ID: 975789023

View in Genome Browser
Species Human (GRCh38)
Location 4:77927857-77927879
Sequence TCTAGAAAACAAGCTTAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 8, 3: 17, 4: 229}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975789023 Original CRISPR TCTAGAAAACAAGCTTAGAT TGG (reversed) Intronic
901406430 1:9049969-9049991 TCTAGAAAAAAATAATAGATTGG + Intronic
906855244 1:49297531-49297553 TCTAGATAAGAAACTGAGATTGG - Intronic
908100820 1:60789213-60789235 TCTAGAAAAAAAAATTAGCTGGG - Intergenic
908427999 1:64027258-64027280 TCTGGAAAACAAGCTAGGAAGGG - Intronic
911141335 1:94505705-94505727 GCTAGAAAAGAAGCTGAGAAAGG + Intronic
911702722 1:100973213-100973235 TCTAGAAAAAAAGCCAAGCTAGG + Intronic
912223876 1:107709012-107709034 ACTAGAAAATAATGTTAGATAGG + Intronic
912598716 1:110905133-110905155 TCTAGAAAATAACCTCAGAAGGG + Intergenic
913006924 1:114642508-114642530 ATAAGAAAACAAGCTTAGAAGGG - Intronic
913473967 1:119218660-119218682 TAAATAAAACAAGCTTTGATGGG - Intergenic
915940112 1:160113692-160113714 TCCAGAACACAACCTGAGATAGG - Intergenic
916279248 1:163030540-163030562 CCTAGAAAACAAGCTGCGTTTGG + Intergenic
916341664 1:163743904-163743926 TCTAGAAAACAGCCTTAAAGGGG - Intergenic
916591129 1:166191778-166191800 TCTAGTAAACATGTTTAGTTTGG - Intergenic
918971549 1:191426383-191426405 TCTATAAAACATGCTTAAAACGG - Intergenic
919197207 1:194301217-194301239 CCCAGAATACAAGCTTAGAAAGG + Intergenic
919200599 1:194350228-194350250 TCTAGAAAACAGGATAAAATTGG + Intergenic
919263642 1:195233120-195233142 TGTTGAAAACAAAATTAGATAGG - Intergenic
919694998 1:200565689-200565711 TCCTGAAAACAAGCTTAAAATGG - Intronic
920442982 1:205993931-205993953 CCCAGAAAAGAAGCTTAGTTGGG - Intronic
920686000 1:208109371-208109393 TCTTGAAAACAGGTTTGGATTGG - Intronic
921256461 1:213344828-213344850 TATAAAAAACAAGCATAGGTGGG - Intergenic
921506863 1:215982452-215982474 TCTCAAAAACAAGCTTAGGCAGG + Intronic
922076358 1:222248531-222248553 CATAGAAAACTAGCTAAGATTGG + Intergenic
922382613 1:225047777-225047799 TTTAGAAAACAAGTTTGGACTGG - Intronic
923293023 1:232565177-232565199 TCTGGATAAAAACCTTAGATAGG + Intergenic
923440085 1:234009479-234009501 GGCAGAAAACAATCTTAGATTGG - Intronic
923918118 1:238531110-238531132 TCTAGAGCACAAACTTCGATAGG + Intergenic
923976684 1:239271878-239271900 TATATAAAACTAGCTGAGATGGG - Intergenic
923983212 1:239350129-239350151 ACTAGAAATGAAGCTTACATTGG - Intergenic
1063411798 10:5842039-5842061 TATAGAAAACAAGGTTCAATTGG + Intronic
1065370304 10:24978004-24978026 TATAGGAAACAAGAATAGATGGG - Intergenic
