ID: 975793367

View in Genome Browser
Species Human (GRCh38)
Location 4:77980596-77980618
Sequence TTGCTAAGTCTGCTACAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975793367_975793368 11 Left 975793367 4:77980596-77980618 CCTATCTGTAGCAGACTTAGCAA No data
Right 975793368 4:77980630-77980652 ATCAAGTGACTGTAAATGTGAGG No data
975793367_975793369 12 Left 975793367 4:77980596-77980618 CCTATCTGTAGCAGACTTAGCAA No data
Right 975793369 4:77980631-77980653 TCAAGTGACTGTAAATGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975793367 Original CRISPR TTGCTAAGTCTGCTACAGAT AGG (reversed) Intergenic
No off target data available for this crispr