ID: 975800811

View in Genome Browser
Species Human (GRCh38)
Location 4:78057675-78057697
Sequence GCCGGAAAGTTGCTGGTCAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 61}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975800811_975800813 -8 Left 975800811 4:78057675-78057697 CCAGTGACCAGCAACTTTCCGGC 0: 1
1: 0
2: 0
3: 3
4: 61
Right 975800813 4:78057690-78057712 TTTCCGGCGAGATTTTGACGCGG 0: 1
1: 0
2: 0
3: 0
4: 15

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975800811 Original CRISPR GCCGGAAAGTTGCTGGTCAC TGG (reversed) Exonic
905683793 1:39894154-39894176 GCCTCAGAGTTGCTGGTCATGGG + Intergenic
906193665 1:43915202-43915224 GCTGAAGAGCTGCTGGTCACTGG + Intronic
909353598 1:74681937-74681959 TCTGGAATGTTGCTGGTTACTGG - Intergenic
910865397 1:91783654-91783676 GCTCAAAAGTTGCTGGTCATTGG - Intronic
912370818 1:109172773-109172795 GCTGGAAAGCTGCTGGTCTTTGG - Intronic
919768163 1:201140589-201140611 GCAGGAGAGCTCCTGGTCACAGG + Intronic
1068901839 10:62278172-62278194 TCTGGAAAGTTGCCTGTCACTGG - Intergenic
1072726413 10:97816757-97816779 GCCTGACAGTTGCTGGGCTCTGG + Intergenic
1075813955 10:125250048-125250070 GCCAGCAAGTTTCTGGTCATTGG - Intergenic
1076496899 10:130903530-130903552 GCCAGGAAGCTGCTGGTCCCAGG - Intergenic
1083222371 11:61261124-61261146 GCAGGAGAGTTGCTGGAAACCGG + Intronic
1088873324 11:113911618-113911640 GCAGGAAAATTGCTTGTCCCCGG - Intronic
1089343337 11:117774403-117774425 GCCCGACAGTTGCTGAGCACAGG - Intronic
1098358555 12:69633306-69633328 GCTGGAAAGTGGCTGGTCTAAGG - Intergenic
1099354955 12:81622404-81622426 ACCTGAAAGTTACTGGGCACAGG - Intronic
1101866648 12:108525157-108525179 GCCCGTATGCTGCTGGTCACAGG + Intronic
1104053085 12:125209393-125209415 GCAGCAGAGTGGCTGGTCACTGG + Intronic
1105278028 13:18947529-18947551 GGAGAAAAGTTGCAGGTCACTGG - Intergenic
1112990614 13:105509182-105509204 GCCTGGAAGTTGCTGGTTACGGG - Intergenic
1132716257 16:1291571-1291593 ACCGGGAAGCTGCTGATCACCGG + Intergenic
1140359649 16:74333445-74333467 GCCTGGAAGTTGCTCGTTACAGG + Intergenic
1140749715 16:78012131-78012153 GCCAGAAATGTGCTGGCCACAGG - Intergenic
1148441378 17:47713364-47713386 GGCGGAAAGTTGCTGGGGGCTGG + Intergenic
1153733255 18:8036917-8036939 GCAGGAAAGTTGCTGTTTACTGG + Intronic
1160888664 19:1365322-1365344 GCCTGGAAGTTGCAGGTCATTGG + Intronic
1161680317 19:5676833-5676855 GCCAGAAAGCAGCTGCTCACTGG + Intronic
927477209 2:23423138-23423160 CCTGGGAAGTTCCTGGTCACAGG + Intronic
930763203 2:55058477-55058499 GCCTGAAAGTGGCTGGTAGCTGG - Intronic
932567870 2:72920850-72920872 CCCGGAAAGTTCCTGATCTCGGG - Intronic
938940792 2:136168005-136168027 GCCTGAAAGATGCTGGGCAGAGG + Intergenic
942608874 2:177720572-177720594 GCTGGAAAGGTTCTGGTCTCTGG - Intronic
948565706 2:238884802-238884824 GCCGGAAAGTGCCTGCTCCCTGG + Intronic
948670409 2:239564802-239564824 CCCGGAAAGAAGCTAGTCACTGG - Intergenic
1174836223 20:53857915-53857937 GCTGGAAAGTTTCTGGGCAGGGG - Intergenic
1176150479 20:63588314-63588336 GCTGGAAGGTTGCGGGTCCCAGG + Exonic
1180700485 22:17778857-17778879 GGCGGCAAGTTGGAGGTCACTGG - Intergenic
1181314960 22:21964938-21964960 GCTGGAAAGCTGGTGGTCTCTGG - Intronic
951155399 3:19346843-19346865 GTCTGCAAGTAGCTGGTCACAGG + Intronic
955447049 3:59023619-59023641 CCCACAAAGTTGGTGGTCACTGG - Intronic
956610604 3:71118614-71118636 ACTGGAAAGTTTCTAGTCACGGG + Intronic
960622266 3:119648307-119648329 GCAGGAAAGTTGGTGGTAGCTGG + Exonic
965436796 3:168662584-168662606 GTCGGGAAGTTGCTGGTCATTGG + Intergenic
974876621 4:67710545-67710567 CCCGGGAAGTTGCTTCTCACTGG + Intergenic
975365583 4:73524212-73524234 GACGGAAACTTGCTGGTTTCAGG - Intergenic
975517900 4:75267260-75267282 GCCACTAAGTTGCTGGTAACTGG + Intergenic
975800811 4:78057675-78057697 GCCGGAAAGTTGCTGGTCACTGG - Exonic
978498067 4:109381044-109381066 GCTGGAAAGCTGCCAGTCACAGG + Intergenic
995199241 5:109409224-109409246 GGCGGAAAGGTGCTGATCCCGGG + Intronic
999624368 5:153504850-153504872 GCAGGAAATGTCCTGGTCACTGG - Intronic
1013308386 6:108871168-108871190 GCTGGAAAGTGGCTGATCAAGGG + Intronic
1017680698 6:156861370-156861392 GCCGGTGAATTGCTGGACACAGG + Intronic
1024613563 7:51087822-51087844 GTCAGAAAGTTGCTGGAAACTGG - Intronic
1024697206 7:51869887-51869909 GGCGTAAAGGTGCAGGTCACAGG - Intergenic
1030542195 7:110844830-110844852 CCAGGAAATTTACTGGTCACAGG + Intronic
1030714153 7:112789351-112789373 GCCGGATTTTTGCTAGTCACTGG - Intronic
1031655486 7:124349647-124349669 GCGGGAAAGCTGCCAGTCACAGG + Intergenic
1046654028 8:116874127-116874149 GGCGGAAGGTTGCTGCTCCCGGG + Intronic
1048115065 8:131511749-131511771 GCCAGATATTTGCTAGTCACAGG - Intergenic
1049344634 8:142131903-142131925 TCCGGAGAGCTGCTGGGCACAGG - Intergenic
1049360300 8:142209607-142209629 GCCGGGAAGTTCCTGGGCAGTGG + Intergenic
1051279818 9:15431154-15431176 GCAGGAAAGCTGCTGGGCGCGGG - Intronic
1057185175 9:93053360-93053382 GCCGCCAAGTGCCTGGTCACTGG - Intergenic
1060804195 9:126564463-126564485 GCTGGACAGTGGCTGGTGACAGG - Intergenic
1185950994 X:4434117-4434139 GCCAGAACCTTGCTGGACACAGG + Intergenic
1190768113 X:53492409-53492431 AGGGGAAAGCTGCTGGTCACTGG + Intergenic