1067547782 10:47207267-47207289 TCTATAAAACAAGGCTAGTTTGG - Intergenic
1068157983 10:53225149-53225171 TCTAGAAAATAACCTCAAATAGG + Intergenic
1070649734 10:78226229-78226251 TCTAGACATCAAGCCAAGATTGG - Intergenic
1071486674 10:86106959-86106981 TCTAGATCAGAAGCCTAGATGGG + Intronic
1072092656 10:92144429-92144451 TCTACAAAACAAGATTAGCCGGG - Intronic
1073932280 10:108589404-108589426 TGTAGTATACAAGCTTAGATTGG + Intergenic
1077292171 11:1802820-1802842 TGCAGAAAACAAGATGAGATGGG - Intergenic
1078113850 11:8425776-8425798 TTTCAAAAACAGGCTTAGATAGG - Intronic
1079183707 11:18216791-18216813 TCTAGAAAACAGTCTCAGAAAGG + Intronic
1079310911 11:19365049-19365071 TCTGGAAAAGAACCTCAGATGGG - Intronic
1079486608 11:20941712-20941734 TCTAGAAATCAGGATCAGATAGG - Intronic
1080114587 11:28607290-28607312 TCTAGGAAACAAGCTGAGTTTGG - Intergenic
1080299028 11:30763471-30763493 TCTAAAGAACAGGCTCAGATTGG - Intergenic
1081426621 11:42932817-42932839 TCTAGAAAACAAAATTAGACAGG + Intergenic
1082965072 11:58958901-58958923 GTTAGAAAACAAAATTAGATGGG - Intronic
1084096482 11:66914867-66914889 TCTAGAAAAAAAAATTAGCTGGG + Intronic
1086571664 11:88291836-88291858 TCTAGAAAAAAAAATCAGATGGG - Intergenic
1087501718 11:98964247-98964269 TCTAGAAAGCAAGTTTAAACTGG + Intergenic
1091261070 11:134234749-134234771 TCAAGAAAACAAGGCTAGAAGGG + Intronic
1094276212 12:28678453-28678475 TCTAGAAAACAAGGACACATAGG + Intergenic
1094403439 12:30087283-30087305 TTTAGAAAACAAGCTATGATTGG - Intergenic
1094568951 12:31625252-31625274 TATAGAAAACTAGCTCAAATTGG + Intergenic
1095278619 12:40322668-40322690 TCTAGAATACAAGATTTTATTGG - Intronic
1097146838 12:56947254-56947276 TCTAGAAAACAGACTTAAAAGGG - Intergenic
1097150596 12:56976587-56976609 TCTAGAAAATAAACTTAGAAGGG - Intergenic
1097864158 12:64545144-64545166 TCAGGAAAAAAAGCTTGGATTGG + Intergenic
1098458801 12:70708390-70708412 TGTAGAAGCCAAGCTTACATAGG + Intronic
1098483496 12:70994130-70994152 TCTAGAAAGCAAGTCTAGAAAGG + Intergenic
1098824621 12:75279483-75279505 TTTAAATAACAGGCTTAGATGGG + Intronic
1099607712 12:84826835-84826857 TATAGAAAAGAAGCTTTGAAGGG + Intergenic
1099947186 12:89258123-89258145 TCTAGAAAATAGGCTTAGATGGG - Intergenic
1101171900 12:102106135-102106157 TCTAGAAAACAGGCATGGAATGG + Intronic
1102844748 12:116168106-116168128 TATAGTACACAAGATTAGATTGG - Intronic
1103597085 12:122030517-122030539 TGGAGAAACCAGGCTTAGATGGG + Intronic
1109914741 13:68967905-68967927 TATAGAAACCAAGTTTAAATTGG + Intergenic
1111722884 13:91969417-91969439 TCTAGAAAAAAATCATAGGTAGG + Intronic
1111827964 13:93292854-93292876 TCTAGAAAACAATTTGAAATGGG + Intronic
