTTAGTAAAGACGG + Intronic
948406461 2:237723981-237724003 GGATTTTTCATTAGGTAAAATGG - Intronic
1169157426 20:3343649-3343671 GTTTCTTTCTTGGGGAAGAAGGG - Intronic
1169631297 20:7635318-7635340 GTATTTTTTTTGTAGAAAGAGGG + Intergenic
1169657554 20:7942081-7942103 GTATTTTTATTTAGTAAAGATGG + Intergenic
1169827819 20:9789307-9789329 GAATTTTTCTTGGGGACAGATGG + Intronic
1170087371 20:12549146-12549168 GTAATTTTCTTGTGGTAAAAAGG + Intergenic
1170138153 20:13098605-13098627 CTATTTTTCATGAGTACAAAGGG - Intronic
1170661105 20:18341189-18341211 GTATTTTTTTTTAGTAGAAATGG + Intergenic
1170814191 20:19698755-19698777 GTCTTTGTCTCGGGGAAAAAGGG + Intronic
1170890460 20:20371031-20371053 TTATTTTTTATTAGGAAAAAGGG + Intergenic
1170891224 20:20377490-20377512 GTATTTTTTTTAAGTAGAAATGG + Intergenic
1172287111 20:33748538-33748560 GTATTTTTCTTGTAGAGACAGGG + Intronic
1172536855 20:35680467-35680489 TTAATTTGGTTGAGGAAAAATGG - Intronic
1173036551 20:39417028-39417050 ATTTTTTTCTTTAAGAAAAATGG + Intergenic
1173452740 20:43179788-43179810 GTATTTTTCTCCAAGAAACAAGG + Intronic
1173702216 20:45082772-45082794 GTATATGTCTTGTGGTAAAAAGG - Intergenic
1175898072 20:62348429-62348451 GTATTTTTCTTTAGTAGAGATGG - Intronic
1177091416 21:16773751-16773773 TTATTTTTCTCTAGGAAATATGG + Intergenic
1177336136 21:19730855-19730877 GTATTTTTCTTTATAAAACACGG + Intergenic
1177424298 21:20902452-20902474 GTATTATTCTTGAAGAGTAAGGG - Intergenic
1178084414 21:29098479-29098501 TTAAATTTCTTGAGAAAAAAAGG + Intronic
1178628678 21:34240458-34240480 GTATTTTTTTTTAGTAAAGACGG + Intergenic
1178808729 21:35861391-35861413 GAATTTGTCCTGAGGAAAACAGG + Intronic
1178932140 21:36828501-36828523 CTATTCTTCTTTTGGAAAAAAGG - Intronic
1180485061 22:15786909-15786931 ATATTTTTCTAGAGCAAGAAGGG - Intergenic
1182168321 22:28199820-28199842 GTGTTACTCTGGAGGAAAAATGG + Intronic
1182194362 22:28499511-28499533 TTTTTTTTCCAGAGGAAAAAAGG - Intronic
1182201878 22:28580958-28580980 ATATTTTTCTTAAGGAAGAGAGG - Intronic
1182375704 22:29846161-29846183 GTATTTTTTTTGAAGAGACAGGG - Intergenic
1182678203 22:32056820-32056842 GTTTTCTCCTTGAGGAAACAAGG - Intronic
1182742171 22:32575856-32575878 TTTTTTGTCTTGAGGAAAGAAGG - Intronic
1183404187 22:37622251-37622273 GTATTTTTTTTGTGGAGAAGGGG + Intronic
1184166213 22:42729846-42729868 GTATTTTTTTTTAGGAGAGATGG + Intergenic
1184198740 22:42950445-42950467 GCATTTTGGTTGAGGAAAGAAGG + Intronic
1184304848 22:43590809-43590831 CTCTTTTTCTTGAGCAAAGATGG + Intronic
1184547155 22:45178566-45178588 GTAATTTTGTTGAGCCAAAAAGG - Exonic
1184937569 22:47736182-47736204 GTATTTTTATTGGGTACAAATGG - Intergenic
1203323079 22_KI270737v1_random:87756-87778 GTAATCTCCTTGTGGAAAAACGG + Intergenic
949660929 3:6277497-6277519 ATTTTTTTCCTGGGGAAAAATGG + Intergenic
949770731 3:7574463-7574485 GTCTTTTTCTTGTTGAAAAATGG + Intronic
950898283 3:16473575-16473597 GTATTTTTTTTTAGTAGAAACGG + Intronic
951338921 3:21459738-21459760 TTATGTTGCTTGATGAAAAATGG + Intronic
951586682 3:24222028-24222050 CTTTGTTTCATGAGGAAAAAAGG + Intronic
951610478 3:24486802-24486824 TTATTTTTCTTTAAAAAAAAAGG - Intronic
951876947 3:27437854-27437876 GTAGTTTTGGTGAGGAAAAAGGG - Intronic
