ID: 975788622

View in Genome Browser
Species Human (GRCh38)
Location 4:77922856-77922878
Sequence GTTCCATTTGGACATCTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 173}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975788622_975788628 27 Left 975788622 4:77922856-77922878 CCTTTTAGATGTCCAAATGGAAC 0: 1
1: 0
2: 2
3: 27
4: 173
Right 975788628 4:77922906-77922928 TCTGAATCAGAGAAAAGGGCTGG No data
975788622_975788629 28 Left 975788622 4:77922856-77922878 CCTTTTAGATGTCCAAATGGAAC 0: 1
1: 0
2: 2
3: 27
4: 173
Right 975788629 4:77922907-77922929 CTGAATCAGAGAAAAGGGCTGGG No data
975788622_975788626 22 Left 975788622 4:77922856-77922878 CCTTTTAGATGTCCAAATGGAAC 0: 1
1: 0
2: 2
3: 27
4: 173
Right 975788626 4:77922901-77922923 TCAAGTCTGAATCAGAGAAAAGG 0: 1
1: 0
2: 0
3: 19
4: 259
975788622_975788625 -5 Left 975788622 4:77922856-77922878 CCTTTTAGATGTCCAAATGGAAC 0: 1
1: 0
2: 2
3: 27
4: 173
Right 975788625 4:77922874-77922896 GGAACTGTGTAATAGGTCATTGG No data
975788622_975788627 23 Left 975788622 4:77922856-77922878 CCTTTTAGATGTCCAAATGGAAC 0: 1
1: 0
2: 2
3: 27
4: 173
Right 975788627 4:77922902-77922924 CAAGTCTGAATCAGAGAAAAGGG 0: 1
1: 0
2: 0
3: 26
4: 312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975788622 Original CRISPR GTTCCATTTGGACATCTAAA AGG (reversed) Intronic
900880703 1:5379351-5379373 GGTCCATTTGGACTCCTAAGTGG + Intergenic
903995330 1:27301805-27301827 GTTCCACTTGGGCATCTGAGAGG + Intronic
907249583 1:53129352-53129374 TTTACATTTGCACATCTAGAGGG + Intronic
907996044 1:59633671-59633693 GTTGTCTTTGGACATCTAAGAGG + Intronic
908834377 1:68213892-68213914 GTTTCTTTGGGACATCTAGAAGG - Intronic
908977622 1:69918456-69918478 GTTACATATGTTCATCTAAAAGG + Intronic
911555895 1:99344052-99344074 TTTCCACTTGGACATCTGAAAGG - Intergenic
912945360 1:114079871-114079893 GTTGCATTTGGCCATAGAAACGG + Intergenic
915960816 1:160265159-160265181 GCTCCATTCGGAAATCTAATAGG - Intergenic
916014119 1:160733359-160733381 TCTCCATTTGGATATTTAAAAGG - Intergenic
917920677 1:179747126-179747148 GTTGCATTTGGACCTCAAAAAGG + Intronic
918229944 1:182519081-182519103 GATGCATTTGGAAATCTATATGG - Intronic
919965951 1:202525212-202525234 TTTCCAGTTGGAAATCTAACAGG - Intronic
920047114 1:203140484-203140506 CTTCCATTTGGATACCTAATAGG - Intronic
920162794 1:204012335-204012357 TTTCTATTTGGATATCTAATAGG - Intergenic
921623533 1:217353079-217353101 GTCCCACTTGGAGATCCAAAAGG + Intergenic
923316698 1:232787186-232787208 ATTCCCTTTGGCCATGTAAATGG - Intergenic
1064038874 10:11940479-11940501 TTTCCACTTGGACACCTCAAAGG + Intronic
1064957743 10:20930129-20930151 GTTGGATGTGGACATCTAAATGG - Intronic
1065284400 10:24173860-24173882 TTGCAATTTGGACATTTAAAAGG - Intronic
1065314899 10:24454098-24454120 AATTCATTTGGACATCAAAATGG - Intronic
1067672989 10:48342793-48342815 TTTCCATCTGGACATTCAAAAGG - Intronic
1070461857 10:76678208-76678230 GCTCCATTTGCCCATCTGAAGGG - Intergenic
1071361389 10:84849858-84849880 GTTTCATCTGGAAACCTAAAGGG - Intergenic
1071692917 10:87841585-87841607 GTTTTATTGGGACATCTCAAAGG + Intergenic