1111984711 13:95054355-95054377 TCTTGAACATAAGCTTAGGTAGG + Intronic
1112418438 13:99225720-99225742 ACTAGAACACAAGCTTACTTAGG - Intronic
1114371211 14:22090696-22090718 TTTAGAAATTAAGGTTAGATGGG + Intergenic
1117279053 14:54219818-54219840 ACTTCAAAACAAGCTTAAATTGG - Intergenic
1117767504 14:59098159-59098181 TCTCAATATCAAGCTTAGATTGG + Intergenic
1118941584 14:70344569-70344591 CTTATAAAACAAGCTTAGAATGG + Intronic
1121734456 14:96208246-96208268 TCTAGAAAACAACCCTGGAGTGG - Intronic
1122164931 14:99815659-99815681 TCTAGAAAAACAACTTTGATTGG + Intronic
1124958134 15:34373466-34373488 CATAGAAAACAAGATGAGATTGG - Intergenic
1125115817 15:36090356-36090378 TCTAGAAAATGTGCTTAAATGGG - Intergenic
1127116960 15:55738580-55738602 TCTATAGAACAAGTTTACATTGG + Intronic
1130049903 15:80475257-80475279 TCTAGAAAACATTCTTGGCTGGG + Intronic
1130260542 15:82350674-82350696 TCTAGAAAAAAAGCTTAGTTTGG - Intergenic
1130280690 15:82518330-82518352 TCTAGAAAAAAAGCTTAGTTTGG + Intergenic
1130472062 15:84234513-84234535 TCTAGAAAAAAAGCTTAGTTTGG + Intergenic
1130479556 15:84349084-84349106 TCTAGAAAAAAAGCTTAGTTTGG + Intergenic
1130492214 15:84439045-84439067 TCTAGAAAAAAAGCTTAGTTTGG - Intergenic
1130511976 15:84596958-84596980 TCTAGAAAACAGCCTCAGAAGGG + Intergenic
1130594361 15:85239153-85239175 TCTAGAAAAAAAGCTTAGTTTGG + Intergenic
1130614238 15:85389272-85389294 TTTAGAAAACAAACATAGCTTGG - Intronic
1131036901 15:89228598-89228620 TCTAGAAAACCAGTTTAGGCTGG + Intergenic
1131818658 15:96248902-96248924 TCAAGCAAATAACCTTAGATAGG + Intergenic
1133861745 16:9601949-9601971 TCTAGACTACAAGCTTCTATAGG - Intergenic
1134063369 16:11212009-11212031 TCTAGAAAATTGGCTCAGATAGG + Intergenic
1135204638 16:20472904-20472926 TCTAGAAAACCATCTTAAATTGG - Intronic
1135214253 16:20550908-20550930 TCTAGAAAATCATCTTAAATTGG + Intronic
1139962290 16:70724944-70724966 TCTAGCAAACAGACTTAGGTTGG + Intronic
1140712245 16:77689331-77689353 CCTAGAAAACAATCCTAGAGTGG - Intergenic
1141245117 16:82298695-82298717 ACGAGAAAACAAGCTCAGAGAGG - Intergenic
1142073899 16:88106405-88106427 TCTAGAACACAAGAGTAGACAGG - Intronic
1142953052 17:3499845-3499867 TCTAGAAATTAAGCTTAGTAAGG + Exonic
1144969852 17:19101417-19101439 TCAAGAAAACAAGCCAAGACCGG + Intergenic
1144978064 17:19150647-19150669 TCAAGAAAACAAGCCAAGACCGG - Intronic
1144990157 17:19227585-19227607 TCAAGAAAACAAGCCAAGACCGG + Intronic
1146494812 17:33312235-33312257 TATAGTAAACAAGCTTTGAATGG + Intronic
1149054471 17:52346572-52346594 TCTAGAAAATAGCCTCAGATGGG - Intergenic
1149239941 17:54637027-54637049 TCTAGAAAATAACCTTAAAGGGG + Intergenic