952642654 3:35615979-35616001 GTATTTTTATTCAAGAAAATTGG - Intergenic
952671088 3:35969855-35969877 ACATTTTTCTTAAGGAATAATGG + Intergenic
952734683 3:36677212-36677234 GTATTTTCCCTGGGGAATAAGGG - Intergenic
953645894 3:44754463-44754485 GTATCTTTATTGAGTAAATAAGG + Intronic
953997578 3:47531961-47531983 GTATTTTTTTTTAGTAGAAACGG + Intergenic
955200668 3:56849456-56849478 ATATTTTTCATCAGTAAAAATGG + Intronic
955286243 3:57644478-57644500 GTATTTTTTTTGTGGAGACAGGG + Intronic
956336727 3:68173031-68173053 GGATTTTTTTTAAGGAAAAATGG + Intronic
956351473 3:68341580-68341602 GTTTTTTTCTGGGGGGAAAAGGG + Intronic
956670267 3:71682890-71682912 GTATTTTTCTGATTGAAAAAAGG - Exonic
957546081 3:81639339-81639361 GTATTTTTTTTTAAAAAAAATGG + Intronic
957680919 3:83433225-83433247 GTATTTTTCTTTAGAAGAGATGG + Intergenic
957769387 3:84670267-84670289 TTATTTTTCTTCATGAAAGAAGG + Intergenic
957821418 3:85379736-85379758 GTATTTTTGTTGATGAAAAAAGG - Intronic
958715124 3:97771539-97771561 GTATTGTTTTTGAGTAAAAGTGG + Intronic
958741096 3:98073349-98073371 GCATTTTCCTTGATGAAGAAAGG - Intergenic
958904084 3:99923122-99923144 GCAGTTTTCTGGAAGAAAAAGGG - Intronic
959000836 3:100962360-100962382 GCAATTTTCCTAAGGAAAAAAGG - Intronic
959089308 3:101885378-101885400 GTGTTTTTCCTGGGGAAACAGGG - Intergenic
960514993 3:118593767-118593789 TTATTTGTCTTTAGTAAAAATGG + Intergenic
960661878 3:120069166-120069188 GTATTTTACTTTATGAGAAAAGG + Intronic
961003599 3:123390209-123390231 GGCTTTTTCTTGTGGAAAAATGG + Intronic
963523696 3:146389251-146389273 TTATTTTTCTTGAGAAAAAGTGG + Intergenic
963801029 3:149676449-149676471 GTGTTTTTTTTGCGGAAAGAAGG + Intronic
963949716 3:151185554-151185576 CTTTTGCTCTTGAGGAAAAAAGG + Intronic
964459238 3:156904334-156904356 GTATTTTTCTTGAGGATAAGGGG - Intronic
965331209 3:167377124-167377146 GTATTTTGTGTGAGGAAAAATGG - Intronic
965729521 3:171755931-171755953 GTTTTCTTCTTGAAGAAAATTGG + Intronic
965966586 3:174498538-174498560 TTATTTCTCTTGAGAAAATAAGG + Intronic
966103089 3:176299356-176299378 TGATTTTTCATGGGGAAAAATGG + Intergenic
966110135 3:176391088-176391110 GTATGTTTTTTGAGGAGAGATGG + Intergenic
966308454 3:178564616-178564638 ATATTAATCTTGAGAAAAAAAGG + Intronic
966316645 3:178654787-178654809 GTATTGTTCTTATTGAAAAATGG + Intronic
966344744 3:178966287-178966309 GTATTTTTCTAGAGGAAGTTTGG - Intergenic
967029440 3:185591906-185591928 GTATTTTTTTTGTAGAAACAGGG + Intronic
967574225 3:191071535-191071557 GTGTGTTTCCTGAGGAATAATGG - Intergenic
967856919 3:194125034-194125056 GTATTTTTTTTGTGGAGAGATGG + Intergenic
968194872 3:196698064-196698086 GTATTTTTTTTTAGTAAAGACGG - Intronic
968245290 3:197140075-197140097 GTATTTTTCTTGAAGCAGACTGG - Intronic
969400902 4:6954773-6954795 GTATTTTTCTTTAGCAGAGATGG + Intronic
970550918 4:17180321-17180343 GTAAGATTCTTGAGGAACAAGGG + Intergenic
971351038 4:25856130-25856152 GTATTTTTGGTGTGGAGAAATGG - Intronic
971652321 4:29294107-29294129 CTATTTATCTTGAGGCAAATGGG + Intergenic
971842745 4:31875079-31875101 GTATTTTTTTTAAGTAAAGATGG - Intergenic
971881103 4:32373959-32373981 ATTTTTTTTTTGAGGAAAGAAGG + Intergenic
972097194 4:35363357-35363379 TTGGTGTTCTTGAGGAAAAAGGG - Intergenic
972224085 4:36991841-36991863 GTATTTTTCTTTAGCAGAGATGG + Intergenic