1071874939 10:89835130-89835152 ATTCTATTTGGACTTATAAATGG - Intergenic
1072766045 10:98096003-98096025 TTTTCCTTTGGACATCTTAAGGG + Intergenic
1074944315 10:118266472-118266494 GGTCCATTAGCACATCAAAATGG - Intergenic
1075675813 10:124295104-124295126 GTCCCATTTGTAAATCTATAGGG + Intergenic
1075710124 10:124526368-124526390 CTTCCATTTGCAAATCTAAATGG - Intronic
1077571768 11:3345653-3345675 TTTCCATTTGGACAATTATAAGG + Intronic
1080295143 11:30718259-30718281 TTTCCATTTTCACATCTAAAAGG + Intergenic
1081416045 11:42817466-42817488 CTTCCATTTGGGAATGTAAAGGG - Intergenic
1083835755 11:65266031-65266053 GTGCCATTTAGACATCCAACTGG - Intronic
1085727811 11:78969598-78969620 ATTCCATTTGGGCATTTAGATGG - Intronic
1087655058 11:100912578-100912600 GTTTCATATGGACTTATAAATGG + Intronic
1088108316 11:106230004-106230026 GTTCCACTTGAACTTTTAAAAGG - Intergenic
1088747715 11:112818239-112818261 GTTTCCCTTGCACATCTAAATGG - Intergenic
1089571118 11:119410590-119410612 CTTCCATTTGGATGTCTAATGGG + Intergenic
1091638106 12:2213471-2213493 GTTACACATGGACATCTAGACGG + Intronic
1092520217 12:9264302-9264324 GTTCTATTTGGATATCTCATGGG + Intergenic
1093550978 12:20410941-20410963 GTTTGATGGGGACATCTAAATGG - Intronic
1093722600 12:22462249-22462271 GTGCCATTTGTAGATCTATATGG + Intronic
1094960090 12:36073504-36073526 TTTCCATGTGGACATTTCAAAGG + Intergenic
1094985380 12:36481849-36481871 TTTCCATGTGGACATTTCAATGG + Intergenic
1095007367 12:36837924-36837946 TTTCCATGTGGACATTTCAAAGG + Intergenic
1096192313 12:49627944-49627966 TTTCCATTTGGACAATTGAATGG + Intronic
1101104356 12:101425277-101425299 GTTCCTTTTGGCCTTCTGAAGGG + Intergenic
1102043627 12:109816252-109816274 CTTCCCTTTGGACACCAAAAGGG + Intronic
1102335429 12:112074901-112074923 GTTTCCTTTGCAAATCTAAAAGG + Intronic
1106206274 13:27598454-27598476 GGTCAATTTTGACATGTAAAAGG + Intronic
1107466178 13:40652674-40652696 GTTCTATTTTGACATGAAAAAGG - Intronic
1107675449 13:42791861-42791883 GGTACATTTGGACATAAAAATGG - Intergenic
1108788239 13:53933130-53933152 GGTAAATTTGGATATCTAAATGG + Intergenic
1109068079 13:57726258-57726280 CTTACATTTGCACATTTAAATGG - Exonic
1109232892 13:59780814-59780836 TTTCCTTTTGGACATGTTAATGG + Intronic
1109280511 13:60350078-60350100 GTTATATTTGGTCATCTTAAAGG - Intergenic
1109820432 13:67645436-67645458 GTTCCATTTTAACATAAAAAGGG + Intergenic
1110104021 13:71647539-71647561 GTTCCCACGGGACATCTAAAAGG + Intronic
1110731657 13:78885476-78885498 GTGCCATTTGGTAATATAAAGGG - Intergenic
1112470012 13:99679626-99679648 GTGTCATTTGCAGATCTAAAAGG - Intronic
1115269454 14:31535576-31535598 GTTTCATTTGAACGTATAAAAGG - Intronic
1126644403 15:50860545-50860567 TTTCGACTTGGACATCTAATAGG + Intergenic
1133081715 16:3326590-3326612 ATTCCATTTGGAGATCTGAGAGG + Intergenic
1134158168 16:11861192-11861214 GTTCCAATGGTACATCTAAATGG + Intergenic
1135918659 16:26628174-26628196 CTTCCATTTGGACCTATAAATGG - Intergenic
1139556909 16:67718274-67718296 GTTCTTTCTGGACATTTAAAAGG + Intronic
1140557999 16:75943705-75943727 TCTCCATTTGGACAGCTAATGGG - Intergenic
1140784438 16:78326747-78326769 GTTTCATTTAGACATTTAAGTGG + Intronic