1149312591 17:55409369-55409391 TCTAGAAAACAGAATTAGAAAGG - Intronic
1149353426 17:55814867-55814889 TCTAGAAGACAAGCGGAGTTTGG + Intronic
1151057612 17:71051751-71051773 TCTGGAAAACAGGCTGAGATGGG + Intergenic
1156356397 18:36345776-36345798 GCTAGAAAACAAACTTACAGAGG + Intronic
1157034986 18:43960814-43960836 TTTAGAAAACACGCTTATATAGG - Intergenic
1157872211 18:51240890-51240912 ACTAGAAAATAAACCTAGATAGG - Intergenic
1159806106 18:72960184-72960206 TCTGGAAATCAAGTTTTGATTGG + Intergenic
1161863431 19:6816645-6816667 ACAAGAAAGCAGGCTTAGATCGG - Intronic
1162438812 19:10680209-10680231 TCTGGAAAACATGCCTAGCTCGG - Intronic
925260257 2:2522461-2522483 TGTAGAAAAAAAGCTTTGATTGG + Intergenic
925611151 2:5704620-5704642 TCGAGAAAGCATGCTTACATTGG - Intergenic
928038361 2:27848659-27848681 TATAGACAACAAGATTAGGTTGG + Intronic
930292471 2:49512321-49512343 TCTATGAAATAAGCTTAGAGGGG + Intergenic
930430301 2:51266841-51266863 TGTAGAAAACAGGCTTTAATAGG + Intergenic
932949962 2:76281449-76281471 GCCAGAAAGCAAGCTTAGAGTGG + Intergenic
938965135 2:136381588-136381610 CCTAGAAAACCAGCTGAGTTTGG + Intergenic
939273753 2:139972464-139972486 TCTAGAAAACAGCCTTAAAAGGG + Intergenic
939344707 2:140949462-140949484 TCTAGAGTACAAGCTAAGAAAGG - Intronic
939469346 2:142599845-142599867 TCTAGAAAATAATCTTATTTAGG - Intergenic
939597087 2:144138584-144138606 TCTGGAAAAGAAGTGTAGATGGG + Intronic
941012882 2:160321209-160321231 TGTAGCAAACAAGCTGAGAGAGG - Intronic
941640381 2:167981676-167981698 GCAAGAAAACAAGCTGGGATGGG + Intronic
941964297 2:171285596-171285618 TGGAAAAAACAAGCTTAGAGGGG + Intergenic
942391620 2:175501110-175501132 TCTAGAAAATAAGCTTAAAAAGG - Intergenic
944305101 2:198170036-198170058 TCTAGAAAACATACTTCAATGGG - Intronic
945441883 2:209889324-209889346 TCTAGAAAACATCCTTAGCCAGG - Intronic
945806828 2:214500535-214500557 GCTGGAAAACAGGCTCAGATGGG - Intronic
946674727 2:222147179-222147201 ATTAGAAAACAAGATTAGACAGG + Intergenic
948397047 2:237652688-237652710 TCAAGAAAACAATCTTGGCTGGG + Intronic
1169287484 20:4321723-4321745 TCTGGAAAACAGGCATAGAGAGG + Intergenic
1169601950 20:7271387-7271409 CATAGAAAAGAAGCTTTGATGGG + Intergenic
1169695630 20:8384387-8384409 ACTAGAAAACCAGTTTAGAGAGG - Intronic
1172374828 20:34430191-34430213 ATGAGAAAACAAGCTTAGAAAGG + Intronic
1177559039 21:22727248-22727270 TCTAGAAAACAATCTTTTAAGGG + Intergenic
1178018671 21:28382958-28382980 TATAGTAAACAAGATTATATAGG + Intergenic
1178297190 21:31420243-31420265 TATAGAAAACAAGCCTTGAAAGG + Intronic
1180013155 21:45064670-45064692 TCTAGAAAACAAAAATAGGTGGG + Intergenic