972762774 4:42123080-42123102 GTAATTTTCATCAAGAAAAAGGG + Intronic
972863972 4:43207512-43207534 GTAAATTTCTTAAAGAAAAATGG - Intergenic
973040590 4:45464709-45464731 GTATTTTTATTATAGAAAAAAGG + Intergenic
973042692 4:45492286-45492308 GTATTTTAGTTGAGAAGAAATGG + Intergenic
973086382 4:46067040-46067062 ATATTTTCCTTCAGGAAAATTGG - Intronic
974053407 4:56962166-56962188 GGGTTTTTATTAAGGAAAAATGG - Intergenic
974118412 4:57608901-57608923 GAATTTATATTGAAGAAAAAGGG + Intergenic
974155152 4:58062002-58062024 CTATTTTTCTGGAAGAAAATGGG - Intergenic
974299448 4:60044372-60044394 GTAATTTTGTTGAGGACAAGAGG - Intergenic
974602589 4:64104818-64104840 TTATGTTGCTTCAGGAAAAAGGG - Intergenic
974981452 4:68962358-68962380 TTTTTTTTCTTCAGTAAAAATGG + Intergenic
975788221 4:77917675-77917697 GTATTTTTCTTGAGGAAAAAAGG - Intronic
976046610 4:80955823-80955845 GTATTTTTCTTTAGTAGAGATGG - Intronic
976128415 4:81857830-81857852 GCATGTTTCTGGAGGAGAAATGG - Intronic
976210894 4:82668730-82668752 GTATTTTACCTGAGTAAAATAGG + Intronic
976991264 4:91369850-91369872 GTATTTTTTTTTAGGAGAGACGG + Intronic
977720307 4:100231976-100231998 GGATTTTTCTTTAGTAAAAATGG - Intergenic
977837451 4:101662095-101662117 GTATTTATCTTGAGGAAATTTGG + Intronic
978295272 4:107197559-107197581 TTTTTTTTCTTGAAGATAAATGG - Intronic
978672317 4:111264622-111264644 GTATTTTCCTAGTGGAAAACAGG - Intergenic
978690257 4:111500035-111500057 GTATTTTTCTTGGCCCAAAAGGG + Intergenic
979055688 4:115990928-115990950 GTTTTTTTCTGGATTAAAAATGG + Intergenic
979187042 4:117809958-117809980 TGATTTTTCTTTAGTAAAAATGG + Intergenic
979210957 4:118102076-118102098 GTTTATTTATTGAGAAAAAATGG + Intronic
979323260 4:119349323-119349345 ATATTTTTATTGAGGATAGAAGG - Intergenic
979514668 4:121594242-121594264 TCATTTTTCTTGAAGAAAAATGG - Intergenic
980161753 4:129172575-129172597 GTAGGTTTCTAGATGAAAAATGG + Intergenic
980305519 4:131055666-131055688 ATATTCTTCTGGAGTAAAAATGG - Intergenic
980435027 4:132760254-132760276 GTATCTTTATGGATGAAAAAGGG - Intergenic
980959034 4:139456037-139456059 GTATTTTTCTTCCGAAAAACTGG + Intronic
981080686 4:140636355-140636377 GTATTTTTCTGGAGATACAAAGG - Intronic
981798514 4:148628363-148628385 GTCTTATTCATCAGGAAAAATGG + Intergenic
982550370 4:156790651-156790673 ATATTTTTGTTGAGAAAAATTGG - Intronic
982727833 4:158924296-158924318 GTGTTTTTCATCATGAAAAAGGG + Intronic
983033985 4:162839480-162839502 GAAATTTTGTTGAGGCAAAAGGG - Intergenic
983051189 4:163049363-163049385 CATTTTTTCTTTAGGAAAAAGGG - Intergenic
983241091 4:165233961-165233983 ATATTTTTATTGAGGATAGAAGG - Intronic
983241161 4:165234823-165234845 CTACTTTTATTGAGAAAAAAAGG - Intronic
983300319 4:165916882-165916904 GTATTATTAATGATGAAAAAAGG + Intronic
983719801 4:170836306-170836328 ATATTTTGATTGAGGGAAAATGG - Intergenic
984088457 4:175341001-175341023 CTTTTTTTCTTGAAGAAAACAGG - Intergenic
984516006 4:180740335-180740357 GTATGTTTCTTGTAGAGAAAGGG - Intergenic
984590475 4:181612026-181612048 ATATTTTTCCTGAGGCATAAAGG - Intergenic
985151068 4:186947267-186947289 GTATTTTTCCAGAGACAAAATGG + Intergenic
986019784 5:3790447-3790469 GTTTTTGTTTTGAGGCAAAAGGG - Intergenic
