ID: 975800813

View in Genome Browser
Species Human (GRCh38)
Location 4:78057690-78057712
Sequence TTTCCGGCGAGATTTTGACG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 16
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 15}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975800808_975800813 0 Left 975800808 4:78057667-78057689 CCCATCGGCCAGTGACCAGCAAC 0: 1
1: 0
2: 0
3: 1
4: 66
Right 975800813 4:78057690-78057712 TTTCCGGCGAGATTTTGACGCGG 0: 1
1: 0
2: 0
3: 0
4: 15
975800811_975800813 -8 Left 975800811 4:78057675-78057697 CCAGTGACCAGCAACTTTCCGGC 0: 1
1: 0
2: 0
3: 3
4: 61
Right 975800813 4:78057690-78057712 TTTCCGGCGAGATTTTGACGCGG 0: 1
1: 0
2: 0
3: 0
4: 15
975800806_975800813 21 Left 975800806 4:78057646-78057668 CCGAGGGAAATGCTGGAAGATCC 0: 1
1: 0
2: 0
3: 15
4: 155
Right 975800813 4:78057690-78057712 TTTCCGGCGAGATTTTGACGCGG 0: 1
1: 0
2: 0
3: 0
4: 15
975800809_975800813 -1 Left 975800809 4:78057668-78057690 CCATCGGCCAGTGACCAGCAACT 0: 1
1: 0
2: 0
3: 7
4: 75
Right 975800813 4:78057690-78057712 TTTCCGGCGAGATTTTGACGCGG 0: 1
1: 0
2: 0
3: 0
4: 15
975800805_975800813 22 Left 975800805 4:78057645-78057667 CCCGAGGGAAATGCTGGAAGATC 0: 1
1: 0
2: 0
3: 19
4: 192
Right 975800813 4:78057690-78057712 TTTCCGGCGAGATTTTGACGCGG 0: 1
1: 0
2: 0
3: 0
4: 15

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975800813 Original CRISPR TTTCCGGCGAGATTTTGACG CGG Exonic
905205454 1:36340611-36340633 TTTGAGCCGAGATTTTGAAGTGG - Exonic
1076416843 10:130297305-130297327 TTTACGGCCAGATTTTGGGGGGG - Intergenic
1084065003 11:66698991-66699013 TTTCCTGCAAGATTGTCACGAGG - Exonic
1108013884 13:46052714-46052736 CTTCCGGCGGCATTTTGAGGCGG - Exonic
1159814741 18:73059009-73059031 TTTCTGGTGAGATTTTGGAGAGG + Intergenic
1163189540 19:15666501-15666523 TTTCCAGGGAGATATTGAAGGGG + Intergenic
940310529 2:152274106-152274128 TTTACGGCCAGATTTTGGGGGGG + Intergenic
946986999 2:225284642-225284664 TTTCCACCCAGATTTTGAGGTGG + Intergenic
947333727 2:229057753-229057775 TTTCCAGGGAGATGTTGACAAGG + Intronic
966978782 3:185110550-185110572 TTTATGGCCAGATTTTGAGGGGG - Intronic
975800813 4:78057690-78057712 TTTCCGGCGAGATTTTGACGCGG + Exonic
987466113 5:18274042-18274064 TTTCTGTCAAGATTTTGATGAGG + Intergenic
994343292 5:98657157-98657179 TTACCGGGGTGATTTTGAAGAGG + Intergenic
1005062078 6:21785936-21785958 TTTCCGGCTAGTTTTTGTCTAGG + Intergenic
1051516101 9:17932078-17932100 TTTCCTGCCAGATTTTGTTGTGG + Intergenic
1058281301 9:103118558-103118580 TTTCCGGCTAGGTTTTAATGTGG - Intergenic