1183910279 22:41074092-41074114 CATAGAAAACAAGATAAGATTGG - Intergenic
950753584 3:15153045-15153067 TGTAGAAAAGAATGTTAGATGGG + Intergenic
952181804 3:30924690-30924712 TCTAAATAACAAGCTAAAATCGG + Intergenic
954260131 3:49432837-49432859 TCTATAAAACAGGCTTGGCTGGG - Intergenic
956996710 3:74833924-74833946 TCTAGGATACAACCCTAGATAGG + Intergenic
957494355 3:80971768-80971790 TCTTGTAAACAAGTTGAGATGGG - Intergenic
958446416 3:94220977-94220999 CCTAGAAAACAAGCCAAGTTTGG + Intergenic
958788482 3:98624532-98624554 CCTGGAAAACAAGCCTACATAGG - Intergenic
960075526 3:113480679-113480701 TCAAGAAAACAAGAATTGATTGG + Intronic
963564920 3:146917166-146917188 TCAATAAAACAAGCTTATTTTGG + Intergenic
966085025 3:176060825-176060847 TATAAGAGACAAGCTTAGATTGG + Intergenic
966349479 3:179015758-179015780 TCTAGAAAACAGGGTTAGAGAGG + Intergenic
967370929 3:188745087-188745109 TCTAGAAAATGAGCTCAAATTGG - Intronic
971362403 4:25950301-25950323 TATAGAAAAAGAGCTTAGAATGG + Intergenic
971777736 4:30989246-30989268 ACTGCAAAACAAGCTAAGATAGG + Intronic
974504822 4:62755815-62755837 TCCAGAAATCTAGCTTACATGGG - Intergenic
975368901 4:73561040-73561062 TTTAAAAATCAAGCTTAAATAGG + Intergenic
975789023 4:77927857-77927879 TCTAGAAAACAAGCTTAGATTGG - Intronic
980500384 4:133644405-133644427 TCAAGAAAATAAGCTGTGATAGG - Intergenic
981402488 4:144329778-144329800 TATAGTATACAAGCTTAGCTAGG - Intergenic
984355265 4:178651165-178651187 TCTAGAAAATAAGCTCAAAAGGG - Intergenic
984459991 4:180022199-180022221 ACTAAAAAAGAAGCTTACATTGG + Intergenic
984675158 4:182539076-182539098 TTAAGAAAAAAAGCATAGATTGG + Intronic
986698513 5:10380467-10380489 TGTACAAAACAAGCTTCTATTGG - Intronic
986771906 5:10981930-10981952 CCAAGAAAACAAGCTTTGTTAGG - Intronic
988608165 5:32700337-32700359 TCTAGAAAATAGCCTTAGAGGGG - Intronic
990170365 5:53041333-53041355 TCTAGAATACAGGATGAGATTGG - Intronic
991325569 5:65427873-65427895 TGTAGAAAAAAAGCTAAGTTTGG + Intronic
991407772 5:66318517-66318539 CCTAGAAAACATGCTTGGATAGG + Intergenic
993667909 5:90723381-90723403 TCTAGAAGACAAGCTGAGATGGG + Intronic
995715038 5:115073956-115073978 TCTAGAAAAGAACCTAAGATAGG + Intergenic
996301343 5:121989915-121989937 TCTAAAGAAAAAGCCTAGATTGG + Intronic
996315517 5:122156301-122156323 TCTAAAAGAAAAGCCTAGATGGG + Intronic
999590441 5:153139285-153139307 AATAGAAAGCAAGCTTCGATGGG + Intergenic
999856236 5:155597264-155597286 TCTAAAAACCAAGCTCAGTTGGG + Intergenic
1000521708 5:162302770-162302792 TATAGCAAAAAAGCTGAGATTGG + Intergenic
1001345458 5:170892911-170892933 ACAAGAAAACAGGCTTAGAGGGG + Intronic
1001361887 5:171094629-171094651 GTTAGAAGACAAGCTTAGGTGGG - Intronic