986124354 5:4871517-4871539 GAATTTTTCTTAAGTGAAAATGG + Intergenic
986403361 5:7400863-7400885 GTAATTTTCTGCAGGAAAGATGG + Intronic
986545655 5:8893842-8893864 ATATTTTTGTTGGGGAAAGAAGG - Intergenic
986840852 5:11695569-11695591 TTCTATTTCTTGAGAAAAAATGG + Intronic
986944312 5:12996782-12996804 GTGTATTTCTTGAGGAGAGAAGG - Intergenic
987350155 5:17015052-17015074 GTATTTTTTTTGAAGAGACAGGG - Intergenic
988247680 5:28708610-28708632 TCATTTTTTTGGAGGAAAAATGG - Intergenic
988446398 5:31290661-31290683 GTTCTTTTCTTGGGAAAAAAAGG - Intronic
988668503 5:33356353-33356375 ATAATTTACTTGAGGAAAAAAGG + Intergenic
988890535 5:35611822-35611844 TTATTTTGGTTGAGGCAAAACGG - Intergenic
989265129 5:39464629-39464651 GTTTTTATCTTAAGGACAAAGGG - Intergenic
989416711 5:41186299-41186321 TCATTTGTCTTGAGGCAAAAAGG - Intronic
989755417 5:44947234-44947256 ATATTTTACTTTATGAAAAAGGG + Intergenic
989795121 5:45459865-45459887 GTATTTTTCAGGAGAAGAAAAGG - Intronic
989813691 5:45709986-45710008 TTATTTTTTTTGAAAAAAAAAGG + Intergenic
990296747 5:54409369-54409391 AAATTTTTCCTAAGGAAAAATGG - Intergenic
990391662 5:55328195-55328217 GTAATTTTCTTAAATAAAAAAGG + Intronic
990974130 5:61542671-61542693 GTTTTTTTATTTTGGAAAAAGGG + Intronic
991095154 5:62732046-62732068 GTATTTTTTTTTAGGAGAGATGG + Intergenic
991714876 5:69442312-69442334 GGATTTTTCTAAGGGAAAAAGGG + Intronic
992130780 5:73690818-73690840 CCATTTTAATTGAGGAAAAATGG - Intronic
992292911 5:75298581-75298603 GAATTTGTCTTTAGTAAAAATGG + Intergenic
992757955 5:79926656-79926678 CTACTTTCCTTCAGGAAAAAAGG + Intergenic
993145979 5:84094400-84094422 GTATTTTTCTTCAACAGAAAAGG + Intronic
993409851 5:87559779-87559801 GAATTTTTCTTGAAGGGAAAGGG + Intergenic
993527743 5:88987392-88987414 GTATTTTTGTAGAGCAAGAAGGG - Intergenic
993691977 5:91013029-91013051 GTGTTTTTCTTGTGGGAACAAGG - Intronic
994337303 5:98582640-98582662 GTTATTTTCTGGAGGAAAGAAGG + Intergenic
995689338 5:114806112-114806134 GTATTTTTCTTGGGGTTAATGGG + Intergenic
995929886 5:117427761-117427783 GTTTTTTTCTTAAAGAAAAGAGG - Intergenic
996339154 5:122416947-122416969 TTATTTTCCATGAGGAAAAAAGG - Intronic
996457963 5:123706925-123706947 TTACTTTTTTTGAGAAAAAATGG + Intergenic
996602685 5:125284283-125284305 CTATTTTTCAGGAAGAAAAATGG + Intergenic
996827463 5:127701726-127701748 GTATTTTTTTAAAGGAGAAATGG + Intergenic
997101772 5:130977439-130977461 GTTATTTTCTTTAGGAAGAATGG + Intergenic
997930188 5:138066489-138066511 TTATTTTTATAAAGGAAAAATGG - Intergenic
997983296 5:138483959-138483981 TTATTTGTCTTGAAGAAAACAGG + Intergenic
998547070 5:143038489-143038511 GAATTGGTCTTGAGGAAATAAGG + Intronic
998758632 5:145407598-145407620 GTACTTTTCTTGACGAATATAGG + Intergenic
999050156 5:148514461-148514483 GTATTTTTCTTAAGGATTGAAGG + Intronic
999815796 5:155174829-155174851 GTATTTTTTTTTTGGAGAAATGG + Intergenic
1000182852 5:158829355-158829377 GTATTTTTTTTGTGAAAACAGGG + Intronic
1000415854 5:160983034-160983056 TTATTTATCTTTAGTAAAAATGG + Intergenic
1001092145 5:168749510-168749532 GGAATCTCCTTGAGGAAAAATGG + Exonic
1002352278 5:178591398-178591420 TTATTTTTCTTAAAAAAAAATGG - Intergenic
1002382934 5:178843203-178843225 GTATTTTTTTTTAGGAGAGAAGG - Intergenic
