ID: 975796644

View in Genome Browser
Species Human (GRCh38)
Location 4:78012922-78012944
Sequence CTGTGTACCAAGAAGAATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975796644_975796647 16 Left 975796644 4:78012922-78012944 CCATCATTCTTCTTGGTACACAG No data
Right 975796647 4:78012961-78012983 TACAAGAGAATCACTGCCTAGGG No data
975796644_975796646 15 Left 975796644 4:78012922-78012944 CCATCATTCTTCTTGGTACACAG No data
Right 975796646 4:78012960-78012982 TTACAAGAGAATCACTGCCTAGG No data
975796644_975796648 22 Left 975796644 4:78012922-78012944 CCATCATTCTTCTTGGTACACAG No data
Right 975796648 4:78012967-78012989 AGAATCACTGCCTAGGGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975796644 Original CRISPR CTGTGTACCAAGAAGAATGA TGG (reversed) Intergenic
No off target data available for this crispr