1006699919 6:35963754-35963776 TCTAGAAACCATTCTCAGATGGG + Intronic
1009287569 6:61840571-61840593 TTTAGAAAGTCAGCTTAGATAGG - Intronic
1011102755 6:83742784-83742806 TCTAGAAAATAACCTTAAAAGGG - Intergenic
1011237601 6:85234582-85234604 TCTAGAAAACAGCCTTAAAAAGG + Intergenic
1013648264 6:112167419-112167441 TTTAGAAAACAAACTTAAGTGGG - Intronic
1014143358 6:117969297-117969319 TCCAAAAAACAAACTTTGATAGG + Intronic
1014159084 6:118146539-118146561 TCTAGAAAACATTTTCAGATTGG + Intronic
1014198986 6:118588096-118588118 TCTAGAAAAGAGGCTAAGTTAGG - Intronic
1014402307 6:121005929-121005951 AGTAGAAAACAAGGTTAGAAAGG + Intergenic
1015318118 6:131840547-131840569 TGTACAAAACATGCCTAGATTGG - Intronic
1017421561 6:154278159-154278181 CATAGAAAAAAAGTTTAGATTGG + Intronic
1017629430 6:156382215-156382237 TCTACAACACAATCTTAGTTTGG - Intergenic
1019884461 7:3891984-3892006 TTTTGAAAACAAGTTTAGTTAGG + Intronic
1020242491 7:6406651-6406673 TCTACAAAACAAAATTAGCTGGG - Intergenic
1020611577 7:10404021-10404043 TGTAGAAGTCAAGCTTAGAGTGG - Intergenic
1021641155 7:22737217-22737239 TCTAGAAAACAGCCTCAAATGGG + Intergenic
1021953022 7:25793782-25793804 TCTAAAAAACAAAATTAGCTGGG + Intergenic
1023368920 7:39492431-39492453 TCAAAAAAAAAAACTTAGATTGG + Intronic
1026780722 7:73265309-73265331 TCTAGAAAACAAGCCTTGGCAGG - Intergenic
1027021578 7:74818744-74818766 TCTAGAAAACAAGCCTTGGCAGG - Intronic
1027066444 7:75127180-75127202 TCTAGAAAACAAGCCTTGGCAGG + Intronic
1027242759 7:76343551-76343573 TTTTGAAAACAATCTCAGATGGG - Intronic
1027973356 7:85116132-85116154 AATAGAAAACAAGTTTATATAGG - Intronic
1028207017 7:88030113-88030135 TCTAGAAAACAACCTCAAAGGGG - Intronic
1028645508 7:93092356-93092378 TCTAGAAAATAACCTTAAAAGGG - Intergenic
1031380678 7:121082153-121082175 TCTAGAAAAGCAGCTCAAATGGG - Intronic
1031428364 7:121635554-121635576 TTTAGAAGATAAGCTTAGATGGG - Intergenic
1032778958 7:135146738-135146760 TCTAAATAACATGCTTGGATTGG - Intronic
1033028779 7:137804651-137804673 TCTCGATAACAAGCTTGGATGGG + Intronic
1037439067 8:18895561-18895583 TCTAGCAAACTTGCTTAGAGTGG - Intronic
1038463843 8:27741757-27741779 TGTAGCAAACAAGATTAGAGAGG + Intronic
1039343170 8:36673206-36673228 TCTAAAATACAAGGTTAGTTAGG + Intergenic
1040393257 8:46968343-46968365 TCTAGAAAATAACCCTAGAAAGG - Intergenic
1043101492 8:76052948-76052970 TCAAGAAAACAAGGTTCAATGGG - Intergenic
1043445589 8:80316341-80316363 TCTAGGAAACAAGCATAGCCTGG + Intergenic
1045234533 8:100339067-100339089 GCTGGAAAACAGGCTTAGAGAGG + Intronic
1045304165 8:100943109-100943131 TCTAGAAAACATGCTAAAATTGG + Intronic