1002550550 5:179987338-179987360 CTATATTTCTTGTGGAGAAAGGG + Intronic
1003117310 6:3291608-3291630 TTATTTTTCCTCAGCAAAAATGG + Intronic
1003547035 6:7067862-7067884 TTATTTTTTTTGAGGCAAGAAGG + Intergenic
1003766294 6:9240898-9240920 ATAGTTTTCTTGTGGAAAAATGG - Intergenic
1003894733 6:10596553-10596575 CCGTTTTTCTGGAGGAAAAATGG + Intronic
1004121812 6:12830764-12830786 GTATTTTTTTTTAGTAGAAATGG + Intronic
1004980560 6:21018862-21018884 GTTTTTTTCTCGTGGTAAAAGGG + Intronic
1005094703 6:22102192-22102214 GTATTTTTTTTGTGGAGACAGGG + Intergenic
1005281376 6:24278369-24278391 GTATCTTCCTGGAGGCAAAAGGG + Intronic
1005371754 6:25140668-25140690 GTAATTTTGTTGAGCCAAAAAGG - Intergenic
1007605308 6:43113780-43113802 GCATTTATCTTGATGAATAATGG + Intronic
1008467619 6:51848113-51848135 GTACTTTTCTTGTGGGAAATGGG + Intronic
1008622176 6:53281386-53281408 GTATTTTTAATGAGAAAACAGGG + Intronic
1008799860 6:55353557-55353579 TTATTTTTCTTGAGTGAATAAGG + Intronic
1008865207 6:56202270-56202292 TTGTTTTTCTGGAGGAAAAAGGG + Intronic
1009430524 6:63560572-63560594 GTATTTTTTTTAAGTAAAGATGG + Intronic
1010215491 6:73397606-73397628 GAATGTTTGTTGAGGAAAATGGG + Intronic
1010734072 6:79422970-79422992 ATATTTTTCCTGGGGAATAAAGG + Intergenic
1011206596 6:84905870-84905892 GGATTTGTGTTTAGGAAAAAGGG + Intergenic
1011256977 6:85432417-85432439 CTAGTTTTCTGGTGGAAAAAGGG + Intergenic
1011767446 6:90638159-90638181 TTATTTTTCTTCAAGAAATAAGG + Intergenic
1011912203 6:92454509-92454531 TTACTTTTCTTGAAGGAAAAGGG + Intergenic
1012276877 6:97284645-97284667 GTATTTTTTTTGTGGAGACAAGG - Intergenic
1012321054 6:97846348-97846370 GCTTTTTTCTTTAGGAAAAAGGG + Intergenic
1012420523 6:99059617-99059639 GTATTTTTATTTTGGATAAATGG + Intergenic
1012634689 6:101523303-101523325 GGAATTTGCTGGAGGAAAAATGG + Intronic
1013269283 6:108530834-108530856 GTTTTTTTCTTGGAGAAATAAGG + Intergenic
1013401090 6:109796984-109797006 GTACCTTACTTGAGGAAAACTGG + Intronic
1013477263 6:110520661-110520683 CTATTTTTCCTGAGCAATAATGG - Intergenic
1013994246 6:116289212-116289234 GTATTTTTAGTAAGGTAAAATGG + Intronic
1015419804 6:132994056-132994078 GTTTGTTTTTTAAGGAAAAAAGG + Intergenic
1016490042 6:144590031-144590053 GTATTTTTTTTGTGGAGACAGGG + Intronic
1016832368 6:148446411-148446433 GTTCTTTTCTTAAGGAAAGAGGG + Intronic
1017771362 6:157647116-157647138 GTATTTTTCTTAAAGAAAACGGG - Intronic
1018605284 6:165591095-165591117 GTATTTTTATTGGGAAAAAAAGG + Intronic
1020285181 7:6673347-6673369 CTATTTTTCTTGAAGAAACTGGG - Intergenic
1020287150 7:6692542-6692564 CTATTTTTCTTGAAGGAACAGGG + Exonic
1020370734 7:7429514-7429536 GAAGTTTTCTTCAGAAAAAAAGG + Intronic
1020851966 7:13365020-13365042 GTATTTTTGTTGAGAATACATGG + Intergenic
1020928424 7:14361855-14361877 GTATTTTAATATAGGAAAAAAGG - Intronic
1021001689 7:15339717-15339739 GTATTTTCTTTAAGGATAAAGGG - Intronic
1021738565 7:23662719-23662741 GTATTGTTTTTGAGAAAGAAAGG - Intergenic
1021837289 7:24691676-24691698 TTAATTTTCTTAGGGAAAAAGGG + Exonic
1021900888 7:25284275-25284297 GAATTTTTGTTGAGAGAAAAAGG - Intergenic
1022128150 7:27377957-27377979 TTATTTCTCTGGTGGAAAAAAGG + Intergenic
1022290069 7:28993106-28993128 GTATTTTACTTTAGAAGAAAGGG - Intergenic