1141275436 16:82583487-82583509 ATTCCACTTGGAGATCTAGAAGG + Intergenic
1142706047 17:1695115-1695137 GTTGCATTCTGACATCCAAAGGG - Intergenic
1150032405 17:61753400-61753422 TTTCCATTTGGATATCTTAAAGG - Intronic
1150040139 17:61851477-61851499 TTTCCATATGGACATCTAACAGG + Intronic
1150089865 17:62314044-62314066 TTTCCATTTGGAGTTTTAAAAGG + Intergenic
1156199620 18:34815287-34815309 ATTCCTTTTGTACATCCAAAAGG + Intronic
1156200003 18:34820169-34820191 GTTCCATTTTCACTTCTAACTGG + Intronic
1158183103 18:54740301-54740323 TTTCTATTTAGACATCTAAGGGG - Intronic
1159990339 18:74899535-74899557 GTTTCATTTGGACATCACATGGG - Intronic
1163257317 19:16164671-16164693 AGTCCATTTGCACATCTGAAGGG - Intronic
1165639851 19:37375161-37375183 ATTCCATTTGGATATCCAAAAGG - Intronic
1167288798 19:48613508-48613530 GAGCCATTTGGACATCTGCAGGG - Exonic
1167729175 19:51240930-51240952 CTTCCATTTGTTTATCTAAAGGG - Intronic
926277505 2:11415766-11415788 ATTCCATTTGGTCTTCCAAATGG + Intergenic
927579564 2:24230110-24230132 GTGCCTTTTAGACATCTGAATGG - Intronic
928565675 2:32545962-32545984 GTTCCATTTTCACATCTAAAAGG + Intronic
930686414 2:54313209-54313231 TTTCCAATTGAACATCTAACAGG + Intergenic
931596037 2:63944721-63944743 GTTCCATTTGTACATTAAAAAGG + Intronic
932207760 2:69898517-69898539 TTTCCATTTGCAAAACTAAATGG - Intronic
933077105 2:77943046-77943068 ATTCCTTTTGGACATCTTAGGGG + Intergenic
934058276 2:88270667-88270689 GTTCCATTTGGTCATTCAAGAGG + Intergenic
936689524 2:114869912-114869934 GGTCTCTTTGGACATATAAAAGG + Intronic
937222748 2:120351181-120351203 GTGGCACTTGGACATCTAGAGGG - Exonic
940253875 2:151708699-151708721 CTTCCATGTGGATGTCTAAAAGG + Intronic
941853447 2:170207102-170207124 TTCCCATTTGGAAATCTAAGAGG - Intronic
943767302 2:191677301-191677323 CTTGCTTTTGTACATCTAAAAGG - Intergenic
944558573 2:200912314-200912336 TTTCCATTTGGAAATCTCAAAGG + Intronic
946758830 2:222973169-222973191 TCTCCATTTGGACATCTGAAAGG - Intergenic
946997472 2:225411457-225411479 TCTCCACTTGGACATTTAAAAGG - Intronic
947297461 2:228647810-228647832 ATTCCATTTTGAAATCAAAATGG - Intergenic
1169652506 20:7885190-7885212 GCTCCCTTTGGACATCTAAGTGG - Intronic
1171184503 20:23115335-23115357 GTTCTATTGGGCCCTCTAAATGG + Intergenic
1174240493 20:49130536-49130558 GGACAATTTGGACATCAAAATGG + Intronic
1175182148 20:57156266-57156288 GGTCCACTTGGACTTCTCAATGG + Intergenic
1185304688 22:50108020-50108042 GATACATTTGAACATTTAAAAGG - Intronic
950641382 3:14350852-14350874 CTTTCATCTGGACATCGAAATGG - Intergenic
950830900 3:15875144-15875166 TATCCATTTGGAGATCTAACAGG - Intergenic
951169405 3:19522336-19522358 GTTCCATTTCGAAAGCCAAAAGG + Intronic
951360177 3:21715872-21715894 TTTACATTTGGAGATCTAATAGG + Intronic
952136511 3:30428564-30428586 GTTCAAGATGGACATCTGAAAGG - Intergenic
952238956 3:31510027-31510049 GTTTCATTTGAACAGCTCAATGG + Intergenic
955636892 3:61040119-61040141 GCTTAATTTGGACATTTAAAGGG - Intronic
956801458 3:72763370-72763392 GTTTCATTTGGACAGTTAACAGG - Intronic
957435981 3:80176981-80177003 GTTGTATTTGGAGATCTTAAAGG + Intergenic
958587987 3:96116516-96116538 GTGCCATTTGGAGGTCTCAAAGG - Intergenic