1045359946 8:101423790-101423812 TCTAGAGAACAAGTGTAGACTGG - Intergenic
1045969968 8:108069009-108069031 TCTAGAAAAGAATATAAGATAGG + Intronic
1048593444 8:135842865-135842887 TCAAGGAAACAGGCTTAGAAAGG + Intergenic
1050328955 9:4525667-4525689 TCTAGAAATGAAACTTAGAGTGG + Intronic
1050561198 9:6835629-6835651 TGCAGAAAACAAGATGAGATTGG + Intronic
1050760484 9:9063460-9063482 ACTTGGAAACAAGCTTTGATAGG - Intronic
1051489850 9:17649936-17649958 TCTAGAAAAAAAGTATAGAATGG + Intronic
1051570747 9:18555849-18555871 TCTAGAAAACAGGCAAAGCTGGG + Intronic
1052271776 9:26634894-26634916 TCTAGAAACCACTCCTAGATAGG - Intergenic
1052607611 9:30724489-30724511 TCTTGAAAACAATCTTAAAAGGG + Intergenic
1053110383 9:35454766-35454788 TCTAGAAAATAACCTTAAAAGGG + Intergenic
1053251246 9:36575663-36575685 TCTGGAAAACTAGCAGAGATGGG - Intronic
1054831909 9:69634471-69634493 TCTGGAAAACAAGCTCAGAAAGG + Intronic
1055222915 9:73959594-73959616 AGTAGAAAACAAACTTAGGTTGG - Intergenic
1055749890 9:79493486-79493508 GCTAGAAATCAAGCTGAGGTAGG + Intergenic
1056022471 9:82454614-82454636 AGTAGAAAACAAGTCTAGATTGG + Intergenic
1057052030 9:91932238-91932260 TTTTAAAAACAAGCTTAGAATGG + Intronic
1057210514 9:93198679-93198701 TATAAAAAACAAGCTAAGAAGGG - Intronic
1060362695 9:122975210-122975232 TCAAGAAAACATGCTTAGGAAGG - Intronic
1186221312 X:7352082-7352104 TTTAGAAAACATTCTTAGAGAGG + Exonic
1187032924 X:15506624-15506646 TGTAGAAAATAAGCTTATCTGGG + Intronic
1187161979 X:16773517-16773539 TCTAGAAAGCCAGCTTGAATCGG + Intergenic
1187852876 X:23608447-23608469 TCTAGAAAACATGTTGAGAAAGG + Intergenic
1189066515 X:37815311-37815333 TCTAGAAAATAAGCTCACAGTGG - Intronic
1189436000 X:40993210-40993232 TCTAGCAAACAAGCCAAGAAGGG - Intergenic
1189957190 X:46287937-46287959 GCCAGAAAACAAGATGAGATTGG - Intergenic
1190130722 X:47746372-47746394 TTTAGAAAAAAAGATTAAATTGG + Intergenic
1193038227 X:76976775-76976797 TGTATAAAAGAAGCTTAGAGAGG + Intergenic
1193209057 X:78784083-78784105 TCTAGAAAAGGAGCCTATATTGG + Intergenic
1194218637 X:91165154-91165176 TCTAGAAAACAACCTCAAAAGGG - Intergenic
1194457384 X:94122108-94122130 TCTAGAAAACAACCTCAAAAGGG - Intergenic
1196550652 X:117019979-117020001 TCTTGAAAACAACATTTGATCGG - Intergenic
1197307824 X:124864606-124864628 TCTAGAAAATAACCTTAAAGGGG + Intronic
1198225412 X:134640795-134640817 TCAACAAAACAACCTTAGAAAGG + Intronic
1200231926 X:154448362-154448384 TCTAGAAGACAAGCCTAGGGCGG - Intronic
1200555146 Y:4628906-4628928 TCTAGAAAACAACCTCAAAAGGG - Intergenic
1201527902 Y:14957167-14957189 TCTAGGAATCAAGCTTACAAGGG + Intergenic