1022604542 7:31797236-31797258 TTATTTTTCATGAGCAAAGAGGG - Intronic
1023065375 7:36372520-36372542 CTATTTTCATTGAGGTAAAAAGG - Intronic
1023092032 7:36626107-36626129 GTATTTTTCTAGTTGAGAAAAGG + Intronic
1023099531 7:36701528-36701550 GTATATTTCATAATGAAAAAGGG - Intronic
1023626449 7:42119635-42119657 GTATTTTTCTATAGGAAATCTGG - Intronic
1025888696 7:65624302-65624324 GTCTTTCTCTAGAAGAAAAAAGG + Intergenic
1026999753 7:74644184-74644206 GTATTTTTTTTTAGTAGAAACGG - Intergenic
1027736295 7:81936818-81936840 GTATTTCTCTTTAGGAAAATAGG + Intergenic
1027941810 7:84691697-84691719 TTATTTTTCATGAGGAAAGAGGG + Intergenic
1028092592 7:86721985-86722007 GGCTCTTTCTTGAGGAAAACTGG + Intronic
1028441242 7:90864118-90864140 TTTTTTTTTTTAAGGAAAAATGG - Intronic
1028871608 7:95776506-95776528 GTAGTTTTCTAGGGAAAAAATGG + Intronic
1029090437 7:98043921-98043943 GTATTTTTTTTGTAGAAACAAGG - Intergenic
1029547848 7:101220292-101220314 GTATTTTTTTTGTAGAAACATGG + Intronic
1029590200 7:101502379-101502401 GTATTTTTCTTGAGCATAGCTGG - Intronic
1030010134 7:105157580-105157602 ATATTTTTCTTAAAGAAAGATGG + Intronic
1030741215 7:113112275-113112297 GTATTTTTCTTGGTGGAATATGG + Intergenic
1030852231 7:114503151-114503173 ATATTTTGCTTGAGGAGAAAGGG - Intronic
1030985168 7:116232963-116232985 GTCATTTTCTTTAGGACAAAAGG + Intronic
1031004367 7:116455855-116455877 GTTTTTTTCTAAAGGCAAAAAGG + Intronic
1031117825 7:117687391-117687413 ATATGTTTCTTCAGCAAAAATGG - Intronic
1031140234 7:117934553-117934575 CTATTTTTCTGGAGGAAATTTGG - Intergenic
1031541496 7:123000289-123000311 GTATATATCTTGAGGTACAATGG + Intergenic
1031560187 7:123228753-123228775 GTATTTTTTTTAAGGACAGATGG - Intergenic
1031748062 7:125530465-125530487 TTAATTTTCTTGAGGGGAAAAGG + Intergenic
1032031651 7:128489258-128489280 GTATTTTTCTTTAGTAGAGATGG - Intronic
1032188610 7:129749405-129749427 GTATCATTCTTGAGCCAAAATGG - Intronic
1032820700 7:135521659-135521681 GTATTTTTCTTAAAGAGACAGGG - Intergenic
1033026442 7:137777962-137777984 GTATTCTTGTTGAGGAAATAAGG - Intronic
1033073366 7:138225182-138225204 GTTTTCTTCTTGAGGCAAAATGG - Intergenic
1033197942 7:139343010-139343032 GTATTTTCCCTGTGGAGAAAGGG - Intronic
1033374762 7:140747655-140747677 ATATTTTTCTGGAGGAATTATGG - Intronic
1033482612 7:141756998-141757020 GCATTTTGGTTGAGGAAAGATGG + Intronic
1033547807 7:142417804-142417826 GTAATTTTTTTGAGGATGAAAGG + Intergenic
1035440051 7:158889618-158889640 GTATTTTTATTGAAAAAAATAGG + Intronic
1037022915 8:13995987-13996009 GTACTCTTTTTGAGGAAATAGGG - Intergenic
1038059907 8:23901508-23901530 GTATTTTTATTTATTAAAAAAGG - Intergenic
1038747406 8:30266563-30266585 CTATTTTTCTTGATAAAAACTGG - Intergenic
1039621637 8:39002491-39002513 GTATTTTTTTTTAGTAAAGACGG + Intronic
1040076443 8:43236594-43236616 GTATTTTTTTTTAGTAGAAACGG + Intergenic
1040649536 8:49432868-49432890 TTATCTTTCTTAAGGAAGAAGGG - Intergenic
1041803960 8:61829870-61829892 GTATTTTTCCTGAAGAACAATGG - Intergenic
1042583795 8:70312389-70312411 GTATCTTTCTTGGGGAAAAAGGG + Intronic
1042652273 8:71056349-71056371 TTATTTTTCATGAAGGAAAAAGG + Intergenic
1042748221 8:72130931-72130953 TTATGTTTCTTGAGAAGAAAAGG + Intergenic
1042908260 8:73796922-73796944 GTATTTGTCTTGACCCAAAATGG - Intronic