958741854 3:98083231-98083253 GTTCCTTTTAGACTTCCAAAAGG + Intergenic
959056005 3:101568328-101568350 TCTCCACTTGGACATCTAATAGG - Intergenic
960426924 3:117520212-117520234 GTTCCACTTGGTCCTATAAAAGG - Intergenic
963871732 3:150423076-150423098 GTTCCATTTGAACACGTTAAAGG + Exonic
965323468 3:167274426-167274448 GTTCAACTTGGTCTTCTAAAAGG - Intronic
970608859 4:17707430-17707452 GCTCAGATTGGACATCTAAAAGG - Intronic
973787694 4:54348930-54348952 TCTCCACTTGGACATCTAATAGG - Intergenic
974690862 4:65296423-65296445 GCTTCATTTGGATGTCTAAAAGG - Intergenic
975788622 4:77922856-77922878 GTTCCATTTGGACATCTAAAAGG - Intronic
976705075 4:88011647-88011669 CTTCCCTTTAGACATCGAAAGGG - Intronic
977103223 4:92845497-92845519 ATTCCTTTTGGACATGTAGATGG + Intronic
977776414 4:100925493-100925515 GTGGCATTTTGAGATCTAAATGG - Intergenic
979209341 4:118080254-118080276 TCTCTACTTGGACATCTAAAAGG - Intronic
979609696 4:122676146-122676168 CTTCCATTTGAATATCTAAAAGG - Intergenic
980441287 4:132848825-132848847 GTTCCACTGGGACGTCTTAATGG + Intergenic
981069097 4:140516276-140516298 TTTCTATTTAGACATTTAAAAGG - Intergenic
981874489 4:149524299-149524321 GTTCTATATGTTCATCTAAATGG + Intergenic
989512484 5:42304438-42304460 GGTCTAATTGGACATTTAAAAGG + Intergenic
990877214 5:60499121-60499143 GGCCCATGTGGATATCTAAAGGG - Intronic
993160856 5:84289117-84289139 GCTCCATTTAGAAATCTAGATGG - Intronic
993592818 5:89815986-89816008 CTGCCATTTGGACACCAAAATGG + Intergenic
995866536 5:116697713-116697735 TTTCCATTTTGACATCTAATAGG - Intergenic
996358268 5:122619956-122619978 GGTCCATTTGAACATTTATATGG - Intergenic
999653220 5:153787790-153787812 TCTCCACTTGGACATCTAACAGG + Intronic
999883721 5:155896286-155896308 GTTTCATTTAAAAATCTAAAAGG - Intronic
1000077858 5:157810663-157810685 GTTGGATTTGGACATGGAAATGG - Intronic
1000568992 5:162886977-162886999 GTTGCACTTTGACAACTAAAAGG + Intergenic
1001128954 5:169047493-169047515 GTTCCATCTGGAGACCTAGATGG + Intronic
1003622361 6:7712145-7712167 ACTCCATTTGGATATCTGAAAGG + Intergenic
1003820650 6:9893096-9893118 GTTTCATTTGGAAAACAAAAAGG - Intronic
1004433446 6:15567073-15567095 TTTCCATTTAGACCTTTAAAAGG - Intronic
1005695486 6:28348451-28348473 GTAATATTTGGATATCTAAATGG - Intronic
1006303006 6:33204040-33204062 GTTGCATTTGGAAGGCTAAATGG + Exonic
1006967789 6:38007097-38007119 TATTCATTTGGACATTTAAAAGG + Intronic
1009341317 6:62558221-62558243 GTTCCATATGGACTTCAAAGTGG - Intergenic
1009380012 6:63016201-63016223 GTTCCATTTGTACAGTTAGAGGG - Intergenic
1010046878 6:71454935-71454957 AATTCATTTGGACAACTAAAGGG - Intergenic
1012260082 6:97078515-97078537 ATTCAATTTGGACATCTTAGAGG + Intronic
1012739194 6:102992823-102992845 TGGCCATTTGGAAATCTAAAAGG + Intergenic
1014875968 6:126659909-126659931 ATTCCTTTTGTACATCAAAATGG - Intergenic
1015065036 6:129014188-129014210 GTTCTATTTAGATGTCTAAAAGG - Intronic
1015590149 6:134815255-134815277 TTTCCATTTGGATCTCTGAAAGG - Intergenic
1020150852 7:5680709-5680731 CTTCTACTTGGATATCTAAAAGG + Intronic
1020478504 7:8627673-8627695 GTTGCATTTTGACTTTTAAAAGG + Intronic
1020995049 7:15252735-15252757 GTTCCAGCTGGAAATCTAACAGG - Intronic
