ID: 975798049

View in Genome Browser
Species Human (GRCh38)
Location 4:78030589-78030611
Sequence CACATTTAGTAACTTGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975798044_975798049 4 Left 975798044 4:78030562-78030584 CCAAGGGAAAGCGCTCCCAGGGT No data
Right 975798049 4:78030589-78030611 CACATTTAGTAACTTGAGGTGGG No data
975798042_975798049 5 Left 975798042 4:78030561-78030583 CCCAAGGGAAAGCGCTCCCAGGG No data
Right 975798049 4:78030589-78030611 CACATTTAGTAACTTGAGGTGGG No data
975798040_975798049 10 Left 975798040 4:78030556-78030578 CCTCACCCAAGGGAAAGCGCTCC No data
Right 975798049 4:78030589-78030611 CACATTTAGTAACTTGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975798049 Original CRISPR CACATTTAGTAACTTGAGGT GGG Intergenic
No off target data available for this crispr