1042909637 8:73813228-73813250 GTATTTTTCCTAAAGAGAAATGG + Intronic
1043047162 8:75341013-75341035 GCATTGTTCTGGAGTAAAAAGGG + Intergenic
1043050121 8:75376184-75376206 GCCTTGTTTTTGAGGAAAAATGG + Intergenic
1043541787 8:81271650-81271672 ATGGTTTTCTTGAGGAACAAGGG + Intergenic
1044269616 8:90226322-90226344 TTACTTCACTTGAGGAAAAAAGG + Intergenic
1044475644 8:92622185-92622207 GTATCTTTCTTTAAAAAAAATGG - Intergenic
1044646534 8:94449432-94449454 GTATTTTTTTAGTGGAAACAGGG - Intronic
1044731815 8:95234747-95234769 ATATTTTTCTTAACGAAAATGGG - Intergenic
1044830914 8:96247524-96247546 GAATTTTCCATGAGGAAACATGG + Intronic
1044987035 8:97764942-97764964 GTATATTTCCTGAGGAAAGTGGG - Intergenic
1045075324 8:98559875-98559897 ATATTTTGAATGAGGAAAAAGGG + Intronic
1045440724 8:102207252-102207274 ATATTTTTTTGGGGGAAAAAGGG - Exonic
1045623279 8:104008554-104008576 CTAATTTTCTTGAGGAAATTGGG + Intronic
1046222519 8:111234650-111234672 TGATTTTTCTTTAGTAAAAATGG + Intergenic
1046332429 8:112736821-112736843 ATATTTTTCTTAGGGAACAATGG + Intronic
1046690768 8:117282058-117282080 GTATTTTTCTTGAAGACAAGAGG + Intergenic
1047171950 8:122502375-122502397 GTATTTTCCTGGAGAAAGAAAGG + Intergenic
1048600930 8:135917939-135917961 GTTTTTTTCCTGAAGACAAAAGG + Intergenic
1048611391 8:136027018-136027040 GTATTTTTTTTTAGTAGAAACGG + Intergenic
1050146730 9:2576024-2576046 GTTTTTAACTTAAGGAAAAAGGG + Intergenic
1050717784 9:8549245-8549267 TCATTTTACTTAAGGAAAAATGG + Intronic
1050993841 9:12188220-12188242 TTTTTTTTCTTTAGAAAAAATGG - Intergenic
1051883660 9:21866745-21866767 GATTTTTTCTTAAAGAAAAATGG - Exonic
1052148689 9:25084058-25084080 TTATTTTTCTTGAAGAGAAAAGG + Intergenic
1052623037 9:30938834-30938856 GTACCTTTCTAGAGGCAAAAGGG + Intergenic
1052721184 9:32172922-32172944 GTATTGTTAATGAGCAAAAATGG - Intergenic
1052769928 9:32678224-32678246 GTATTTGTGTTGAGAAAACAGGG + Intergenic
1054941627 9:70749036-70749058 GTATTTTTTTTGTGGAGATAGGG + Intronic
1054981618 9:71212733-71212755 AGATTTTTCTTAAAGAAAAAGGG + Intronic
1055372379 9:75613810-75613832 GTATTTTTTTTGTAGAAACAGGG + Intergenic
1055593857 9:77846018-77846040 GTATTATCCTTGAGGAAACGAGG + Intronic
1055884107 9:81038699-81038721 GTATTTTTCTTGCAAAGAAAAGG + Intergenic
1056316735 9:85397548-85397570 CTCTTTTTCTTGAGGGGAAAGGG - Intergenic
1056950222 9:91035733-91035755 CTATTTTGGTTGAGGAAAGATGG - Intergenic
1057065505 9:92046441-92046463 GGATTTTCCTTGAATAAAAAAGG - Intronic
1057156695 9:92848264-92848286 GTCTTTTTCTTGAGGAAACCAGG + Exonic
1057800767 9:98190450-98190472 GTGTTTTTTTGGAGAAAAAAAGG + Intronic
1059148022 9:111919617-111919639 GTATTTTTCTTTAGTAGAGACGG - Intronic
1059566760 9:115390246-115390268 GTGTTTTTTTTAAGGAAAACAGG + Intronic
1059621360 9:116009110-116009132 ATTTTTTTCTTCAGGAAAATAGG + Intergenic
1060050599 9:120375744-120375766 GTATTTTTTTTGAAGAGACAGGG - Intergenic
1060328149 9:122638200-122638222 GTAGTTTTCTTTAGGAAAAGAGG + Intergenic
1060681726 9:125571686-125571708 GTATTTTTTTTTAGTAAAGATGG - Intronic
1060688431 9:125633604-125633626 GCATTTTTCTGGAAGAGAAATGG - Intronic
1061734417 9:132643627-132643649 GTTTTTTTCTTCTGGAAAATGGG - Intronic