1022576316 7:31500581-31500603 GCTCAATTAGGACATATAAAGGG + Intergenic
1023846258 7:44122371-44122393 GTTCCATCTGGACAACTACCAGG + Exonic
1026253896 7:68694137-68694159 GCTCTATTTAGATATCTAAAGGG - Intergenic
1028338482 7:89688087-89688109 GGTCCCTTTGAATATCTAAAGGG + Intergenic
1029378110 7:100194299-100194321 CTTTCATTTGGACACTTAAAAGG + Intronic
1031395929 7:121273631-121273653 GTTCCATTTGGTCATATTAAAGG - Intronic
1034050935 7:147983862-147983884 TTTCCATTTAGACCTTTAAAAGG + Intronic
1034068648 7:148161357-148161379 GTGGCATTTGGAAATCTCAAGGG - Intronic
1034682621 7:152940607-152940629 TTTCCATTTGGATATGTCAAAGG - Intergenic
1036709183 8:11067411-11067433 GTCCCATTTGAACATCAAAAGGG + Intronic
1038324367 8:26561454-26561476 TTTCCACTTGGATATCTTAAAGG + Intronic
1041877297 8:62704666-62704688 GTTCCAGGTGGAAATCTAGAAGG - Intronic
1046318887 8:112544787-112544809 TTTCCTTTTGGACATCTTAGTGG + Intronic
1046371493 8:113314709-113314731 TTTCCATATGGATATCCAAATGG - Exonic
1051342334 9:16123085-16123107 GTTCCATTTGGACAGCAAGATGG - Intergenic
1051542152 9:18231692-18231714 GCTCCACTTGGATGTCTAAAAGG + Intergenic
1053439044 9:38099556-38099578 GCTCCACTTGGAAATCTAAAAGG + Intergenic
1053570677 9:39302208-39302230 TTTCCATGTGGAAATCTAAAAGG - Intergenic
1053836625 9:42143125-42143147 TTTCCATGTGGAAATCTAAAAGG - Intergenic
1053846401 9:42241923-42241945 TTTCCATATGGATATCTGAATGG - Intergenic
1054092299 9:60861225-60861247 TTTCCATGTGGAAATCTAAAAGG - Intergenic
1054113712 9:61136818-61136840 TTTCCATGTGGAAATCTAAAAGG - Intergenic
1054126468 9:61316804-61316826 TTTCCATGTGGAAATCTAAAAGG + Intergenic
1054593983 9:67045369-67045391 TTTCCATGTGGAAATCTAAAAGG + Intergenic
1055093499 9:72386884-72386906 TTTCAATTTGGAAACCTAAATGG - Intergenic
1056542978 9:87590136-87590158 GTTCCCTTTGAACATCAATATGG + Intronic
1056985115 9:91356611-91356633 GTACTTCTTGGACATCTAAATGG - Intronic
1057520446 9:95755586-95755608 GTTCCTTTAGGACAGGTAAATGG - Intergenic
1058706950 9:107645366-107645388 GTTTTATTTGCACAACTAAAGGG + Intergenic
1060767560 9:126306559-126306581 GTTCCATTTGGAGATCTCAAGGG - Intergenic
1185738126 X:2508653-2508675 GGTCAATTGGGACATCAAAATGG - Intergenic
1186364311 X:8875237-8875259 GGACCATTTGGATATGTAAAGGG + Intergenic
1186636798 X:11414686-11414708 GATCAATTTTGACATGTAAATGG - Intronic
1187018504 X:15354670-15354692 TTTCCATTTGGTAATCTTAAGGG + Intronic
1187962018 X:24575513-24575535 AATCCATTTGGATATGTAAAGGG + Intronic
1188294766 X:28433891-28433913 TCTACATTTGAACATCTAAAAGG - Intergenic
1188852396 X:35148484-35148506 GCTCCATTTGTATATCTAATTGG - Intergenic
1189518558 X:41741398-41741420 TTTCCATGTTGACATCTAGATGG - Intronic
1190823008 X:53992107-53992129 GTTCCATTTTTACTTTTAAAAGG - Intronic
1190898135 X:54641070-54641092 GTGCCTTTGGGACATCTAAAGGG + Intergenic
1192292330 X:69810891-69810913 GTTTCCTCTGGACATTTAAAAGG + Intronic
1192475601 X:71439115-71439137 GTTCCATTGAGACATCCAAGAGG - Intronic
1194733926 X:97488982-97489004 ATGCCATTGGGACATTTAAAGGG + Intronic
1197657452 X:129132520-129132542 ATTCCATTTGGATGTCTAATAGG - Intergenic