1061758103 9:132829589-132829611 GTTTTTTTTTTTAAGAAAAATGG - Intronic
1185999555 X:4993196-4993218 ATATTTTTCTTGTGGATACACGG - Intergenic
1186130973 X:6464980-6465002 GTATCTTTCTAGATGACAAATGG + Intergenic
1186508979 X:10116417-10116439 GGATTCTGCTTCAGGAAAAAAGG + Exonic
1186566301 X:10666575-10666597 GTATTTATCCTGAGGAAATCTGG + Intronic
1186755519 X:12667067-12667089 GTATTTTTATTTAGAAAGAAAGG - Intronic
1187266101 X:17735869-17735891 GTATTTATTTTTAGTAAAAATGG + Exonic
1187669356 X:21653827-21653849 GTTTTTTTCAGGAGGAGAAAGGG + Exonic
1187687578 X:21830889-21830911 GTATTCCTCTTAAGGAATAATGG + Intergenic
1188295559 X:28443772-28443794 GTATTTCTCTGGTGGAAGAAAGG - Intergenic
1188492831 X:30754593-30754615 GTATTTTTTTAGTGGAAACAGGG - Intergenic
1188883970 X:35527271-35527293 TGATATTTCTTGAGGTAAAATGG - Intergenic
1189226142 X:39414852-39414874 TTTTATTTCTTGGGGAAAAAAGG + Intergenic
1190004841 X:46725869-46725891 TTATTTCTTATGAGGAAAAATGG + Intronic
1190472508 X:50797009-50797031 GTTGCTTTCTTGAGGAAAAGAGG + Intronic
1190568320 X:51754317-51754339 GTATTATTATTTAGCAAAAATGG - Intergenic
1191613290 X:63139765-63139787 GGATTTGTCTTTAGTAAAAATGG + Intergenic
1191623007 X:63239162-63239184 GGATTTGTCTTTAGTAAAAATGG - Intergenic
1191872819 X:65764450-65764472 GTAATTCTTTGGAGGAAAAAGGG + Intergenic
1192197037 X:69035285-69035307 GTCTTTTTCTTAAGAACAAAGGG - Intergenic
1192659261 X:73024605-73024627 ATAATTATCTTGAGTAAAAATGG - Intergenic
1192757159 X:74058357-74058379 GTATCTTTCTCCAGGAATAAAGG + Intergenic
1192915635 X:75648582-75648604 GTTTTTTTCTTGAGGAAGCATGG - Intergenic
1193471787 X:81913523-81913545 GTATCTTTCTGGAGGAGAAAGGG - Intergenic
1193835070 X:86333347-86333369 GCATTTTTCTTGCAGTAAAATGG - Intronic
1193873429 X:86830602-86830624 GCATTTTTCTAAAGGACAAATGG + Intronic
1194051804 X:89078530-89078552 TTATTTTTCTGAAGAAAAAAGGG - Intergenic
1194167684 X:90540137-90540159 GTATTTTTTTTTAGTAGAAACGG - Intergenic
1194204264 X:90993562-90993584 GTTTTTTTCTGTAGAAAAAAAGG + Intergenic
1195219926 X:102737115-102737137 TTATTTTTCTGAAGAAAAAAAGG - Intronic
1195220675 X:102743143-102743165 GGAATTTCCTTGTGGAAAAATGG + Intronic
1195889843 X:109680807-109680829 TTATTTTTTTTGAGGAGAAATGG + Intronic
1197119563 X:122874317-122874339 TTAGTTTTCCTCAGGAAAAAGGG - Intergenic
1197708518 X:129650510-129650532 CAATTTTTCTTGGGGAAAGAGGG - Intronic
1197999977 X:132423665-132423687 CTTTTTTTCATTAGGAAAAAAGG - Intronic
1198495664 X:137190099-137190121 GTTTAGTTCTTTAGGAAAAAGGG + Intergenic
1198624688 X:138557445-138557467 GTATTATTTGTTAGGAAAAAAGG - Intergenic
1198647031 X:138819762-138819784 GTATTTTTCTCCACTAAAAATGG - Intronic
1199002873 X:142661023-142661045 GTATTTATTTTGAATAAAAAGGG - Intergenic
1199355012 X:146852018-146852040 GTATTTTTCTTTAAGAAAATAGG - Intergenic
1199378008 X:147134940-147134962 TTTTTTTTTTTGAGGTAAAAAGG + Intergenic
1199686003 X:150266249-150266271 GTTTTGTTAATGAGGAAAAAGGG + Intergenic
1199687652 X:150279044-150279066 GAATTTATCTTGAGGACAATGGG + Intergenic
1199702277 X:150391001-150391023 GGATTTTTCTTCAGGAACCATGG - Intronic
1199846689 X:151696684-151696706 ATTTTTTGCTTGAAGAAAAATGG - Intronic
1200513937 Y:4117917-4117939 GTATTTTTTTTTAGTAGAAACGG - Intergenic